added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:11:30.000Z
|
sjf7fncws3dwvdpatppk2shstymju62z
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68837",
"uncompressed_offset": 638437391,
"url": "www.panarmenian.net/eng/news/116740/",
"warc_date": "2013-11-22T14:35:20.000Z",
"warc_filename": "<urn:uuid:3bd9b783-201c-4e85-b115-eef85b83603a>",
"warc_url": "http://www.panarmenian.net/eng/news/116740/"
}
|
cccc_CC-MAIN-2013-20
|
Heavy clashes reported in Syria’s Aleppo
PanARMENIAN.Net - There have been heavy clashes between security forces and rebels in Syria's second city of Aleppo, activists say, according to BBC News.
The fighting was centred on the Salah al-Din district, but had also spread to Sakhur and Haydariya, the Syrian Observatory for Human Rights reported.
Aleppo has so far been spared the daily bloodshed seen in other cities since the uprising began in March 2011.
The violence came a day after the UN Security Council voted to extend the UN observer mission for a "final" 30 days.
Activists said the clashes in Aleppo between troops and members of the rebel Free Syrian Army (FSA) began in Salah al-Din on Friday July 20 morning. By Friday afternoon, they had spread into Sakhur and Haydariya.
Aleppo-based activist Mohammed Saeed said the fighting continued throughout the night until Saturday morning, most of it in Salah al-Din.
"Last night was very bad," he told the Associated Press. "There were huge explosions and the gunfire didn't stop for several hours." "The uprising has finally reached Aleppo," he added.
Mr Saeed said dozens of FSA fighters had entered from the countryside. Aleppo is not far from Turkey, where the FSA commanders are based.
The Local Co-ordination Committees, an activist network, said there had been an "exodus" of Salah al-Din residents "because of fear of a regime bombardment and offensive".
Partner news
Top stories
Jorge Rafael Videla, an austere former army commander, led Argentina during the bloodiest days of its Dirty War dictatorship.
According to the United Nations, April was Iraq's bloodiest month for almost five years, with 712 people killed.
Reports suggest the rebel fighters may have tried to blow up the walls of the prison, which holds some 4,000 inmates.
Moscow has condemned other nations for supporting rebel forces and failing to condemn what it describes as terrorist attacks on the Syrian regime.
Partner news
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:20:16.000Z
|
dwmyj6ri5hzidjemouwk5ph5evqzcisj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68839",
"uncompressed_offset": 646575795,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0032.tlg007.perseus-eng1%3A7.5.35",
"warc_date": "2013-11-22T14:35:20.000Z",
"warc_filename": "<urn:uuid:3bd9b783-201c-4e85-b115-eef85b83603a>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0032.tlg007.perseus-eng1:7.5.35"
}
|
cccc_CC-MAIN-2013-20
|
[35]
When all this was finished, he first called the magi and requested them, inasmuch as the city had been taken by the sword, to select sanctuaries and the first fruits of the booty for the gods. Next he distributed the private houses and official residences among those whom he considered to have had a share in what had been achieved; and he made the division in the way that had been decided upon—the best to the most meritorious. And if any one thought he had less than he should, he bade him come and explain his reasons for thinking so.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (1910)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hide References (3 total)
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0032.tlg007.perseus-eng1:7.5.35
Document URN: urn:cts:greekLit:tlg0032.tlg007.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:00.000Z
|
5ce3rmldtvxybvxcwhftriqtwennts54
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68840",
"uncompressed_offset": 646596368,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0526.tlg001.perseus-eng1%3A7.117",
"warc_date": "2013-11-22T14:35:20.000Z",
"warc_filename": "<urn:uuid:3bd9b783-201c-4e85-b115-eef85b83603a>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0526.tlg001.perseus-eng1:7.117"
}
|
cccc_CC-MAIN-2013-20
|
[117] THIS were the honors that such as were left of Saul's and Jonathan's lineage received from David. About this time died Nahash, the king of the Ammonites, who was a friend of David's; and when his son had succeeded his father in the kingdom, David sent ambassadors to him to comfort him; and exhorted him to take his father's death patiently, and to expect that he would continue the same kindness to himself which he had shown to his father. But the princes of the Ammonites took this message in evil part, and not as David's kind dispositions gave reason to take it; and they excited the king to resent it; and said that David had sent men to spy out the country, and what strength it had, under the pretense of humanity and kindness. They further advised him to have a care, and not to give heed to David's words, lest he should be deluded by him, and so fall into an inconsolable calamity. Accordingly Nahash's [son], the king of the Ammonites, thought these princes spake what was more probable than the truth would admit, and so abused the ambassadors after a very harsh manner; for he shaved the one half of their beards, and cut off one half of their garments, and sent his answer, not in words, but in deeds. When the king of Israel saw this, he had indignation at it, and showed openly that he would not overlook this injurious and contumelious treatment, but would make war with the Ammonites, and would avenge this wicked treatment of his ambassadors on their king. So that king's intimate friends and commanders, understanding that they had violated their league, and were liable to be punished for the same, made preparations for war; they also sent a thousand talents to the Syrian king of Mesopotamia, and endeavored to prevail with him to assist them for that pay, and Shobach. Now these kings had twenty thousand footmen. They also hired the king of the country called Maacah, and a fourth king, by name Ishtob; which last had twelve thousand armed men.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (B. Niese, 1892)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0526.tlg001.perseus-eng1:7.117
Document URN: urn:cts:greekLit:tlg0526.tlg001.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:59.000Z
|
fppuamw7demeac4qyzhrqem2ck7j66yk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68860",
"uncompressed_offset": 804405340,
"url": "www.werelate.org/wiki/Givenname:Eleazar",
"warc_date": "2013-11-22T14:35:20.000Z",
"warc_filename": "<urn:uuid:3bd9b783-201c-4e85-b115-eef85b83603a>",
"warc_url": "http://www.werelate.org/wiki/Givenname:Eleazar"
}
|
cccc_CC-MAIN-2013-20
|
Givenname:Eleazar
Watchers
the text in this section is copied from an article in Wikipedia
Eleazar (meaning God's assistance, El-azar) is a common Jewish given name for a male.
This page uses content from the English Wikipedia. The original content was at Eleazar (name). The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:03:15.000Z
|
4lonr4hf4lso5wfmpcf6mpa4egqel5jr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68861",
"uncompressed_offset": 804420806,
"url": "www.werelate.org/wiki/Place:Gunter%2C_Hastings%2C_Ontario%2C_Canada",
"warc_date": "2013-11-22T14:35:20.000Z",
"warc_filename": "<urn:uuid:3bd9b783-201c-4e85-b115-eef85b83603a>",
"warc_url": "http://www.werelate.org/wiki/Place:Gunter%2C_Hastings%2C_Ontario%2C_Canada"
}
|
cccc_CC-MAIN-2013-20
|
Place:Gunter, Hastings, Ontario, Canada
Watchers
NameGunter
TypeCommunity
Coordinates44.881°N 77.544°W
Located inHastings, Ontario, Canada
See alsoCashel, Hastings, Ontario, Canadatownship in which Gunter located until 2001
Tudor and Cashel, Hastings, Ontario, Canadamunicipality in which Gunter located since 2001
Gunter is a "dispersed rural community" in the former Cashel Township on the eastern side of Hastings County in southeastern Ontario, Canada.
Since 2001 the community of Gunter has been located in the municipality named the Township of Tudor and Cashel.
Research Tips
The primary source for basic documents (vital statistics, land records, wills) for people who lived in the Province of Ontario is the Archives of Ontario, 134 Ian Macdonald Blvd, Toronto, Ontario, Canada M7A 2C5.
Early Records
Civil registration did not begin in the province until 1869. Before then there may be church records of baptisms and burials. For the most part these are still held by the denomination who recorded them. Copies of marriage records made pre-1869 had to be sent by individual clergymen to the registrar of the county in which the marriage took place. These marriage records are available through Ontario Archives, on micorfilm through LDS libraries, and on paid and unpaid websites, but because they were copied at the registrars' offices, they cannot be considered a primary source.
Vital Records after 1869
Birth, marriage and death registrations are not open to the public until a specific number of years after the event occurred. Births to 1914 are now available [October 2012]; dates for marriages and deaths are later. Birth and death registration was not universally carried out in the early years after its adoption. Deaths were more apt to be reported than births for several years. The more rural the area, the less likely it would be that these happenings were reported to the authorities.
Images and indexes of civil registrations for the "viewable" years can be found on paid websites, and indexes only on FamilySearch. The latest year published is not yet available online. The FamilySearch Wiki on Ontario Vital Records explains how these records are organized and their availability.
Land Records and Wills
Information on how to access land records and wills is best sought on the Archives of Ontario website. An ancestor's land holding might be found on Canadian County Atlas Digital Project if he was in occupancy circa 1878.
Association for the Preservation of Ontario Land Registry Office Documents (APOLROD). A list of Land Registry Offices for all Counties of Ontario.
Censuses
The original censuses are in the hands of Library and Archives Canada. All of the original census (1851-1911) images are online with the exception of that for 1861. Not all of them are indexed. Later censuses are not yet available. Census divisions were redrawn as the population increased and more land was inhabited.
Other websites, some paid and some free, also provide Canadian census originals and/or indexes online. One can view censuses on microfilm at the Archives of Ontario or at big libraries throughout Canada.
E-books and Books
• The Internet Archive, particularly texts from Canadian universities, can contain interesting material
• Our Roots is a Canadian website similar to The Internet Archive
• Global Genealogy is an online bookshop specializing in Ontario material who will ship anywhere in the world.
Some websites with more local information on Hastings County
source: Family History Library Catalog
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:18:54.000Z
|
veljnkicaaw2q4g52e5buwmvctawieo5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68880",
"uncompressed_offset": 19317663,
"url": "autisminnb.blogspot.com/2011/01/what-court-of-law-convicted-dr-andrew.html?showComment=1294499521775",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://autisminnb.blogspot.com/2011/01/what-court-of-law-convicted-dr-andrew.html?showComment=1294499521775"
}
|
cccc_CC-MAIN-2013-20
|
Friday, January 07, 2011
What Court of Law Convicted Dr Andrew Wakefield of Fraud?
The "autism" news has been overwhelmed in the past 48 hours with news that Dr Andrew Wakefield committed fraud in conducting and publishing the MMR study which has since been retracted.
I was aware that a medical society tribunal in the UK had found problems with the MMR study but I was unaware that a court of law, or governing medical society tribunal, had found Wakefield guilty of the serious offence of fraud.
If anyone knows which court of law, or governing medical society tribunal, found Dr. Wakefield guilty of fraud could you post a link to this site please?
Thank you.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:11.000Z
|
6jhhdvvjosat56ielzecrl7vmlz2x5u7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68898",
"uncompressed_offset": 46589703,
"url": "ccsenet.org/journal/index.php/ijbm/article/view/1560",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://ccsenet.org/journal/index.php/ijbm/article/view/1560"
}
|
cccc_CC-MAIN-2013-20
|
Discussion on Reader Service Concept in Cataloging under Network Environment
Chunlan Qiu, Yonglin Xiao
Abstract
This paper discusses the relationship among the construction of book storing, literature cataloging and reader service in libraries, and points out that only if the reader service awareness were set up can we do well the cataloging under network environment and improve the use rate of literature information in libraries.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
International Journal of Business and Management ISSN 1833-3850 (Print) ISSN 1833-8119 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:58.000Z
|
frelfney554inorpzlcqqv2ss23dt32r
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68902",
"uncompressed_offset": 55796418,
"url": "cnx.org/content/m11249/latest/content_info",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://cnx.org/content/m11249/latest/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Random Vectors
About: Random Vectors
Module by: Don Johnson. E-mail the author
View the content: Random Vectors
Metadata
Name: Random Vectors
ID: m11249
Language: English (en)
Subject: Mathematics and Statistics, Science and Technology
Document Type: -//CNX//DTD CNXML 0.5 plus MathML//EN
License: Creative Commons Attribution License CC-BY 1.0
Authors: Don Johnson (dhj@rice.edu)
Copyright Holders: Don Johnson (dhj@rice.edu)
Maintainers: Mariyah Poonawala (mariyah@rice.edu), Kyle Clarkson (kclarks@gmail.com), Kevin Duh (kevinduh@rice.edu), Elizabeth Gregory (elizabeth.gregory@gmail.com), Don Johnson (dhj@rice.edu), Eileen Krause (erkrause@rice.edu), Jeffrey Silverman (JSilverman@astro.berkeley.edu)
Latest version: 1.2 (history)
First publication date: May 13, 2003 7:00 pm -0500
Last revision to module: Aug 8, 2003 2:02 pm -0500
Downloads
PDF: m11249_1.2.pdf PDF file, for viewing content offline and printing. Learn more.
EPUB: m11249_1.2.epub Electronic publication file, for viewing in handheld devices. Learn more.
XML: m11249_1.2.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Source Export ZIP: m11249_1.2.zip ZIP containing the module XML plus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.2 Aug 8, 2003 2:02 pm -0500 by Charlet Reedstrom
Changes:
changed markup of conjugate, transpose, cdf, covariance and variance, fixed typo
Version: 1.1 Jun 10, 2003 12:00 am -0500 by Elizabeth Gregory
Changes:
adding Jeff as a maintainer (module not complete)
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 1.0), you must include
• the authors' names: Don Johnson
• the title of the work: Random Vectors
• the Connexions URL where the work can be found: http://cnx.org/content/m11249/1.2/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 1.0) of this work:
American Chemical Society (ACS) Style Guide:
Johnson, D. Random Vectors, Connexions Web site. http://cnx.org/content/m11249/1.2/, Aug 8, 2003.
American Medical Assocation (AMA) Manual of Style:
Johnson D. Random Vectors [Connexions Web site]. August 8, 2003. Available at: http://cnx.org/content/m11249/1.2/.
American Psychological Assocation (APA) Publication Manual:
Johnson, D. (2003, August 8). Random Vectors. Retrieved from the Connexions Web site: http://cnx.org/content/m11249/1.2/
Chicago Manual of Style (Bibliography):
Johnson, Don. "Random Vectors." Connexions. August 8, 2003. http://cnx.org/content/m11249/1.2/.
Chicago Manual of Style (Note):
Don Johnson, "Random Vectors," Connexions, August 8, 2003, http://cnx.org/content/m11249/1.2/.
Chicago Manual of Style (Reference, in Author-Date style):
Johnson, D. 2003. Random Vectors. Connexions, August 8, 2003. http://cnx.org/content/m11249/1.2/.
Modern Languages Association (MLA) Style Manual:
Johnson, Don. Random Vectors. Connexions. 8 Aug. 2003 <http://cnx.org/content/m11249/1.2/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:33.000Z
|
4kzfjownqwqbedfrrsguaythncbrtsga
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68903",
"uncompressed_offset": 55832340,
"url": "cnx.org/content/m34325/1.2/content_info",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://cnx.org/content/m34325/1.2/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Response to Roger Bagnall paper: Integrating Digital Papyrology
About: Response to Roger Bagnall paper: Integrating Digital Papyrology
Module by: Peter Robinson. E-mail the author
View the content: Response to Roger Bagnall paper: Integrating Digital Papyrology
Metadata
Name: Response to Roger Bagnall paper: Integrating Digital Papyrology
ID: m34325
Language: English (en)
Subject: Arts
Keywords: digital, Egypt, Egyptian, history, humanities, online, papyrology, papyrus, research, scholarship
License: Creative Commons Attribution License CC-BY 3.0
Authors: Peter Robinson (p.m.robinson@bham.ac.uk)
Copyright Holders: Peter Robinson (p.m.robinson@bham.ac.uk)
Maintainers: Frederick Moody (fred.moody@rice.edu), Ben Allen (fmstack@gmail.com)
Editors: Frederick Moody (fred.moody@rice.edu), Ben Allen (fmstack@gmail.com)
Latest version: 1.2 (history)
First publication date: Apr 3, 2010 6:16 pm -0500
Last revision to module: May 14, 2010 5:38 am -0500
Downloads
PDF: m34325_1.2.pdf PDF file, for viewing content offline and printing. Learn more.
XML: m34325_1.2.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.2 May 14, 2010 5:38 am -0500 by Ben Allen
Changes:
added buybutton
Version: 1.1 May 1, 2010 9:30 pm -0500 by Frederick Moody
Changes:
Metadata; final proofing.
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Peter Robinson
• the title of the work: Response to Roger Bagnall paper: Integrating Digital Papyrology
• the Connexions URL where the work can be found: http://cnx.org/content/m34325/1.2/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Robinson, P. Response to Roger Bagnall paper: Integrating Digital Papyrology, Connexions Web site. http://cnx.org/content/m34325/1.2/, May 14, 2010.
American Medical Assocation (AMA) Manual of Style:
Robinson P. Response to Roger Bagnall paper: Integrating Digital Papyrology [Connexions Web site]. May 14, 2010. Available at: http://cnx.org/content/m34325/1.2/.
American Psychological Assocation (APA) Publication Manual:
Robinson, P. (2010, May 14). Response to Roger Bagnall paper: Integrating Digital Papyrology. Retrieved from the Connexions Web site: http://cnx.org/content/m34325/1.2/
Chicago Manual of Style (Bibliography):
Robinson, Peter. "Response to Roger Bagnall paper: Integrating Digital Papyrology." Connexions. May 14, 2010. http://cnx.org/content/m34325/1.2/.
Chicago Manual of Style (Note):
Peter Robinson, "Response to Roger Bagnall paper: Integrating Digital Papyrology," Connexions, May 14, 2010, http://cnx.org/content/m34325/1.2/.
Chicago Manual of Style (Reference, in Author-Date style):
Robinson, P. 2010. Response to Roger Bagnall paper: Integrating Digital Papyrology. Connexions, May 14, 2010. http://cnx.org/content/m34325/1.2/.
Modern Languages Association (MLA) Style Manual:
Robinson, Peter. Response to Roger Bagnall paper: Integrating Digital Papyrology. Connexions. 14 May 2010 <http://cnx.org/content/m34325/1.2/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:25.000Z
|
ukn5xse35oc7vcvp7rhxzhtx2hda3vt6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68916",
"uncompressed_offset": 80804002,
"url": "dotnetkicks.com/stories/28446/A_Whirlwind_Tour_through_the_Managed_Extensibility_Framework_MEF",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://dotnetkicks.com/stories/28446/A_Whirlwind_Tour_through_the_Managed_Extensibility_Framework_MEF"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
A Whirlwind Tour through the Managed Extensibility Framework (MEF)
0
kicks
A Whirlwind Tour through the Managed Extensibility Framework (MEF) (Unpublished)
From a hotel lobby in the sunny city of Durban, South-Africa, waiting for my plane transfer after a great TechEd Africa event. Why not write a blog post on one of my talks: the Managed Extensibility Framework, or MEF. As we steam ahead to release .NET 4.0, it’s great to see the amount of new APIs that will make it into this release. I had the opportunity to talk on three of those the past few days: * The Dynamic Language Runtime (System.Dynamic) with dynamic support in C# and VB, and dynamic languages like IronPython and IronRuby. * New additions for parallel programming (Task Parallel Library, PLINQ, Coordination Data Structures). * The Managed Extensibility Framework (System.ComponentModel.Composition).
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:11:23.000Z
|
fl4u2b7o6nqrtmw3wufsafekqomiwgwd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68923",
"uncompressed_offset": 87031626,
"url": "elinux.org/index.php?action=history&title=ECE497_Notes_on_Ubuntu_and_Audio_Cape",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://elinux.org/index.php?title=ECE497_Notes_on_Ubuntu_and_Audio_Cape&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Revision history of "ECE497 Notes on Ubuntu and Audio Cape"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:27.000Z
|
x24jrdivmqjwqi4bwgxowdzsw2h65cmz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68932",
"uncompressed_offset": 96001375,
"url": "familysearch.org/learn/wiki/en/Netherlands_Web-sites",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://familysearch.org/learn/wiki/en/Netherlands_Web-sites"
}
|
cccc_CC-MAIN-2013-20
|
Netherlands Web-sitesEdit This Page
From FamilySearch Wiki
Netherlands Homepage
Note: The Genlias website is offline as of January 1st. 2013. The role of national genealogical platform has been taken over by the website WieWasWie. The data from Genlias are largely included in WieWasWie.nl$. As of 2009, Genlias contained 13.5 million records, representing almost 55 million individuals.
Overview
Have you always wanted to know from whom you are descended? Genlias gives you a quick way to find your Dutch forebears, both in the Netherlands and overseas. Your search is in the most accurate source for Dutch genealogy, the Civil Register. And it is not difficult!
GenLias is a national Dutch database containing information for use in genealogical research. It is a joint initiative by the national archive services and the regional historical centres. This means that it is not a database of documents held by the Nationaal Archief.
GenLias holds data from the Civil Register. This is the official record of births, marriages and deaths in the Netherlands. It has existed in most of the country since 1811, but in the province of Limburg somewhat longer. Although GenLias contains a large proportion of this data, not all Dutch local authorities are yet included. Some provinces, such as Zuid-Holland, are still barely represented.
The database also contains some details of baptisms, marriages and deaths maintained by church parishes prior to 1811, as well as memoranda of inheritance from the 19th century.
On the GenLias homepage itself, you can download a detailed summary of the data available. To reach this, click on the "What's in GenLias?" link. Scroll down till you find "Current database status" and click on the orange(!) link. Choose the province and then the town you are looking for. If the town is not there, no records are as yet available on this site. If there are records, it will tell you which time period and what type of records are covered. There are even records included from some of the Dutch colonies.
Statistics 2009 Genlias currently contains 13.5 million records, representing almost 55 million individuals. In 2009 Genlias was visited 2 million times and almost 23 million questions were answered.
Content
The Genlias site includes:
Births (1811 to 1903) Marriages (1811 to 1923) Deaths (1811 to 1953) Death duties - statements of succession
According to the Genlias site:
A record of birth provides you with the following information:
• The name of the child
• The names of the parents
• The exact date of birth
• The place of birth
A record of marriage provides you with the following information:
• The names and ages of the bride and groom
• In most cases, the names of the bride's and the groom's parents
• In most cases, the places of birth of the bride and groom
• Whether the bride is a widow or the groom a widower
• In most cases the profession of groom and/or bride
A record of death provides you with the following information:
• The name of the deceased
• The exact date of death
• In most cases, the name of the deceased's parents
• In most cases, the age of the deceased
• In some cases, the deceased's place of birth
• In some cases, the name of the deceased's spouse
Using the Genilas Site
When you first visit the Genlias site, it will initially come up in Dutch. If you want to view it in English, click 'English' at the top of the home page.
Cost
Most genealogical websites in the Netherlands are free.
If you want to find genealogical websites in the Netherlands, search this website: Genealogie in Nederlandse provinciën
Other genealogical websites in the Netherlands include:
• Digital Resources Here you can find web-sites for every province on a regional as well as local levels.
• Centraal Bureau voor Genealogie The CBG is the ideal starting point for most research into Dutch ancestors or Dutch migrants who settled in other countries in the world.
Check your family name in our online catalogue inside the frame at the top right hand corner and find corresponding entries into our collections. For catalogue information click catalogue. In our digital reading room you have access to an increasing number of digitized collections.
Some specific web-sites:
For more information on vital records see also "Civil Registration" or "Church Records"
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 26 April 2013, at 15:06.
• This page has been accessed 1,064 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:20:34.000Z
|
2uwo4fghnfo4tjkob6q4ouyigpuqjfgp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68990",
"uncompressed_offset": 195887218,
"url": "openwetware.org/index.php?oldid=572547&title=McClean%3A_NIS_Elements_Repair",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://openwetware.org/index.php?title=McClean:_NIS_Elements_Repair&oldid=572547"
}
|
cccc_CC-MAIN-2013-20
|
McClean: NIS Elements Repair
From OpenWetWare
Revision as of 14:59, 13 December 2011 by Megan N McClean (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Contents
Overview
On occasion "funny" things happen with the NIS Elements software/drivers. For example, every time you mark a stage position the stage goes all the way to the left hand bottom corner regardless of what position you marked. When this happens it is time to run the repair utility.
Protocol
• Open the Windows Start menu
• Choose All Programs
• Choose NIS-Elements 3.2 64-bit
• Choose Modify Installation
Click Repair, Next
If prompted to restart, restart the computer
Notes
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input! Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
1. *Megan N McClean When I can't age my dissection plates on my bench for a few days, I will stick them in the 30°C or 37°C warm room the morning of the day I dissect to dry them out a little bit. It is absolutely infuriating, if not impossible, to try dissection on plates that are wet.
2. *Megan N McClean Different tetrad dissection protocols call for using different enzymes to digest the ascus wall. Our protocol uses a β-glucuronidase from Sigma (G7770) which is a mixture of enzymes derived from Helix pomatia (the Roman snail). Zymolyase, another commonly used enzyme, consists mostly of β-1,3-glucan laminaripentaohydrolase. It hydrolyzes glucose polymers at the β-1,3-glucan linkages releasing laminaripentaose as the principal product. β-glucuronidase catalyzes hydrolysis of β-D-glucuronic acid residues from the non-reducing end of mucopolysaccharides (also referred to as glycosaminoglycans).
References
Adapted from Maitreya Dunham's protocol (http://dunham.gs.washington.edu/sporulationdissection.htm) and the Botstein lab protocol (http://www.princeton.edu/genomics/botstein/protocols/Sporulation_and_Tetrad_Dissection.pdf)
Contact
or instead, discuss this protocol.
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:51:54.000Z
|
wttztnk7qsyzu4wn4yo7dsslrtah7hzt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:68999",
"uncompressed_offset": 213675477,
"url": "quotationsbook.com/quote/15391/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/15391/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
A fellow who is always declaring that he's no fool, usually has his suspicions. Mizner, Wilson
This quote is about fools and foolishness · Search on Google Books to find all references and sources for this quotation.
A bit about Mizner, Wilson ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:21:08.000Z
|
gucl4ohfswysel6jzjil75mu2u2ew5om
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69000",
"uncompressed_offset": 213681682,
"url": "quotationsbook.com/quote/20728/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/20728/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
The greatest enemy of individual freedom is the individual himself. Alinsky, Saul
This quote is about individuality · Search on Google Books to find all references and sources for this quotation.
A bit about Alinsky, Saul ...
Saul Alinsky off the cover of Let Them Call Me Rebel: Saul Alinsky, His Life and Legacy by Sanford D. Horwitt.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:04:54.000Z
|
dj6wegr2fcwdbslfwhe6iqm2443zjx6d
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69001",
"uncompressed_offset": 213687874,
"url": "quotationsbook.com/quote/32563/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/32563/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
How soon not now, becomes never. Luther, Martin
This quote is about procrastination · Search on Google Books to find all references and sources for this quotation.
A bit about Luther, Martin ...
Martin Luther (November 10, 1483 February 18, 1546) was a German theologian, an Augustinian monk, and an ecclesiastical reformer whose teachings inspired the Reformation and deeply influenced the doctrines and culture of the Lutheran and Protestant traditions. Luther's call to the Church to return to the teachings of the Bible led to the formation of new traditions within Christianity and to the Counter-Reformation, the Catholic reaction to these movements. His contributions to Western civilization went beyond the life of the Christian Church. His translations of the Bible helped to develop a standard version of the German language and added several principles to the art of translation. His hymns inspired the development of congregational singing in Christianity. His marriage on June 13, 1525, to Katharina von Bora began a movement of clerical marriage within many Christian traditions.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:53:13.000Z
|
nuppemdimu5zpxm7no4tuy3irlj6qe7b
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69002",
"uncompressed_offset": 213694689,
"url": "quotationsbook.com/quote/40825/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/40825/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
In a narrow circle the mind grows narrow. The more one expands, the larger their aims. Schiller, Johann Friedrich Von
This quote is about vision · Search on Google Books to find all references and sources for this quotation.
A bit about Schiller, Johann Friedrich Von ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:55.000Z
|
gly57gfkd2zwkhfgkicxyrikv5yiyqgo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69003",
"uncompressed_offset": 213705957,
"url": "quotationsbook.com/quote/gift/39529/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/gift/39529/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Though we travel the world over to find the beautiful, we must carry it with us or we find it not. Emerson, Ralph Waldo
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:02:18.000Z
|
rxwadqjttdzbjtfuw7gqjhplkihaygtu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69004",
"uncompressed_offset": 213711471,
"url": "quotationsbook.com/quote/gift/4727/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://quotationsbook.com/quote/gift/4727/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
A book is a part of life, a manifestation of life, just as much as a tree or a horse or a star. It obeys its own rhythms, its own laws, whether it be a novel, a play, or a diary. The deep, hidden rhythm of life is always there -- that of the pulse, the heart beat. Miller, Henry
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:27.000Z
|
bhdtz2a227i23cks5h6lskuhn7qknt7k
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69007",
"uncompressed_offset": 220179304,
"url": "robots.net/person/jstrohm/diary.html?start=0",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://robots.net/person/jstrohm/diary.html?start=0"
}
|
cccc_CC-MAIN-2013-20
|
Older blog entries for jstrohm (starting at number 0)
4 May 2003 (updated 5 May 2003 at 16:09 UTC) »
I'm new here. As I try to build my robot I'd like to get more involved in the robot "scene". I've been programming for over 20 years, but never done much with hardware except build my own computers. I'm currently trying to build a 4 legged self-contained walking robot using air muscles. I know it's a big project, but I rarely like to start simple on stuff that I do. I've been playing around and planning it for the last year and have slowly tested different parts to use in the bot. I still have a long way to go.
X
Share this page
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:21.000Z
|
s4oftyap3hxk6ze6kcyeawbat3osr65o
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69034",
"uncompressed_offset": 257353019,
"url": "talk.maemo.org/showthread.php?t=28363",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://talk.maemo.org/showthread.php?t=28363"
}
|
cccc_CC-MAIN-2013-20
|
Thread Tools Search this Thread
Posts: 11 | Thanked: 3 times | Joined on Dec 2007 @ montreal
#1
i have a scruffy old n800 for sale in montreal, qc, canada.
unit is in good working order. running chinook. 4 days of standby with wifi off. at least 3 hours of use with wifi on and power saving off (the only way it stays connected with my crappy dlink wep router). if you prefer decreased battery performance, i will flash it to diablo.
scratched screen, missing stylus, lower voltage nokia phone charger (takes longer to charge than the original charger).
$100 obo
Thread Tools Search this Thread
Search this Thread:
Advanced Search
Forum Jump
All times are GMT -4. The time now is 06:00 AM.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:14.000Z
|
2xu7xrpcf2soe2vb6pufee3jrpy2ydse
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69058",
"uncompressed_offset": 289434265,
"url": "wikitravel.org/shared/Special:RecentChangesLinked/Category:Yas_Island",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://wikitravel.org/shared/Special:RecentChangesLinked/Category:Yas_Island"
}
|
cccc_CC-MAIN-2013-20
|
"Wikitravel has a speed and convenience the books' publishers can only envy." Time Europe
Changes related to "Category:Yas Island"
Jump to: navigation, search
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 09:33, 18 May 2013
Page name:
No changes on linked pages during the given period.
Personal tools
Namespaces
Variants
Views
Actions
Navigation
RSS
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:24.000Z
|
etzs34ei6vetx6miapgxf2mawcdkiisq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69059",
"uncompressed_offset": 289454626,
"url": "wikitravel.org/wiki/en/index.php?oldid=1769608&title=Ayodhya",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Ayodhya&oldid=1769608"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Ayodhya
From Wikitravel
Asia : South Asia : India : Plains : Uttar Pradesh : Awadh : Ayodhya
Revision as of 04:44, 19 October 2011 by 173.254.204.131 (Talk)
Jump to: navigation, search
For other places with the same name, see Ayodhya (disambiguation).
Ayodhya is an ancient city and the old capital of Awadh, in Uttar Pradesh in India.
Understand
• Regional Tourist Office, House No. 1-3/152/4, near Pusparaj Guest House, Civil Lines, Faizabad, UP. Phone: (05278) 223214.
• Government of UP Assistant Tourist Office, Pathik Niwas Saket, Near Railway Station, Ayodhya. Phone: (05278) 232435.
Get in
By air
Faizabad has an Airport at Naka, near Dr. Ram Manohar Lohia University, but no regular airlines services are available. Nearest airport is Lucknow (about 130 km).
By train
Trains are available from Delhi, Lucknow, Varanasi and Allahabad.
Ayodhya is 6 km from Faizabad on banks of Saryu River, birth place of Lord Rama
By land
The city is about 130 km from Lucknow, 200 km from Varanasi, 160 km from Allahabad, 140 km from Gorakhpur and about 636 km from Delhi. Buses are frequently available from Lucknow, Delhi and Gorakhpur. Buses are also available from Varanasi, Allahabad and other places.
Get around
See
• Ramkot, (In the western part of the city). The chief place of worship in Ayodhya is the site of the ancient citadel of Ramkot which stands on an elevated ground. Although visited by pilgrims throughout the year, this sacred place attracts devotees from all over India and abroad on Ram Navami, the day of Lord's birth, which is celebrated with great pomp and show, in the Hindu month of Chaitra (March-April).
• Nageshwarnath Temple, (On the bank of the river, on the east side of town). 5AM-11AM, noon-8PM. It is said to be built by Khush, Lord Rama's son. Legend has it that he almost destroyed the water-living Nagas (semi-divine snake people) because he suspected them of stealing his amulet. Only Lord Shiva's intervention saved the semi-divine snakes. Khush then established this temple showing the Nagas worshipping Lord Shiva, his father's favourite deity. Another version of this legend states that the lost amulet was found by a Nag-kanya (young girl from the Naga tribe), who fell in love with him, and as she was Lord Shiva's devotee he constructed this temple for her.
• Lakshmana Ghat, (On the banks of the Sarayu river). This is where Rama's brother Lakshman is said to have voluntarily given up his life-an act called samadhi. Another version says that he gave up living after he broke a vow.
• Mani Parbat. A former Buddhist vihara (cave with cells) that became a Hindu temple. It is dotted with little shrines and if you stand on the topmost terrace you get a splendid view of Ayodhya, one that includes a cluster of small white buildings at the base of the hill that turns out to be a Muslim graveyard.
• Swarg Dwar. According to mythology, Lord Rama is said to have transformed himself into Lord Mahavishnu and left for Vaikunth.
• Mani Parbat and Sugriv Parbat. The first of these ancient earth mounds is identified with a stupa built by the Emperor Ashoka, while the second is believed to be an ancient monastery.
• Treta ke Thakur. It is a temple that stands at the place where Rama is said to have performed the Ashwamedha Yagna. The Raja of Kulu is said to have built a new temple here about 300 years ago called Kaleram ka Mandir, where the idols of Lord Rama, Sita, Lakshman and Bharat have reportedly been carved out of a single block of black sandstone. These idols are supposed to be from the original Rama temple, which once stood on the banks of the River Sarayu.
• Hanuman Garhi, (Right in the center of the town). Visitors to Ayodhya must make a move towards Hanuman garhi. It is a massive structure in the shape of a four sided fort with circular bastions at each corner. The temple is highly revered for its imposing architecture and its religious value.
• Kanak Bhawan, (Near Hanuman Garhi). The Bhawan is frequented by scores of visitors every year. The temple is widely known for the images of Sri Rama and Sita wearing gold crowns and because of this the Bhawan is also referred to as Sone-ka-Ghar.
• Vijayraghaw temple. It is one of the best temple in Ayodhya, build in 2008. In this temple god Ram presented in 12 faces called Viswa-virat(world's big). This temple made by red marbles and stainless steel.
• Choti chawni. A very big temple made by 100% white marble.
Do
Ayodhya being a sacred religious place, has lots to offer to a spiritual mind. Some of the fairs and festivals Ayodhya is famous for are
• Ram Lila. The enactment of the story of Lord Rama is believed to have been started by great Saint Tulsidas. The Ramcharitmanas, written by him till today forms the basis of Ram Lila performances. In some places, Rama Lila is associated with Vijayadashmi celebrations in late September and early October and also with Rama Navami, the birthday of Lord Rama. Ram lila, basically an enactment of a myth, is presented as a cycle-play with the story varying from 7 to 31 days. The Rama Lila performance evokes a festive atmosphere and enables observance of religious rites. It is also rich in performance of crafts such as costume jewellery, masks, headgear, make-up and decoration. The four main Ram Lila styles are the pantomimic style with a predominance of jhankis based style with multi-local staging; the operative style which draws its musical elements from the folk operas of the region and the stage, Ram Lila of the professional troupes called mandalis. Ayodhya is popular for mandali Ram Lila. The performance is dialogue – based and presented on a platform stage. High standard of performance is complemented by songs and kathak dances and eye-catching décor.
• Ram Navmi Mela. Ayodhya, the holy city of the sacred pilgrim centre of Hindus plays host to the Ram Navmi Festival in the month of April. Thousands of worshippers gather to venerate the Lord at Kanak Bhawan.
• Sravan Jhula Mela. This mela celebrates the playful spirit of the deities. On the third day of the second half of Shravan, images of the deities (specially of Rama, Lakshman and Sita) are placed in swings in the temples. They are also taken to Mani Parvat, where the idols are made to swing from the branches of the trees. Later the deities are brought back to temples. The mela lasts till the end of the month of Shravan.
• Parikramas. Ayodhya is perhaps the most noted place in the northern India where parikramas are undertaken by Hindu Pilgrims. These are circumambulations of important religious places and are of varying duration, shortest being the `Antargrahi Parikrama’ which has to be completed within a day. After taking a dip in the Saryu, the devotee commences the parikarma from the Nageshwarnath temple and passes through Rama Ghat, Sita Kund, Manipuravata and Brahma Kund, finally terminating at Kanak Bhawan. Then there is the `Panchkoshi Parikrama’ circuit of 10 miles, which touches Chakratirtha, Nayaghat, Ramghat, Saryubagh, Holkar-ka-pura, Dashrathkund, Jogiana, Ranopali, Jalpa Nala and Mahtabagh. On the way the people pay homage to deities in the shrines which are situated on the route.
• Chaturdashkoshi Parikrama. Constitutes a circular journey of 28 miles made once a year on the occasion of Akshainaumi, which is completed within 24 hours.
Buy
You can buy Ramnama towel, chundri, kurta and handicraft bags, tulsi mala, ramdana, Ramayana, books, sweet ball (laddoo).
Eat
Options are limited to local eateries/restaurants which offer largely vegetarian food.
You can get wines,water,fruite juice,cold drinks etc to drink.
Sleep
Ayodhya
• Birla Dharamshala, (Bus Station), 05278-232252.
• Gujrat Bhawan Dharamshala, (near Bus Station), 05278-232075.
• Hanubagh Trust......shankar. Has AC and non-AC rooms available with breakfast, lunch, dinner at very low cost. * Jain Dharamshala, (Rai Ganj), 05278-232308.
• Janaki Mahal Trust Dharamshala.
• Niskaam Sewa Aasram. Adjacent to Hanuman Bag trust, janki mahal road (Parikrama Marg). Ayodhya, all types of room available ac/nonac in very low cost with breakfast, lunch and dinner.contact-(+91)9795966108.email manishaydg27@gmail.com Excellent Ashram like environment. In-charge - Ramchandra Das
• Pandit Banshidhar Dharamshala, (Naya Ghat).
• Pathik Niwas Saket, (Near Railway Station), 05278-232435. UP Tourism Accommodation.
• Ram Anugsah Vishram Sadan, Chhoti Chhawani Marg, 05278-223142, 223146.
• Ram Charit Manas Trust Dharamshala.
• Ram Dham Guest House, (near Railway Station Road), 05278-232791.
• Sarvan Kunj, (+91)9044787391. Have many room available for sleep, travel guide and many facilities.
• Sri Ram Hotel, (near Dant Dhawan Kund), 05278-232512, 232474.
Faizabad
Quality accommodation is available at Faizabad town, just 7 km away
• Abha Hotel, Moti Bagh, Faizabad, 05278-222930, 222550.
• Hotel Alka Raje, Rekabganj, Faizabad, 05278-222027.
• Avantika Hotel, Civil Lines, 05278-220472.
• Hotel Krishna Palace, 05278-221367-70.
• Hotel Shan-e-Awadh, Civil Lines, Faizabad, 05278-223586, 222075.
• Tirupati Hotel, Civil Lines, Faizabad, 05278-223231/222448.
Contact
Get out
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:34.000Z
|
ewpceacvazsjypzgley7siqyz7e7yuhw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69060",
"uncompressed_offset": 289478449,
"url": "wikitravel.org/wiki/en/index.php?oldid=1330287&title=Talk",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Talk&oldid=1330287"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Talk
From Wikitravel
Revision as of 13:12, 23 December 2009 by Pashley (Talk | contribs)
Jump to: navigation, search
This article is a travel topic
Using English
English is very much a world language — it is taught as a second language in many places — and it is possible to travel almost anywhere using only English.
Nearly anywhere, if you stay in heavily-touristed areas and pay for a good hotel, enough of the staff will speak English to make your trip painless. Nearly anywhere, you can hire an English-speaking guide and translator--especially if you take care of it beforehand. Travelling this way may not be as cheap or as interesting as it could be, but it will be relatively easy.
English-speaking percent of population by country
For a business trip, paying for good hotels and guides or translators may be the best strategy; the convenience and ability to get things done are more important than cost. For a backpacker on a tight budget, this is not a good strategy; coping with language difficulties should be considered part of the adventure. Many travellers fall somewhere between; they may choose a hotel where English is spoken, but they will also have linguistic adventures in the markets.
Regional languages
In many areas, it is very useful to learn some of a regional language. This is much easier than trying to learn several local languages, and is generally more useful than any one local language. Even in really out-of-the-way places, you should at least be able to find hotel staff and guides who speak the regional language well.
The world's major regional languages
Regional languages that are used in many countries are Russian for Central Asia and the Caucasus, Arabic for the Middle East and North Africa, French for parts of Europe and Africa, and Spanish for most of Latin America. Other languages such as Portuguese, Mandarin, Hindi, German, Persian, and Swahili are important for particular areas.
Regional languages are often useful somewhat beyond the borders of their region. Some Russian is spoken in Northern China, some German in Turkey, and so on.
Language as a reason for travel
It is fairly common for language to be part of the reason for various travel choices.
• Some travellers choose destinations based partly on the language. For example, an English speaker might choose to visit Malaysia rather than Thailand or Jamaica rather than Mexico because it is easier to cope with a country where English is widely spoken.
• Others may choose a destination where a language they want to learn or improve is spoken; see Language tourism.
• Still others may use language teaching as a method of funding their travel; see Teaching English.
Language is almost never the only reason for these choices, but it is sometimes a major factor.
Coping without a language
There are several ways to cope with travel in countries where English is not spoken. Perhaps another language will work.
• Learn some of the local language. It will rarely be practical to learn a language for one trip, but bring a phrasebook! Learning the basics of pronunciation, greetings, how to ask directions, and numbers (for transactions) can be enough fulfill nearly all the essentials of travel on your own, and can be a fun activity on long flights or bus delays.
• Try a regional language.
• Try any other languages you speak. Older Chinese often speak Russian, some Turks and Arabs speak good French or German, and so on.
• Try simple English: Keep sentences short. Use the present tense. Use single words and hand gestures to convey meaning.
If none of those work for your situation, you can just smile a lot and use gestures. It is amazing how far this can take you; many people are extremely tolerant.
It is also fairly common in things like negotiating a price to write down numbers or key them into a calculator for display to the other party.
Widely used expressions
A few English words may be understood anywhere, though which ones will vary from place to place. For example, "OK" and "bye-bye" are used in Chinese and many Chinese speakers also know "hello" and "thank you". Unless you are dealing with educated people, however, that may well be the extent of their English.
French words also turn up in other languages. "Merci" is one way to say "thank you" in Persian.
English idioms may also be borrowed. "ta-ta" is common in India, for example.
Abbreviations like CD and DVD are often the same in other languages. "WC" for toilet seems to be widely used, both in English and on signs, in various countries, though never in English-speaking ones.
Words from the tourist trade, such as hotel, taxi and menu, may be understood by people in that line of work, even if they speak no other English.
Some words have related forms across the Muslim world.
• "Thank you" is shukran in Arabic, tashekur in Turkish, shukria in Urdu.
• The word for peace, used as a greeting, is shalom in Hebrew, salaam in Arabic, salamat in Indonesian.
Even if you use the form from another language, you might still be understood.
Some loanwords may be very similar in a number of languages. For example, "sauna" (originally from Finnish) sounds similar in Chinese and English among other languages. Naan is Persian for bread; it used in several Indian languages, though the recipe varies.
The word for tea is approximately "chai" across most of Asia (Hindi, Russian, Persian, Turkish, ...), "cha" in standard Mandarin and Cantonese (albeit with different tones) and "teh" in the Minnan dialect (in fact, the English word tea was derived from teh).
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:55.000Z
|
if7wklu4gxc3zh5isszsyafxxrcbir5u
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69067",
"uncompressed_offset": 301029570,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/91DF2D5EA397EE31CA25711F001470A7",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/91DF2D5EA397EE31CA25711F001470A7?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1292.0 - Australian and New Zealand Standard Industrial Classification (ANZSIC), 2006 (Revision 1.0)
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 19/09/2008
Page tools: Print Page RSS Search this Product
Division P EDUCATION AND TRAINING
Subdivision 80 PRESCHOOL AND SCHOOL EDUCATION
Group 801 PRESCHOOL EDUCATION
Class 8010 Preschool Education
This class consists of units mainly engaged in providing accredited pre-primary school education. Pre-school programs are educational in nature and are designed to introduce children to ideas, attitudes and behaviour required in a school environment. They are usually directed at children aged three to five years, are generally sessional in nature and are provided by staff that have training in an educational field.
Primary activities
• Kindergarten, preschool, operation (except child minding centre)
• Playcentre operation (NZ only)
• Pre-school operation
Exclusions/References
Units mainly engaged in
• providing pre-primary school education in conjunction with normal primary school education are included in Class 8021 Primary Education; and
• providing child minding or day nursery services are included in Class 8710 Child Care Services.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:21.000Z
|
cn7laq7tnjdg53xjihqs5qk3sgq4il4g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69068",
"uncompressed_offset": 301036841,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/90AE3040E103143BCA2574560014C2A2",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/90AE3040E103143BCA2574560014C2A2?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
6250.0 - Labour Force Status and Other Characteristics of Migrants, Australia, Nov 2004
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/06/2005
Page tools: Print Page Print All RSS Search this Product
ABOUT THIS PUBLICATION
This publication presents information about the labour force status and other characteristics of 'migrants'. For the purposes of this publication, migrants are defined as people who were born overseas, arrived in Australia after 1984, were aged 15 years and over on arrival, and have permanent Australian resident status. Information is also provided for people who were temporary residents who planned to stay in Australia for 12 months or more. See the Glossary for more information.
The statistics in this publication were compiled from data collected in the Labour Force Status and Other Characteristics of Migrants survey that was conducted throughout Australia in November 2004 as a supplement to the Australian Bureau of Statistics (ABS) monthly Labour Force Survey (LFS).
NOTES ABOUT THE ESTIMATES
A number of new data items relating to the residency status (including visa types) of the respondent have been included in this publication. These are 'Residency status as at November 2004', 'Residency status on most recent arrival to live in Australia', 'Type of visa as at November 2004', 'Type of visa on most recent arrival to live in Australia', 'Type of permanent visa before becoming an Australian citizen', 'Whether an Australian citizen as at November 2004' and 'Whether main applicant or whether arrived with main applicant'. The data items 'Whether had family or friends in Australia just before migration', 'All family in Australia just before migration' and 'Migration category' used in the 1999 publication have been dropped as the information was not collected in the 2004 survey.
ROUNDING
As estimates have been rounded, discrepancies may occur between sums of the component items and totals.
INQUIRIES
For further information about these and related statistics, contact the National Information and Referral Service on 1300 135 070 or Labour Market Section on Canberra (02) 6252 7206.
SUMMARY OF FINDINGS
OVERVIEW
In November 2004, the Australian civilian population aged 15 years and over comprised 15,745,200 people (excluding institutionalised people and boarding school pupils; and people in very remote parts of Australia). Of these people 4,342,600 (28%) were born overseas.
There were 1,559,700 people who were born overseas, arrived in Australia after 1984, and were aged 15 years and over on arrival. This represents 10% of the civilian population aged 15 years and over. Of these, 1,362,600 (87%) were migrants, that is, people who were born overseas, who arrived in Australia after 1984, were aged 15 years and over on arrival and had obtained permanent Australian resident status prior to or after their arrival. The remainder were either temporary residents who planned to stay in Australia for 12 months or more (11%) or those whose status was not able to be determined (2%).
Of those overseas born people who arrived in Australia after 1984 and were aged 15 years and over on arrival, 61% were the main applicant on the application form.
MIGRANTS
In November 2004, there were 1,362,600 migrants. The majority (68%) were born in other than main English speaking countries, and most (87%) were aged 15-44 years on arrival in Australia.
There were 337,300 migrants who had a temporary visa on their most recent arrival to live in Australia, and had obtained a permanent visa by November 2004. Of those who had obtained a permanent visa, 45% were in the family stream.
Employment
In November 2004, 66% of migrants were employed, compared to 64% of those born in Australia. Of those migrants who were employed, 73% had a job just before arrival, and approximately 56% of these had changed their major occupation grouping since arriving in Australia. Male migrants were more likely to be employed (80%) than female migrants (55%).
Unemployment
In November 2004, the unemployment rate for migrants was 5.6% and 4.9% for those born in Australia. The rate for male and female migrants was 5.1% and 6.2% respectively. This compares with 4.9% for males and females born in Australia.
Labour force participation
The labour force participation rates for male and female migrants were 83.9% and 58.6%. For males and females born in Australia, participation rates were 74.7% and 60.2% respectively.
Migrants who were born in main English-speaking countries had a higher participation rate (78.9%) than those born in other than main English-speaking countries (66.2%).
Qualifications
Just over half (51%) of migrants arrived in Australia without a non-school qualification. Of the 661,100 who arrived with a non-school qualification, 57% arrived with a Bachelor Degree or higher and 54% had their overseas qualifications recognised in Australia.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:14:22.000Z
|
tc2x3gy2gsp6sfxcbfwhgdiy22qvtevf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69069",
"uncompressed_offset": 301045482,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=Dec+2008&prodno=8752.0&prodno=8752.0&tabname=Past+Future+Issues&viewtitle=Building+Activity%2C+Australia~Dec+2008~Previous~17%2F04%2F2009",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/second+level+view?ReadForm&prodno=8752.0&viewtitle=Building%20Activity,%20Australia~Dec%202008~Previous~17/04/2009&tabname=Past%20Future%20Issues&prodno=8752.0&issue=Dec%202008&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8752.0 - Building Activity, Australia, Dec 2008 Quality Declaration
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/04/2009
Past Releases
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:23:24.000Z
|
dafztyq6ceu26d4iichxcnlwximurzd5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69070",
"uncompressed_offset": 301052771,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Latestproducts/1376.0Main%20Features3502013?issue=2013&prodno=1376.0&tabname=Summary",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Latestproducts/1376.0Main%20Features3502013?opendocument&tabname=Summary&prodno=1376.0&issue=2013&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1376.0 - Local Government and ABS, 2013
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 28/02/2013
Page tools: Print Page Print All RSS Search this Product
REVIEW OF REGIONAL DEVELOPMENT AUSTRALIA COMMITTEE 2010-11 REGIONAL PLANS
Introduction
Population
Further information
INTRODUCTION
Staff from the ABS have been working on a research paper, ‘A Review of Regional Development Australia Committee 2010-2011 Regional Plans: Issues Identified by Regions’. The paper summarises selected aspects of regional plans in 2010 and 2011 from all 55 Regional Development Australia (RDA) committees. These plans aim to set out the economic, environmental and social vision of the region. They also identify the drivers of change and identify the regions strengths, weaknesses and opportunities.
The population issues contained in the paper have been reproduced here as a sample of the full report.
POPULATION
Population Growth
The most commonly raised population issue – reported by 45 regions – was a current or predicted rapid growth in population. Forty-one RDA committees reported concern about the strain a rapidly increasing population would place on infrastructure and service provision, including housing, transport, health, education and water. The potential impact of urban expansion on the natural environment, amenity and the availability of agricultural land was also frequently raised.
Uneven distribution of population growth, both geographically and seasonally, was an issue raised by thirteen RDA committees. Some committees reported that expected growth in regional centres coupled with decline in smaller communities would lead to a withdrawal of services and further disadvantage in those small towns. Some committees also reported that seasonal variations in population, mainly due to fly-in, fly-out workers and a high number of tourists in summer, put further pressure on local facilities and services.
Population Ageing
Forty-four RDA committees reported that their population was ageing. Various economic and welfare challenges were associated with an ageing population. The potential impacts included an increased demand for aged care services, health care, smaller housing types, transport and community infrastructure, as well as a shrinking labour force which may exacerbate labour shortages.Youth Retention
The retention of young people was an issue in many regions. Thirty-seven RDA committees reported experiencing an out-migration of youth aged 15 to 30 years who leave the region to pursue education, training and employment opportunities and because of a lack of recreational facilities.
Population Decline
The issue of population decline and sustainability in rural and remote areas was raised by nineteen RDA committees. These committees reported that better strategies were needed to attract and retain residents to prevent the withdrawal of services and to ensure that these areas remained viable and economically productive.
Other issues that the paper discusses are:
• Economic issues including the Global Financial Crisis (GFC), high Australian dollar, carbon tax and environmental legislation.
• Environmental issues including climate change, water supply, conservation and other issues or concern.
• Social issues including education, health, employment, housing, youth support, regional governance and socio-economic disadvantage.
• Infrastructure issues including transport infrastructure, funding and logistical issues, communications infrastructure, community infrastructure, energy infrastructure, water infrastructure and waste infrastructure.
• Data issues focus on gaps that may have been identified throughout the research project.
FURTHER INFORMATION
To read the full paper, please refer to Research Paper: A Review of Regional Development Australia Committee Regional Plans, 2013.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:01.000Z
|
n5lr7g55xpd4pqfk37b6p6ujpipqvbx4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69077",
"uncompressed_offset": 381546916,
"url": "www.ccsenet.org/journal/index.php/ibr/article/view/15907",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.ccsenet.org/journal/index.php/ibr/article/view/15907"
}
|
cccc_CC-MAIN-2013-20
|
Effects of Strategic Performance Appraisal, Career Planning and Employee Participation on Organizational Commitment: An Empirical Study
Danlami Sani Abdulkadir, Sulu Babaita Isiaka, Salami Isaac Adedoyin
Abstract
Despite the recent research efforts into the antecedents of organizational commitment most especially in the developed economies, little empirical work has been conducted examining the effect of some human resource management practices such as performance appraisal system, career planning system and employee participation on organizational commitment. In this article, we examined the effect of these human resource management practices in explaining employee job commitment in the Nigerian banking sector. Based on a survey of 14 banks in Nigeria, the study applies regression analysis, correlation analysis and G-test in testing the hypotheses. Results indicate that performance appraisal system, career planning system and employee participation significantly influence employee job commitment and that the level of organizational commitment of employees in the Nigerian banking sector is low. The study therefore, recommends that for employees to be genuinely committed to their jobs, organizations should make conscious efforts at strategically managing performance appraisal, career planning and employee participation with a view to ensuring effective implementation and achieving desired results.
Full Text: PDF DOI: 10.5539/ibr.v5n4p124
This work is licensed under a Creative Commons Attribution 3.0 License.
International Business Research ISSN 1913-9004 (Print), ISSN 1913-9012 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:49.000Z
|
ppdcwqguknqizjihq6cypbzexazboqdi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69080",
"uncompressed_offset": 381567433,
"url": "www.ccsenet.org/journal/index.php/jmr/article/view/5942",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.ccsenet.org/journal/index.php/jmr/article/view/5942"
}
|
cccc_CC-MAIN-2013-20
|
Predict GARCH Based Volatility of Shanghai Composite Index by Recurrent Relevant Vector Machines and Recurrent Least Square Support Vector Machines
Phichhang Ou, Hengshan Wang
Abstract
A new machine learning method so called Relevant Vector Machine (RVM) is an efficiently learning technique for classification
and regression problems, including financial time series forecasting. One of the main advantages is that the model
is treated by Bayesian approach and its functional form is identical to a powerful prediction tool Support Vector Machine.
In this paper, we propose a new recurrent algorithm of the relevant vector machine to predict GARCH (1,1) based volatility
of Shanghai composite index. The recurrent support vector machine, recurrent least square support vector machine and
normal GARCH (1,1) models are also employed to make a comparison with the proposed model. Our empirical results
show that the proposed approach generates superior forecasting performance.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Journal of Mathematics Research ISSN 1916-9795 (Print) ISSN 1916-9809 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:42.000Z
|
2bqiichy2fl5csjjjfbjxh4dyvitavg3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69082",
"uncompressed_offset": 409708168,
"url": "www.crummy.com/2000/04/30/1",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.crummy.com/2000/04/30/1"
}
|
cccc_CC-MAIN-2013-20
|
< Previous
Next >
: Susanna's notebook is up and on the new system. Jake, I'll get the gang's notebook on the new system probably Tuesday. I really need to get ready for my collab.net interview tomorrow. The main reason I spent most of today wrestling with NewsBruiser was so I'd have a decent-sized OO project to show them.
You can download a tar.gz of NewsBruiser here.
[Main] [Edit]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:50.000Z
|
465c3ihvjoljdxqlk2ofgmk4f6b6tbbz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69083",
"uncompressed_offset": 409711067,
"url": "www.crummy.com/2006/10/14/0",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.crummy.com/2006/10/14/0"
}
|
cccc_CC-MAIN-2013-20
|
< Previous
Elemental >
Some Lists of Games: We went to Connecticut today -- a totally different state -- and then came back. Doesn't make sense.
NES games: Top 100, bottom 20 with obviousness filters applied. All selections arbitrary.
Filed under:
[Main] [Edit]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:10.000Z
|
fgxikjizjsyqwnhdsachd3k24txtc3j3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69084",
"uncompressed_offset": 409713966,
"url": "www.crummy.com/2008/7/4/1",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.crummy.com/2008/7/4/1"
}
|
cccc_CC-MAIN-2013-20
|
< "He said to take any rug in the house."
Next >
The Truth Is Out There: Oh, here's the real reason the PVR was overheating. I didn't take the little plastic condom off the heatsink before installing it. So the CPU wasn't actually sinking much heat--it was just shrink-wrapping the heatsink. I removed the plastic and there was some slight loss of thermal compound, but everything seems to be working fine now.
As you can tell, I don't put together a lot of computers these days.
[Main]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:31:24.000Z
|
fv77a4fdogjsztd7aqavj5huqvyvwymf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69091",
"uncompressed_offset": 459321410,
"url": "www.familysearch.org/learn/wiki/en/Arthingworth,_Northamptonshire",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Arthingworth,_Northamptonshire"
}
|
cccc_CC-MAIN-2013-20
|
Arthingworth, NorthamptonshireEdit This Page
From FamilySearch Wiki
England Northamptonshire Northamptonshire Parishes
Contents
Parish History
ARTHINGWORTH (St. Andrew), a parish, in the union of Market-Harborough, hundred of Rothwell, N. division of the county of Northampton, 4½ miles (S. by E.) from Harborough. [1]
Resources
Civil Registration
Birth, marriages and deaths were kept by the government, from July 1837 to the present day. The civil registration article tells more about these records. There are several Internet sites with name lists or indexes. A popular site is FreeBMD.
Church records
Marriages from 1654 to 1700 are indexed in Northamptonshire Marriage Index Pre-1700 (2nd ed.). FHL British CD-ROM no. 5489; publisher's bookstore.
Contributor: Include here information for parish registers, Bishop’s Transcripts, non conformist and other types of church records, such as parish chest records. Add the contact information for the office holding the original records. Add links to the Family History Library Catalog showing the film numbers in their collection
Census records
Census records from 1841-1891 are available on film through a Family History Center or at the Family History Library. The first film number is 438880. To view these census images online, they are available through the following websites for a fee ($) or free:
• FamilySearch has some of the British Censuses available.
• FindMyPast ($) has all available census records including images, and is free at Family History Centers and the Family History Library and some public and academic libraries.
• Ancestry.co.uk ($) has now all available census records but free at Family History Centers and the Family History Library and at numerous public and academic libraries. The library versions are known as AncestryInstitution.com.
• The Genealogist.co.uk ($) has all available censuses and is free at Family History Centers and the Family History Library and various other libraries.
• FreeCen is a UK census searches. It is not complete and individuals are always asked to consider helping out with transcriptions.
Probate records
Records of wills, administrations, inventories, indexes, etc. were filed by the court with jurisdiction over this parish. Go to Northamptonshire Probate Records to find the name of the court having primary jurisdiction. Scroll down in the article to the section Court Jurisdictions by Parish.
Maps and Gazetteers
Maps are a visual look at the locations in England. Gazetteers contain brief summaries about a place.
Web sites
References
1. Lewis, Samuel A., A Topographical Dictionary of England (1848), pp. 73-77 Date accessed: 27 February 2013.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 27 February 2013, at 21:37.
• This page has been accessed 233 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:02:31.000Z
|
qehxnyt3hzuhjo4hnbun5thxhjol7shz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69092",
"uncompressed_offset": 459334700,
"url": "www.familysearch.org/learn/wiki/en/Cojedes_Archives_and_Libraries",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Cojedes_Archives_and_Libraries"
}
|
cccc_CC-MAIN-2013-20
|
Cojedes Archives and LibrariesEdit This Page
From FamilySearch Wiki
VenezuelaCojedes ► Cojedes Archives and Libraries
Bibliography & Literature
Archives & Libraries
National Archives and Libraries
Archivo General de la Nación
Avenida Urdaneta, Esquinas Santa Capilla y Carmelitas No-15
Telfs: +58-212-862.99.07
Caracas – Venezuela
Apartado Postal 1010 – A
E-mail: archiven@reaccium.ve
Biblioteca Nacional
Final Av. Panteón Foro Libertador, Edificio Sede
Parroquia Altagracia,
Caracas 1010 – Venezuela
Teléfono: +58-212-505.91.25
Fax: +58-212-505.91.24
State and Provincial Archives
Public and University Libraries
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 11 November 2012, at 22:43.
• This page has been accessed 84 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:22:37.000Z
|
hyxrgmxrtlawxchqherrfmdcclsbk5og
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69105",
"uncompressed_offset": 514767165,
"url": "www.hindawi.com/journals/ijdsn/2012/942080/",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.hindawi.com/journals/ijdsn/2012/942080/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
International Journal of Distributed Sensor Networks
Volume 2012 (2012), Article ID 942080, 9 pages
doi:10.1155/2012/942080
Research Article
Improved Virtual Potential Field Algorithm Based on Probability Model in Three-Dimensional Directional Sensor Networks
1College of Internet of Things, Nanjing University of Posts and Telecommunications, Jiangsu High Technology Research Key Laboratory for Wireless Sensor Networks, and Key Lab of Broadband Wireless Communication and Sensor Network Technology, Ministry of Education, Nanjing 210003, China
2College of Computer, Nanjing University of Posts and Telecommunications, Jiangsu High Technology Research Key Laboratory for Wireless Sensor Networks, and Key Lab of Broadband Wireless Communication and Sensor Network Technology, Ministry of Education, Nanjing 210003, China
Received 2 November 2011; Revised 12 March 2012; Accepted 13 March 2012
Academic Editor: Sabah Mohammed
Copyright © 2012 Junjie Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
In conventional directional sensor networks, coverage control for each sensor is based on a 2D directional sensing model. However, 2D directional sensing model failed to accurately characterize the actual application scene of image/video sensor networks. To remedy this deficiency, we propose a 3D directional sensor coverage-control model with tunable orientations. Besides, a novel criterion for judgment is proposed in view of the irrationality that traditional virtual potential field algorithms brought about on the criterion for the generation of virtual force. Furthermore, cross-set test is used to determine whether the sensory region has any overlap and coverage impact factor is introduced to reduce profitless rotation from coverage optimization, thereby the energy cost of nodes was restrained and the performance of the algorithm was improved. The extensive simulations results demonstrate the effectiveness of our proposed 3D sensing model and IPA3D (improved virtual potential field based algorithm in three-dimensional directional sensor networks).
1. Introduction
The sensory ability of WSNs to physical world is embodied in coverage which is often used to describe the monitoring standard of Quality of Service (QoS) [1, 2]. Coverage optimization in sensor networks plays a significant role in allocating network space, realizing context awareness and information acquisition, and enhancing the viability of networks [3].
Early studies on coverage optimization were based on two-dimensional sensory domain model [4, 5], or 0-1 probability sensory model. For instance, the virtual force algorithm (VFA) proposed by Zou and Chakrabarty [6] moves nodes after all nodes’ moving paths have been determined. The authors of [7] proposed an approximate centralized greed algorithm to solve the maximum coverage problem with minimum sensors. Coverage in terms of the number of targets to be covered is maximized, whereas the number of sensors to be activated is minimized. The target involved virtual force algorithm (TIVFA) is proposed by Li et al. [8] and potential field-based coverage-enhancing algorithm (PFCEA) aiming at directional sensor model is proposed by Tao et al. [9]. The authors of [10] discussed multiple directional cover sets problem of organizing the directions of sensors into a group of nondisjoint cover sets in each of which the directions cover all the targets so as to maximize the network lifetime. In [11], which is written by me, I improved the criterion for judging the generation of virtual potential field via cross-set test. However, probability-based three-dimensional sensor networks model is more tending to be in conformity with practical application, for example, the recently arisen multimedia sensor networks [3, 1216] and underwater networks [17]. In view of three-dimensional sensory model and probability sensory model, overseas and domestic researchers have yielded some research achievements on coverage algorithms in recent years. I proposed a virtual force algorithm which is applicable with three-dimensional omnidirectional sensory model in [18]. Authors of [19] put forward a three-dimensional directional sensory model and optimized coverage performance using virtual potential field and simulated annealing algorithm. Reference [20] proposed a coverage configuration algorithm based on probability detection model (CCAP). Reference [21] proposed a coverage preservation protocol based on probability detection model (CPP) that makes working nodes in sensor networks as few as possible when network coverage is guaranteed. However, this protocol configures network using centred control algorithm which limits the network scale, and at present most of the literatures have not introduced this probability coverage model into three-dimensional sensor networks. In fact, most practical applied wireless sensor networks are deposited in three-dimensional sensor networks so that it will be more accurate if it is simulated in a three-dimensional space [22, 23]. In [22], Bai et al. proposed and designed a series of connected coverage model in three-dimensional wireless sensor networks with low connectivity and full coverage. In [23], Alam and Haas studied truncated octahedron deployment strategy to monitor network coverage situation. But in most studies, the criterion for the generation of repulsion between two points is simply defined as the situation that the distance between nodes is less than twice the sensory radius, which has been proved inappropriate to directional sensor networks in [11] by me. Therefore, first we analyze the sensory ability of three-dimensional directional sensor based on probability model to design a novel direction-steerable three-dimensional directional sensor model and make use of virtual potential algorithm to adjust node direction to improve coverage effect. In particular, in this paper we proposed a more rational criterion for generation of repulsion in three-dimensional directional sensor networks and introduced a factor called coverage impact factor to estimate the impact on network coverage from the change of sensing direction in advance, to reduce profitless adjustment of sensing direction, save node energy, enhance algorithm performance, and optimize coverage effect.
This paper is organized as follows: Section 2 gives the problem description and related definition. Section 3 describes the improved virtual potential field-based algorithm in three-dimensional directional sensor networks based on probability model. Section 4 describes in detail the algorithm flow. Section 5 verifies the validity of the algorithm via simulation experiments and makes contrast. Section 6 draws conclusion.
2. Coverage Enhancement Issues of Three Directional Sensor Networks
2.1. Problem Formulation
The coverage enhancement issue of three directional sensor networks that is constituted by direction-steerable nodes can be described as follow: how to enhance the degree of coverage by changing the sensing direction so that degree of coverage in target area approaches maximum in condition that a certain number of nodes are randomly distributed in a given three-dimensional target area and part of the area is not covered by nodes and the number and position of nodes are stable.
2.2. Analysis and Definitions on Coverage Enhancement Issue in Directional Sensor Networks
For the purpose of later research, we give the consumptions beforehand, shown as follows.(1)Every node works independently, namely, sensory task of each node does not depend on others’.(2) All nodes are isomorphic, namely, all the maximum sensory distance , sensory deviation angle , and communication radius are equal, respectively, and the communication radius is no less than twice of the maximum sensory distance.(3) Every node can get the information of its location and sensing direction and the direction is steerable.
Limited by the angle of view, the sensory area of the directional sensor model is abstracted to a tetrad in three-dimensional space. As shown in Figure 1.
Figure 1: Directional sensor model.
Definition 1 (directional sensor model ). is location of nodes, that corresponds to () in a three-dimensional rectangular coordinate system. is maximum sensory distance of nodes. is unit vector of sensing direction, denoted by (), whose direction and central axis of sensory region is collinear. is called sensory deviation angle and .
In particular, when , the sensory region is a sphere thus the traditional omnidirectional sensor model can be considered as a special case of directional sensor model.
Definition 2 (probability detection model). In this part, we define the sensor sensing accuracy model. Sensing accuracy of sensor at point is defined as the probability of sensor to successfully detect an event happening at point . A point here means a physical location in the covered area.
We assume that a sensor can always detect an event happening at the point with distance 0 from the sensor, and the sensing accuracy attenuates with the increase of the distance. One possible sensing accuracy model is [24] where is the sensing accuracy of sensor at point , is the distance between sensor and point , and constants and are device-dependent parameters reflecting the physical features of a sensor. Generally, ranges from 1 to 4. And is used as an adjustment parameter.
Sensor node density is usually higher. Assume that sensor nodes are randomly distributed in a three-dimensional monitoring area. Therefore, events in the monitoring area are detected by multiple sensor nodes simultaneously. The sense probability is expressed as follow:
Substitute into Formula (1)
According to (3), , because multiple sensor nodes may sense the same events simultaneously.
Definition 3 (maximum sensory distance ). The maximum sensory distance of nodes is defined as
In condition of node working independently, if , the probability of node being detected is . In this case, the effect on system detection probability from node to target point can be ignored. is the minimum probability of target found, which is determined by the actual application environment, hardware and software conditions and quality of service required, and other factors. is usually specified by user.
Definition 4 (sensory domain of node ). For ease of later calculation, we translate the directional sensor model in Figure 1 into that in Figure 2 and give the following definition.
The sensory region is part of a sphere that centred on with radius and maximum rotation angle which is denoted by . In other words, sensory region is constituted by all spots that satisfy Formula (1) in which represents spots in space, represents the intersection angle with sensing direction vector
Figure 2: Sensory domain of node.
Definition 5 (Set of neighbor nodes ). In sensor network, two nodes are called neighbors when Euclidean distance is less than twice the maximum sensory distance . The set of neighbor nodes of node is
Definition 6 (-probability coverage). In a set of active nodes located at (), , system detection probability of target point located at () is . If , the target point located at () is satisfied with probability coverage. If all points in a region are satisfied with probability coverage, then this region is called complete probability coverage.
Definition 7 (degree of coverage). A given area is equally divided into small areas which can be assumed as points as is large enough. If there are points in the points that accord with -probability coverage, coverage rate of area is defined as
Definition 8 (coverage impact factor). Coverage impact factor characterizes the impact on network coverage when the sensing direction angle has been changed. We define it as follows: represents the network coverage after node has been changed.
3. The Improved Virtual Potential Field-Based Algorithm in Three-Dimensional Directional Sensor Networks
Taking the deployment cost of sensor network into consideration, it would be unpractical that all nodes are capable of moving. Moreover, the movement of sensor nodes usually causes the invalidation of part of sensor nodes and in turn changes the topology of the whole sensor network. All these factors raise the maintenance cost of network. Therefore, we assume that all nodes remain at the same location as initial and coverage can be enhanced by changing sensing direction of nodes. We introduce the concept of centroid. represents the centroid that is relative to node and locates in a spot in central axis of sensory region with a distance of apart from the node. Now the issue is translated into the virtual force issue between centroids. We assume that there is virtual repulsion between centroids. Under the action of repulsion, two nodes rotate in opposite direction to avoid the formation of sensory overlap region. At the same time of reducing the redundant coverage, a sufficient and efficient coverage of the monitoring area is achieved. Under the action of virtual potential field, every node gets the repulsion from one or more adjacent nodes.
3.1. Judgement on Overlap Situation of Sensory Area
In traditional algorithms, which use the virtual potential field to enhance coverage, the criterion for the generation of repulsion between two points is that the distance between nodes is less than [7] which is applicable to omnidirectional sensor model in that when the distance between nodes is less than , there bound to be some overlap in sensory area. But with regard to directional sensor model, the above conclusion is obviously incorrect. As shown in Figure 3, two nodes are less than apart from each other; however, with no sensory overlapped region for the difference of sensing direction angle. As a case by case, Figure 3 reflects a common situation in many cases which causes profitless adjustment of deployment, wastes energy of nodes, and shortens network lifetime.
Figure 3: A case that distance is less than without overlapped sensory region.
Therefore, in this paper, the criterion for generation of repulsion between two nodes is defined as whether or not there is overlap sensory region between two nodes.
To three-dimensional directional sensor networks model, when judging whether there is overlapped sensory region between two nodes, we project the sensory region onto planes , , and in a three-dimensional rectangular coordinate system. If and only if all projections on three planes has overlapped region, does the sensory region has overlapped region. So the overlap decision problem of three-dimensional sensor model has translated into that of two-dimensional model. I put forward an approach in [11] to decide if there is overlapped region in a two-dimensional directional sensor network model using cross-set test. Reference [25] demonstrates the 11 kinds of overlapped situations of sensory region with two-dimensional directional sensor model, as shown in Figure 4.
Figure 4: The situations of overlap of sensory region in directional sensor model.
We simplify the sectorial sensor model of a two-dimensional space into a triangle by replacing the arc in sector by line, because only under the circumstances of (c) and (d) in Figure 4 can the decision outcome be different. It can be seen in Figure 4 that the area of the overlap region under the two circumstances is small compared to the whole sensory region, so it is inefficient to waste energy and adjust deployment of nodes for that purpose.
After simplifying, we can determine whether the two triangles have overlap region according to whether they have intersecting sides by mean of cross-set test. As shown in Figure 5, a triangle with overlap region must have intersecting sides. For example, in Figure 5, and intersect, the following must be satisfied:
Figure 5: Two sensor models with overlap sensory region.
3.2. Analysis on Regulation of Node Rotation
3.2.1. Analysis on Regulation of Centroids
Nodes and are neighbors, the centroid at location is under action of the repulsion of at location which is defined as follows:
Using the method of Section 3.1, only when there is overlap region between two nodes, repulsion between centroids of two nodes exists. represents the Euclidean distance between centroid and . represents the repulsion coefficient which is a positive constant. represent sensory domain of node . The magnitude of repulsion of centroid is inversely proportional to the Euclidean distance between them and the direction of repulsion that the centroid taking action is determined by the location of and . The resultant force of repulsion at centroid is represents the set of all the neighbors of node .
3.2.2. Analysis on Rotation Angle
The resultant repulse force actions on centroid and node single rotation angle jointly decide the later target location of centroid . Thereby, the later target location of centroid can be described as rotating a certain angle along the direction of resultant force . Use Formula (5) to calculate the coverage impact factor. If , which means the movement is beneficial to coverage optimization, proceed the node rotation. Otherwise, the current sensing direction remain unchanged. Repeatedly, optimal solution approaches by fine adjustment. Meanwhile, we set the force threshold . When , centroid will oscillate repeatedly around a certain point which can be regarded as a stable state of centroid and no more actions is required. When all centroids come to the stable state within the network, the whole sensor network is considered as having reached the stable state.
4. Algorithm Description
According to the virtual force of the centroid of each node, a node deployment adjustment algorithm is proposed as follows in this paper. The algorithm is a distributed algorithm and executes simultaneously in each node. We equally divided the sensing area into small areas. is large enough so that the small areas could be assumed as points. When area degree of coverage is calculated according to formula (7), the target point should be satisfied with -probability coverage. Take node for example, Formalized description of the algorithm is as in Algorithm 1.
Algorithm 1
5. Algorithm Simulations and Performance Analysis
We developed the simulation software Sencov3.0 that applicable to the research of sensor network deployment and coverage with VC++6.0, using which we verify the validity of IPA3D algorithm through extensive simulation experiments. Values of specific parameters are shown in Table 1. We can see from formula (4) that is determined by , , . In all simulation experiments of this paper, we set and , so the value of is only determined by .
Table 1: Experiment parameters.
5.1. Case Study
250 nodes are randomly deployed in a m3 region for monitoring the environment. The maximum sensory distance m and sensory deviation angle . As shown in Figure 6, we record the quality of coverage in directional sensor networks as IPA3D algorithm is running in different time step. The asterisks represent sensor nodes. Due to that the simulation environment is a 3D cube; it is difficult to present the variation of global coverage intuitively from the 3D figure. Therefore, I chose to give the coverage variation of bottom side in Figure 6. During the initialization, only a few nodes cover the bottom of cube, which is shown in Figure 6(a), where the asterisks represent the nodes. Along with the running of IPA3D algorithm, some nodes that did not cover the bottom of the cube at first change their sensing directions, which results in that their sensing region now covers the bottom of the cube. At this moment, new asterisks representing those nodes appear. In a word, no extra nodes are added into that region, neither have they moved. We can see from Figure 6(a), the initial degree of coverage is 45.3%, overlap region and fade zone are significant in network for the randomness of deployment. By means of the optimization algorithm, the direction of nodes adjusts continuously as time goes on, which in consequence improves the network coverage extent, as shown in Figures 6(b) and 6(c). When the time step comes up to 60 times, the degree of coverage reaches 94.29% which increases 49 percentage points to the initial coverage, as shown in Figure 6(d).
Figure 6: Coverage optimization under IPA3D algorithm.
5.2. Algorithm Convergence Analysis
We carry out a group of experiments with five kinds of network node scale so as to analyze IPA3D algorithm convergence. According to every network node scale, we randomly produce 20 topological structures, respectively, and calculate the algorithm convergence times and average. Experimental data are shown in Table 2 with parameters m, .
Table 2: Convergence analysis on experimental data.
Based on the above analysis we can reach a conclusion that the convergence of IPA3D algorithm, that is, the adjustment number of times, does not change conspicuously along with sensor network node scale. The value ranges from 70 to 80; thus IPA3D algorithm has a nice convergence.
5.3. Comparative Analysis of Algorithms
In this section, a series of simulation experiments are conducted to illustrate the effect on the performance of IPA3D algorithm from the three key parameters. They are node scale , maximum sensory distance , and sensory deviation angle . Reference [9] takes traditional basis as the criterion for the generation of repulsion. We compare it to the coverage enhancement algorithm proposed in this paper and analyze their performances.
It can be seen from the curve in Figure 7 that when and are fixed, smaller value leads to less initial degree of coverage. With the increasing of node scale , the value of shows an upward trend. means the difference between the final degree of coverage and the initial state. When , the degree of coverage increases 49 percentage points and afterwards value of decreases to some extent. The reason is that when nodes number reaches a certain scale, optimized network degree of coverage has approached extreme and increase of node number can no longer enhance network coverage conspicuously. Meanwhile, the increase of nodes leads to a higher initial degree of coverage and greatly decreases the probability that several communicational adjacent nodes form coverage fade zone which undoubtedly weakens the performance of IPA3D algorithm.
Figure 7: Effect on node scale on condition of m, .
We can see from the curve in Figures 8 and 9 that the effect on this algorithm from maximum sensory distance of nodes and sensory deviation angle is in accordance with the node scale. When the node scale is fixed, the smaller maximum sensory distance of nodes and sensory deviation angle are, the less possible that adjacent nodes are form an overlap region, and the less improvement is done to the network coverage performance. As the increase of maximum sensory distance of nodes, increases constantly too. The network degree of coverage reaches the climax when and are at a particular value. However, with the increase of the value of and , the probability of creating coverage fade zone becomes smaller which leads to less significant effect on network degree of coverage enhancement.
Figure 8: Effect on maximum sensory distance of nodes on condition of , .
Figure 9: Effect on sensory angle of deviation on condition of m.
As can be seen from Figures 7, 8, and 9 that compared to the PECEA algorithm in [9], under the same parameter value, the proposed IPA3D algorithm increases the coverage quality most significantly after the optimization of the initial deployment, which illustrates the superiority of this algorithm.
5.4. Analysis on Coverage Impact Factor
In this paper, we introduced coverage impact factor and use it to judge the impact on degree of coverage from the change of sensing direction angle and thereby to decide whether the node sensing direction angle should rotate. We illustrate the impact through a series of simulation experiments with m, .
Figure 10 shows the impact from coverage impact factor on algorithm in different node scales. According to three different network node scales, 10 topologic structures are randomly generated. Record the changes of network degree of coverage when algorithm is running and average. From the curves in Figure 10 we can see, in the first 30 loops of algorithm that the degree of coverage increases sharply and exponentially. So adding coverage impact factor or not has little impact on algorithm performance. However, with the increase of algorithm execution time, algorithm degree of coverage without coverage impact factor presents a fluctuating state and overall degree of coverage stops increasing while algorithm degree of coverage with coverage impact factor shows a gentle rising trend and finally reaches stable state with degree of coverage remaining unchanged. The reason is that, without coverage impact factor, the force on a single node is according to neighbor nodes set and the change of sensing direction angle of a single node cannot take the impact on overall network coverage into account and may reduce network degree of coverage. And algorithm with coverage impact factor will evaluate the impact on overall coverage every time before sensing direction is changed to get rid of profitless rotation. Though it may increase algorithm complexity and cost node energy, it is greatly less than the energy cost of profitless rotation which means movements that cannot give beneficial effect to network coverage. As shown in Figure 10, to add coverage impact factor efficiently improved the performance of coverage enhancement algorithm and overcame the fault of the unstable state in later stage.
Figure 10: Impact on algorithm performance from coverage impact factor in different node scale.
6. Conclusions
This paper proposed a probability-based three-dimensional directional sensory model, and based on which a novel criterion for judgment is proposed in view of the irrationality that traditional virtual potential field algorithms brought about on the criterion for the generation of virtual force. Cross-set test was used to determine whether the sensory region has any overlap and coverage impact factor is introduced to reduce profitless rotation from coverage optimization, thereby the energy cost of nodes was restrained and the performance of the algorithm was improved. In simulation experiment, first we verified the convergence of the algorithm and then the effect on the algorithm from the key parameters and the validity of IPA3D were demonstrated by the comparison between IPA3D and PECEA under the effect of key parameters. Also, we confirmed and analyzed the impact on IPA3D algorithm from coverage impact factor through simulation experiment. The proposed algorithm effectively improved the coverage performance of traditional virtual potential field algorithms but the energy consumption caused by the change of sensing direction angle were not taken into account which is for further study.
Acknowledgments
The subject is sponsored by the National Natural Science Foundation of China (Nos. 60973139, 61003039, 61170065, and 61171053), Scientific and Technological Support Project (Industry) of Jiangsu Province (Nos. BE2010197, BE2010198), Natural Science Key Fund for Colleges and Universities in Jiangsu Province (11KJA520001), the Natural Science Foundation for Higher Education Institutions of Jiangsu Province (10KJB520013, 10KJB520014), Academical Scientific Research Industrialization Promoting Project (JH2010-14), Fund of Jiangsu Provincial Key Laboratory for Computer Information Processing Technology (KJS1022), Postdoctoral Foundation (1101011B), Science and Technology Innovation Fund for Higher Education Institutions of Jiangsu Province (CXZZ11-0409), the Six Kinds of Top Talent of Jiangsu Province (2008118), Doctoral Fund of Ministry of Education of China (20103223120007, 20113223110002), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (yx002001).
References
1. S. Meguerdichian, F. Koushanfar, M. Potkonjak, and M. B. Srivastava, “Coverage problems in wireless ad-hoc sensor networks,” in Proceedings of the 20th Annual Joint Conference of the IEEE Computer and Communications Societies (INFOCOM '01), pp. 1380–1387, IEEE Press, New York, NY, USA, April 2001. View at Publisher · View at Google Scholar · View at Scopus
2. D. Tao, Y. Sun, and H. J. Chen, “Worst-case coverage detection and repair algorithm for video sensor networks,” Acta Electronica Sinica, vol. 37, no. 10, pp. 2284–2290, 2009. View at Scopus
3. I. F. Akyildiz, T. Melodia, and K. R. Chowdhury, “A survey on wireless multimedia sensor networks,” Computer Networks, vol. 51, no. 4, pp. 921–960, 2007. View at Publisher · View at Google Scholar · View at Scopus
4. A. Howard, M. J. Mataric, and G. S. Sukhatme, “Mobile sensor network deployment using potential field: a distributed scalable solution to the area coverage problem,” in Proceedings of the 6th International Symposium on Distributed Autonomous Robotics Systems (DARS '02), pp. 299–308, Fukuoka, Japan, June 2002.
5. S. Poduri and G. S. Sukhatme, “Constrained coverage for mobile sensor networks,” in Proceedings of the IEEE International Conference on Robotics and Automation, pp. 165–171, IEEE Press, New York, NY, USA, May 2004. View at Scopus
6. Y. Zou and K. Chakrabarty, “Sensor deployment and target localization in distributed sensor networks,” ACM Transactions on Embedded Computing Systems, vol. 3, no. 1, pp. 61–91, 2004.
7. J. Ai and A. A. Abouzeid, “Coverage by directional sensors in randomly deployed wireless sensor networks,” Journal of Combinatorial Optimization, vol. 11, no. 1, pp. 21–41, 2006. View at Publisher · View at Google Scholar · View at Scopus
8. S. J. Li, C. F. Xu, Z. H. Wu, and Y. H. Pan, “Optimal deployment and protection strategy in sensor network for target tracking,” Acta Electronica Sinica, vol. 34, no. 1, pp. 71–76, 2006. View at Scopus
9. D. Tao, H. D. Ma, and L. Liu, “A virtual potential field based coverage-enhancing algorithm for directional sensor networks,” Journal of Software, vol. 18, no. 5, pp. 1151–1162, 2007. View at Publisher · View at Google Scholar · View at Scopus
10. Y. L. Cai, W. Lou, M. L. Li, and X. Y. Li, “Target-oriented scheduling in directional sensor networks,” in Proceedings of the 26th IEEE International Conference on Computer Communications (INFOCOM '07), pp. 1550–1558, Anchorage, Alaska, USA, May 2007. View at Publisher · View at Google Scholar · View at Scopus
11. J. J. Huang, Y. Shi, L. J. Sun, R. C. Wang, and H. P. Huang, “An improved algorithm of virtual potential field in directional sensor networks,” Key Engineering Materials Journal, vol. 467–469, pp. 1562–1568, 2011. View at Publisher · View at Google Scholar · View at Scopus
12. H. D. Ma and Y. H. Liu, “Correlation based video processing in video sensor networks,” in Proceedings of the IEEE International Conference on Wireless Networks, Communications and Mobile Computing (WirelessCom '05), pp. 987–992, Beijing, China, June 2005. View at Publisher · View at Google Scholar · View at Scopus
13. H. D. Ma and D. Tao, “Multimedia sensor network and its research progresses,” Journal of Software, vol. 17, no. 9, pp. 2013–2028, 2006. View at Publisher · View at Google Scholar · View at Scopus
14. M. C. Zhao, J. Y. Lei, M. Y. Wu, Y. Liu, and W. Shu, “Surface coverage in wireless sensor networks,” in Proceedings of the 28th IEEE Conference on Computer Communications (INFOCOM '09), pp. 109–117, Rio de Janeiro, Brazil, April 2009. View at Publisher · View at Google Scholar · View at Scopus
15. J. Adriaens, S. Megerian, and M. Potkonjak, “Optimal worst-case coverage of directional field-of-view sensor networks,” in Proceedings of the 3rd Annual IEEE Communications Society on Sensor and Ad hoc Communications and Networks (Secon '06), pp. 336–345, September 2006. View at Publisher · View at Google Scholar · View at Scopus
16. M. Cardei, M. T. Thai, Y. Li, and W. Wu, “Energy-efficient target coverage in wireless sensor networks,” in Proceedings of the 24th Annual Joint Conference of the IEEE Computer and Communications Societies (INFOCOM '05), pp. 1976–1984, Boca Raton, Fla, USA, March 2005. View at Scopus
17. Z. Xiao, M. Huang, J. H. Shi, J. Yang, and J. Peng, “Full connectivity and probabilistic coverage in random deployed 3D WSNs,” in Procedings of the International Conference on Wireless Communications and Signal Processing, (WCSP '09), vol. 31, no. 12, pp. 1–4, Kunming, China, November 2009. View at Publisher · View at Google Scholar · View at Scopus
18. J. J. Huang, L. J. Sun, R. C. Wang, and H. P. Huang, “Virtual potential field and covering factor based coverage-enhancing algorithm for three-dimensional wireless sensor networks,” Journal on Communications, vol. 31, no. 9, pp. 16–21, 2010. View at Scopus
19. H. D. Ma, X. Zhang, and A. L. Ming, “A coverage-enhancing method for 3D directional sensor networks,” in Proceedings of the 28th IEEE Conference on Computer Communications (INFOCOM '09), pp. 2791–2795, Rio de Janeiro, Brazil, April 2009. View at Publisher · View at Google Scholar · View at Scopus
20. D. X. Zhang, M. Xu, Y. W. Chen, and S. Wang, “Probabilistic coverage configuration for wireless sensor networks,” in Proceedings of the International Conference on Wireless Communications, Networking and Mobile Computing (WiCOM '06), pp. 1–4, Changsha, China, September 2006. View at Publisher · View at Google Scholar · View at Scopus
21. J. P. Sheu and H. F. Lin, “Probabilistic coverage preserving protocol with energy efficiency in wireless sensor networks,” in Proceedings of the IEEE Wireless Communications and Networking Conference (WCNC '07), pp. 2631–2636, Kowloon, China, March 2007. View at Publisher · View at Google Scholar · View at Scopus
22. X. Bai, C. Zhang, D. Xuan, and W. Jia, “Full-coverage and k-connectivity (k=14,6) three dimensional networks,” in Proceedings of the IEEE Annual Conference on Computer Communications (INFOCOM '09), pp. 145–154, Rio de Janeiro, Brazil, April 2009. View at Publisher · View at Google Scholar
23. S. M. N. Alam and Z. J. Haas, “Coverage and connectivity in three-dimensional networks,” in Proceedings of the 12th Annual International Conference on Mobile Computing and Networking (MOBICOM '06), pp. 346–357, Los Angeles, Calif, USA, September 2006. View at Scopus
24. J. Lu and T. Suda, “Coverage-aware self-scheduling in sensor networks,” in Proceedings of the Annual Workshop on Computer Communications (CCW '03), pp. 117–123, IEEE, California, Calif, USA, October 2003. View at Scopus
25. D. Pescaru, C. Istin, D. Curiac, and A. Doboli, “Energy saving strategy for video-based wireless sensor networks under field coverage preservation,” in Proceedings of the IEEE International Conference on Automation, Quality and Testing, Robotics (AQTR '08), vol. 1, pp. 289–294, Cluj-Napoca, Romania, May 2008. View at Publisher · View at Google Scholar · View at Scopus
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:18:52.000Z
|
g7trema4dgglqlqgzu6z6qf4ro7re6zn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69111",
"uncompressed_offset": 540504315,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1273336"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Letters (Marion Zimmer Bradley's Fantasy, Fall 1991)
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Letters (Marion Zimmer Bradley's Fantasy, Fall 1991)
Author: The Readers
Year: 1991
Type: ESSAY
Series: Letters (Marion Zimmer Bradley's Fantasy)
Language: English
ISFDB Record Number: 1273336
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:57.000Z
|
nvqesuqr44cba2fkrfmouhuwu2tmjhwz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69123",
"uncompressed_offset": 594700815,
"url": "www.mdpi.com/2073-8994/4/3/474",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.mdpi.com/2073-8994/4/3/474"
}
|
cccc_CC-MAIN-2013-20
|
Symmetry 2012, 4(3), 474-506; doi:10.3390/sym4030474
Article
Supersymmetric Sigma Model Geometry
Theoretical Physics, Department of Physics and Astronomy, Uppsala University, Box 516, Uppsala 75120, Sweden
Received: 6 July 2012; in revised form: 23 July 2012 / Accepted: 2 August 2012 / Published: 23 August 2012
(This article belongs to the Special Issue Supersymmetry)
Download PDF Full-Text [467 KB, uploaded 23 August 2012 14:00 CEST]
Abstract: This is a review of how sigma models formulated in Superspace have become important tools for understanding geometry. Topics included are: The (hyper)kähler reduction; projective superspace; the generalized Legendre construction; generalized Kähler geometry and constructions of hyperkähler metrics on Hermitian symmetric spaces.
Keywords: supersymmetry; complex geometry; sigma models
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Lindström, U. Supersymmetric Sigma Model Geometry. Symmetry 2012, 4, 474-506.
AMA Style
Lindström U. Supersymmetric Sigma Model Geometry. Symmetry. 2012; 4(3):474-506.
Chicago/Turabian Style
Lindström, Ulf. 2012. "Supersymmetric Sigma Model Geometry." Symmetry 4, no. 3: 474-506.
Symmetry EISSN 2073-8994 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:56.000Z
|
jweboo6ek75nkrmisxw22va43pj3dy3l
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69134",
"uncompressed_offset": 642177484,
"url": "www.ohloh.net/p/Gravit/contributors/19810536653872",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.ohloh.net/p/Gravit/contributors/19810536653872"
}
|
cccc_CC-MAIN-2013-20
|
Very Low Activity
Contributors : root
Analyzed 6 days ago based on code collected 6 days ago.
Activity on Gravit by root
All-time Commits: 2
12-Month Commits: 0
30-Day Commits: 0
Overall Kudo Rank:
First Commit: 09-Apr-2005
Last Commit: 09-Apr-2005
Names in SCM: root
Commit history:
Recent Kudos...
... for Gravit given by:
There are no kudos for this contributor at this time.
Do you know this contributor?
Ohloh computes statistics about contributors by analyzing their commits on all FOSS projects. We would like to be able to attribute this work to the right person, so if you know the contributor, please help out:
Are you this developer?
Add this position to your profile!
Know this developer?
Send him or her an invite to join Ohloh.
Project Commits
Approximately one year of commit activity shown
Project Languages
Ohloh did not measure any lines of code written by this contributor.
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:42:03.000Z
|
xgycitgpoxizigdi5efc7zkkc6lizd5v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69150",
"uncompressed_offset": 645242833,
"url": "www.openwetware.org/index.php?oldid=184859&title=User%3AEva_Klinman",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.openwetware.org/index.php?title=User:Eva_Klinman&oldid=184859"
}
|
cccc_CC-MAIN-2013-20
|
User:Eva Klinman
From OpenWetWare
Revision as of 21:53, 6 February 2008 by Eva Klinman (Talk | contribs)
Jump to: navigation, search
I am a new member of OpenWetWare!
Contents
Contact Info
Eva Klinman's puppy
I work in the Lodish Lab at MIT, in the Whitehead. I research the role of ADAMs and their substrates in extracellular protein cleavage, based on a screen of different stresses in human Jurkat and mouse Baf3 cells.
Education
• 2006, Winston Churchill High School
• 2010, MIT: Biological Engineering, focus in Neuroscience
Research interests
1. Neurons
2. Alzheimer's disease
3. microRNA
Classes and Research
Course/Minor
Minor: course 9, Neuroscience
Year of Graduation
2010
Email
eklinman AT mit DOT edu
Related Classes
Previously:
• 7.03
• 5.07
• 20.110
• 5.12
Currently:
• 20.109
• 6.00
• 20.310
Lab Work
For three years, I worked at NIH, in the NICHD. I took part in the research being conducted in the lab of Dr. Brant Weinstein, working with vascular morphogenesis in embryonic zebrafish.
Currently, I work with Dr. Andreas Herrlich in the Lodish lab at the Whitehead. We are performing a large-scale high-throughput screen to test the effects a set of shRNAs designed to knock-down most human kinases and phophatases has on ectodomain cleavage. Specifically, we use osmotic stress as a cleavage stimulus to the EGF ligand TGF-alpha. We work in human Jurkat cells, and mouse Baf3 cell lines.
Personal Info
I am familiar with lab environments and tissue culture set-up and usage. I am a very active person, and tend to dance often, and sing or hum without realizing it. If it causes others around me to get annoyed, please make me aware of what I'm doing and ask me to stop!
Outside Activities
• Dance Troupe
• Next Act
• UROP
Useful links
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:26.000Z
|
7iupdtjeve3sfmmy3disx57oojjaqpox
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69152",
"uncompressed_offset": 650532516,
"url": "www.panarmenian.net/eng/news/114668/Monti_says_more_central_control_of_national_budgets_needed",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.panarmenian.net/eng/news/114668/Monti_says_more_central_control_of_national_budgets_needed"
}
|
cccc_CC-MAIN-2013-20
|
Monti says more central control of national budgets needed
PanARMENIAN.Net - A pooling of eurozone countries' debt, in the form of eurobonds, must be accompanied by increased budget control at a European level, Italian Prime Minister Mario Monti said in an interview Wednesday, July 4.
"We need a partial mutualisation of debt, but also more central control of national budgets," Monti told the daily Frankfurter Allgemeine Zeitung, according to AFP.
"Without proper control it would be irresponsible to burden others with a share of your own debt," he said. "Germany and Italy take the same line on this and are prepared to surrender national sovereignty," Monti added.
The interview appeared on the same that day when German Chancellor Angela Merkel is scheduled to meet Monti in Rome following perceived tensions between the two leaders at last week's EU summit.
But Monti played down any differences. "Angela + Mario = a step forward for European economic policy," he said.
"For several months now, the German and the Italian governments have both been working at a number of European summits to steer the EU onto the path of growth while still adhering to budgetary discipline," Monti said.
Monti insisted that Italy "isn't calling for a rescue and isn't calling for eurobonds. Italy is doing everything that is being demanded of it to boost growth."
Monti conceded that his government would not be able to solve the deep structural problems facing Italy in the year and four months his government had left in office. "It's also a question of the economy. If a government such as ours implements the big fiscal adjustments, that will be a burden to the economy in the short term," he said.
Monti and Merkel are scheduled to hold a joint news conference in Rome later on Wednesday.
Partner news
Top stories
IFC invested $244 million in 40 projects across a range of sectors, including financial markets, manufacturing, and mining.
Armenian Prime Minister addressed a letter to Public Services Regulatory Commission over the reconsideration of gas prices.
Armenia’s Public Services Regulatory Commission plans to reconsider electricity generation and distribution prices.
Edmon Manukyan been addressed by the residents of Armavir and Aragatsotn provinces whose crops have been damaged over a strong hail.
Partner news
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:54.000Z
|
jf7la3bnvfqyrytoppqyidqpa5widaj3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69159",
"uncompressed_offset": 672073432,
"url": "www.progressive-charlestown.com/2012/05/farewell-and-good-luck-chief-shippee.html",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.progressive-charlestown.com/2012/05/farewell-and-good-luck-chief-shippee.html"
}
|
cccc_CC-MAIN-2013-20
|
Menu Bar
Home Calendar Topics Just Charlestown About Us
Monday, May 7, 2012
Farewell and good luck, Chief Shippee
Charlestown Police Chief retires after 30 years on the force
By Will Collette
If you missed the Westerly Sun this past weekend, you may have missed the big news that Charlestown Police Chief Jack Shippee notified the Town Council on Friday that he intends to retire, with his last day on June 5.
The Sun carried the news on Saturday and then ran one of their classic “In the Easy Chair” features on the Chief on Sunday. I especially liked the Sunday feature piece because the Chief’s subtle – but wicked – sense of humor really showed through.
Chief Shippee has served Charlestown for 30 years, starting as a part-time patrol officer and working up the ranks until his appointment in 2009 to replace former Chief Thomas Sharkey.
Charlestown is never of one mind on anything, and Jack Shippee is no exception. There are some people who don’t like him – Council member Lisa DiBello, for example, who is suing Chief Shippee as one of the eleven individual past and former town officials named in her lawsuit against the town, DiBello v. Charlestown.
I guess it’s unlikely that DiBello will pick Chief Shippee to be one of her Hometown Heroes (the Hometown Hero award is perhaps DiBello’s only legislative achievement as a Town Council member). And it’s unlikely that Council President Boss Tom Gentz or his henchman Deputy Dan Slattery will nominate Chief Shippee, since they need to keep DiBello happy to keep her vote in their camp and hang on to their majority.
And if Councilors Marge Frank or Gregg Avedisian try to nominate Chief Shippee as a Hometown Hero, they will probably be outvoted 3-2 as they are on most motions.
So how do we honor Chief Shippee, and honor him we should because even if you don’t like him, he has given this town good and faithful service nearly all of his adult life. And I happen to think he has been a very good chief.
Aside from his humor, what I found special about Chief Shippee was the zest he put into trying to get stuff for his officers and for the town. Last summer, I interviewed Chief Shippee and also got to take a ride in one of the Chief’s most audacious acquisitions – an honest-to-god Army surplus armored personnel carrier that he got for free.
The Chief showed me all around the station and pointed out all the various things he had managed to pick up for the benefit of the town and the police force, such as several off-road vehicles, two surplus military-grade Hummers and the boat for the harbormaster. The desk in his office was a gift from Washington Trust..
On Wednesday, there is going to be a special meeting – a workshop – of the Town Council to look at the town’s options for following through on another one of the Chief’s projects – getting red-light enforcement cameras installed at the town’s four stop lights along Route 1, at no cost to the town.
I’ll give you a preview of that meeting, with details on the bids and links so you can see them yourselves in a separate article. I think the cameras are a great idea and hope they become a practical option for Charlestown.
But why not consider naming one of these things in honor of Chief Shippee’s service? Personally, I think “The Tank” (the armored personnel carrier) is the best candidate, since he was the one who not only latched on to it, but also finangled a way to get it shipped from Indiana to Charlestown at no cost and then got it fixed up and ready for service, again at no cost. It’s a great story and I’d love to see “The Tank” renamed “The Jack.”
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:27.000Z
|
dk4urhqv3ltfxie7rr2dym2tl2f6h7qc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69160",
"uncompressed_offset": 672104688,
"url": "www.progressive-charlestown.com/2013/02/charlestown-has-new-town-administrator.html",
"warc_date": "2013-11-22T14:35:16.000Z",
"warc_filename": "<urn:uuid:c54a9ab4-fcad-42f2-9f9e-24c7fc8df9de>",
"warc_url": "http://www.progressive-charlestown.com/2013/02/charlestown-has-new-town-administrator.html"
}
|
cccc_CC-MAIN-2013-20
|
Menu Bar
Home Calendar Topics Just Charlestown About Us
Thursday, February 14, 2013
Charlestown has a new Town Administrator
Fasten your seat belts
Charlestown's new Town Administrator Mark Stankiewicz
By Will Collette
The Town Council voted to hire a new Town Administrator Monday night. He is Mark Stankiewicz, the former Town Manager of Plymouth, MA.
Stankiewicz will relieve acting Town Administrator Pat Anderson so Pat can go back to the job she really loves, that of Town Treasurer.
Town Administrators (and Managers) are a lot like the coaches of professional sports teams.
When they’re hired, they’re hailed as the best possible person for the job, as geniuses and as the one to lead the town to greatness.
In time, unless that manager truly is a genius with a consistent, outstanding record who doesn't piss off the Town Council, that changes. The day inevitably comes when it’s time for the Town Manager, or in Charlestown's case, Administrator, to go. When that time comes, nobody mentions how much they used to love the guy – at that point, they’d just as soon forget they ever hired him[1].
Stankiewicz’s career is very similar to former Town Administrator Bill DiLibero’s. Both have worked for many different towns around the region. Stankiewicz was hired by Plymouth roughly the same time Charlestown hired DiLibero to high praise and with great expectations. Click here to read Stankiewicz’s resume.
The Council's praise for Stansiewicz sounds eerily like the
kinds of things they used to say about Bill DiLibero
Then, both DiLibero and Stankiewicz resigned under pressure in April, 2012.
DiLibero was hounded out of office by the Charlestown Citizens Alliance’s trumped up “Kill Bill” campaign.
The reasons for Stankiewicz’s departure are much cloudier, although one Plymouth Selectman, a supporter of Stankiewicz, candidly said “The situation is that current, and past, members of the Board of Selectmen don’t understand what their role is in this form of government. Some think they’re omnipotent. Others are just angry at what happened at Town Meeting, but they know they can’t fire Town Meeting representatives, and they can’t fire department heads so, instead, they are lashing out at the town manager.”
According to one of the local newspapers in Plymouth, the Board of Selectmen majority decided to offer Stankiewicz “a dignified departure.”
Both DiLibero and Stankiewicz were given severance packages worth more than $100,000 and agreed to “gag order” terms in their severance agreements where they promised not to speak publicly about the reasons or details of their departures.
Both Bill DiLibero and Stankiewicz have been looking for new gigs ever since.
As part of the severance deal, Plymouth bought out the remaining months left on Stankiewicz’s contract (click here to read his Plymouth contract) plus additional months’ salary including unused leave time and benefits.
Stankiewicz was making in excess of $146,000 a year in Plymouth. According to the Westerly Sun, Charlestown will pay him $110,000.
Before Stankiewicz worked for Plymouth, he was town manager in Stoughton MA for six years. Throughout that period, the town was rocked by scandals and corruption in the police department that split the town and roiled the town government. These did not appear to be problems of Stankiewicz’s making, but they certainly made his work in Stoughton all the more challenging.
But despite his work to clean up the town, Stankiewicz ran out his string in Stoughton. As the Boston Globe reported on November 6, 2008 "Turmoil and tension appear to be eroding the corner office at Stoughton Town Hall, where Mark Stankiewicz's run as town manager could be coming to a bitter close. And though little is being said publicly, behind the scenes it is believed a majority of the five-member Board of Selectmen would like to show the 50-year-old Stankiewicz the door, either with a pink slip or severance package."
I don't consider any of this past history as black marks against Stankiewicz. Like a professional coach, they love you today, but sooner or later, they'll show you the door. It's part of the job.
I hope Stankiewicz has a successful run as Charlestown’s Town Manager. A friend of mine who is a long-time Plymouth resident and political activist called Stankiewicz “a decent guy who can be worked with” and noted that he has a quirky sense of humor. That’s a pretty good sign – especially the sense of humor part.
But according to the few details that leaked out about his resignation in Plymouth, the Board of Selectmen differed sharply with Stankiewicz over how much governance the Selectmen (their equivalent of our Town Council) would exercise. They wanted to micromanage and he resisted.
And, oh boy, that is a huge issue here in Charlestown.
Stankiewicz apparently gave all the right answers during his interviews with the town, no doubt saying he would defer to the Council on any judgment calls. But during most of Stankiewicz’s career, he worked as a Town Manager where the job involved far more authority - and autonomy - than Charlestown’s Town Administrator form of government.
Since Stankiewicz was booted[2] from Plymouth because the Selectmen wanted more detailed control than he did, I see trouble for Stankiewicz here in Charlestown. We've all seen how much the Charlestown Town Council majority loves to micromanage.
Stankiewicz says he plans to move from his family's current home in Stoughton (assessed at $352,900) to somewhere closer to Charlestown. Otherwise, it's a 64 mile, 90 minute one-way trip.
He ought to consider a short-term rental. If he can find one.
If Stankiewicz hopes to stick around for a while, or at least through this current Council’s term, here’s some advice.
• Be totally deferential to the Town Council – or at least the three CCA Councilors (Tom Gentz, Dan Slattery and George Tremblay) who constitute the majority.
• Send them copies of everything and do nothing without asking for their permission first.
• If the Councilors say not to send them everything – don’t believe it. The failure to cc the Council on everything was Bill DiLibero’s undoing.
• Try to work the phrase, “yes, Tom, whatever you say” at least three or four times into every conversation.
• It would also help if you laugh at each and every one of Town Council Boss Tom Gentz’s jokes.
• Under no circumstances should you piss off the most powerful person in town, Planning Commissar Ruth Platner. DiLibero was praised to the high heavens by the Town Council until Commissar Platner decided he had violated CCA orthodoxy on wind energy and sports lighting at Ninigret Park. From that point on, DiLibero was toast.
I felt that Bill DiLibero was an honest, decent guy who worked hard for the greater good of Charlestown. So did the Town Council majority until they turned on him. They went from publicly commending DiLibero and giving him a big raise to wanting him to clean out his desk forthwith.
Now comes Mark Stankiewicz with credentials and experience remarkably similar to DiLibero’s. Like DiLibero, he is a veteran of the kind of small town wars where you ride the job approval roller coaster. Today, the CCA majority on the Town Council thinks he’s the greatest thing since sliced cheese.
But will they love him tomorrow?
FOOTNOTES:
[1] I make no apology for using the masculine pronoun since it usually is a “him” and not a “her.”
[2] From the Boston Globe: “By no means should this be considered as a voluntary resignation,’’ said selectmen vice chairman John Mahoney. “This was a termination.’’
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:04.000Z
|
r2odqmf7wrfet4mts4doujmi3su2dlt3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69193",
"uncompressed_offset": 10456803,
"url": "answers.onstartups.com/questions/19567/software-idea-but-non-it-background?answertab=active",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://answers.onstartups.com/questions/19567/software-idea-but-non-it-background?answertab=active"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I am an entreprenuer, who has always been keen on IT, but having no background of programming. I have several ideas which i would like to implement one at a time. These involve combination of Mobile / Tab applications and windows based application.
I want to start off with my own capital to begin with. The question is how to figure what are the skill sets required for executing my idea? or are there project manager whom i can hire to to build a team according the required skill sets?
Is there any resource like a book or website where I can read about the organization structure required for successful execution of an idea? Or how do i figure what skills sets are required for my ideas?
How to trust project managers with sharing ideas?
I need programmers who can create apps on android and windows.
Do i need design experts for frontend presentation of the apps?
The apps need to be online and accessible through the intranet as well as internet.
Is there any book which can guide me through management and execution of the technical aspect of the business?
share|improve this question
6 Answers
You say that you are keen on IT systems, then you should well versed with how IT systems work. If you are not, study a bit around those systems that you are imagining. This will help you to devide the system you are envisioning into smalller modules. Then plan for hiring skills for each modules.
share|improve this answer
To find a project manager you can trust, you could do the following. interview various candidates and run interview question with typical business question (google for them). Some such questions allow you to score a person according the his/her understanding of business. Then you pick the guy with the lowest score, who is in every other aspect competent. You can then, be a bit more sure that he/she will not run off with your idea.
share|improve this answer
I just want to add that (as a technical person), what you're looking to develop is NOT a simple product. You want:
• android app
• iPhone app
• iPad app
• web/extranet app
• web/intranet app
• mobile (other) app
• windows forms app
That's a ridiculous amount of coding, no matter how you slice it.
Focus your idea. Make it something that you can either build or have built quickly. You seem a bit all over the place and it will likely make anyone technical enough to really help you run away quickly (and those that smile and say yes to helping you will likely leave you disappointed and poorer).
share|improve this answer
You dont need a technical co founder, and you dont need a big pot of money. What you need to do is hire a highly technical person to help you plan the software.
This person can be someone with high level software architecture experience, a former CTO, a just your basic super nerd. You can pay them as a consultant to write you a spec, and then in the long run you can pay them to oversee your project as a project manager.
If you offshore your software, you will want to make sure you have your highly technical person help with interviews, and still oversee the work here for you in the uSA.
An important thing to do is pay attention, and learn as much from this person.
share|improve this answer
You need a technical cofounder.
share|improve this answer
I would say that unless you have a very big pot of money, you need to do something yourself. I think that even with a big pot of money, you should take care of critical things yourself. You should for example make drafts of the design yourself. My poibt is that it is your idea and your vision and there are only so much you can communicate to others. By making the design yourself, it will be easier for others to understand your vision.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:44.000Z
|
qcnmkiuxjffbuqd5jteylp5lbboecjr7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69194",
"uncompressed_offset": 10472888,
"url": "answers.onstartups.com/questions/tagged/chicken-and-egg",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://answers.onstartups.com/questions/tagged/chicken-and-egg"
}
|
cccc_CC-MAIN-2013-20
|
The tag has no wiki summary.
learn more… | top users | synonyms
4
votes
3answers
161 views
Breaking the Chicken Egg dependency (taxi's vs travelers)
I have read through the Q&Z for chicken egg issue, on this site. And have come up with a solution. I hope to receive some business advice on my solution. A Taxi Booking, webportal/mobile app is ...
0
votes
0answers
35 views
Im having the chicken and egg problem; What's the risk of focusing on one group first to attract the second group?
My website is a hiring marketplace focusing on events sector (ex. if venue looking for a dj. The venue will post the job and djs submit proposals).
1
vote
4answers
187 views
Some kind of chicken and egg problem
I built a web site, that people can reserve sport fields. I talked to sport facilities and told them that, they can sell their unreserved hours through this web site. Most of them accepted to join the ...
1
vote
4answers
533 views
Any examples of “positive feedback” startup ideas for production companies?
I am looking for examples of ideas, historical or current, where the output of a production process is also used as the input. An example could be something like this: Magnifying glass is used to ...
-2
votes
1answer
186 views
How to implement “infrastructure” ideas? [closed]
I have several ideas that I label "infrastructure ideas" (both physical and virtual). This means that the ideas will create completely new infrastructure (I use a very broad definition of the term) ...
8
votes
4answers
2k views
How do you solve the “chicken-and-the-egg” problem?
There are two variants of the chicken-and-egg problem: When there are two distinct classes of participants in your business, e.g. buyers and sellers, but it is hard to attract one class without ...
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:46.000Z
|
inweped6rodta6p3pd7rqbac5cjmbxqq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69199",
"uncompressed_offset": 13428529,
"url": "archives.gentoo.org/gentoo-doc-cvs/msg_b5695a9cc552614503db4be68ba0b09c.xml",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://archives.gentoo.org/gentoo-doc-cvs/msg_b5695a9cc552614503db4be68ba0b09c.xml"
}
|
cccc_CC-MAIN-2013-20
|
Note: Due to technical difficulties, the Archives are currently not up to date. GMANE provides an alternative service for most mailing lists.
c.f. bug 424647
List Archive: gentoo-doc-cvs
Navigation:
Lists: gentoo-doc-cvs: < Prev By Thread Next > < Prev By Date Next >
Headers:
To: gentoo-doc-cvs@g.o
From: "Sven Vermeulen (swift)" <swift@g.o>
Subject: gentoo commit in xml/htdocs/doc/en/handbook: hb-working-features.xml
Date: Sun, 27 Nov 2011 18:25:28 +0000 (UTC)
swift 11/11/27 18:25:28
Modified: hb-working-features.xml
Log:
Portage tree is signed with new key (cfr mail on gentoo-dev-announce)
Revision Changes Path
1.40 xml/htdocs/doc/en/handbook/hb-working-features.xml
file : http://sources.gentoo.org/viewvc.cgi/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml?rev=1.40&view=markup
plain: http://sources.gentoo.org/viewvc.cgi/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml?rev=1.40&content-type=text/plain
diff : http://sources.gentoo.org/viewvc.cgi/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml?r1=1.39&r2=1.40
Index: hb-working-features.xml
===================================================================
RCS file: /var/cvsroot/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml,v
retrieving revision 1.39
retrieving revision 1.40
diff -u -r1.39 -r1.40
--- hb-working-features.xml 27 Oct 2011 18:33:42 -0000 1.39
+++ hb-working-features.xml 27 Nov 2011 18:25:28 -0000 1.40
@@ -4,7 +4,7 @@
<!-- The content of this document is licensed under the CC-BY-SA license -->
<!-- See http://creativecommons.org/licenses/by-sa/2.5 -->
-<!-- $Header: /var/cvsroot/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml,v 1.39 2011/10/27 18:33:42 swift Exp $ -->
+<!-- $Header: /var/cvsroot/gentoo/xml/htdocs/doc/en/handbook/hb-working-features.xml,v 1.40 2011/11/27 18:25:28 swift Exp $ -->
<sections>
@@ -13,8 +13,8 @@
ccache and more.
</abstract>
-<version>3</version>
-<date>2011-10-27</date>
+<version>4</version>
+<date>2011-11-27</date>
<section>
<title>Portage Features</title>
@@ -347,14 +347,19 @@
snapshots. Of course, if you want to, you can validate this GPG key as per the
<uri link="/doc/en/gnupg-user.xml#doc_chap2_sect4">proper guidelines</uri>
(like checking the key fingerprint <c>AE54 54F9 67B5 6AB0 9AE1 6064 0838
-C26E 239C 75C4</c>).
+C26E 239C 75C4</c> for key <c>0x239C75C4</c> or <c>DCD0 5B71 EAB9 4199 527F 44AC
+DB6B 8C1F 96D8 BF6D</c> for key <c>0x96D8BF6D</c>).
</p>
+<!-- Key 0x239C75C4 is superceded by 0x96D8BF6D, but keep it in the documents
+ for a while to ensure continuity -->
+
<pre caption="Creating a truststore for Portage">
# <i>mkdir -p /etc/portage/gpg</i>
# <i>chmod 0700 /etc/portage/gpg</i>
-# <i>gpg --homedir /etc/portage/gpg --keyserver subkeys.pgp.net --recv-keys 0x239C75C4</i>
+# <i>gpg --homedir /etc/portage/gpg --keyserver subkeys.pgp.net --recv-keys 0x239C75C4 0x96D8BF6D</i>
# <i>gpg --homedir /etc/portage/gpg --edit-key 0x239C75C4 trust</i>
+# <i>gpg --homedir /etc/portage/gpg --edit-key 0x96D8BF6D trust</i>
</pre>
<p>
Navigation:
Lists: gentoo-doc-cvs: < Prev By Thread Next > < Prev By Date Next >
Previous by thread:
gentoo commit in xml/htdocs/doc/en/handbook: hb-working-features.xml
Next by thread:
gentoo commit in xml/htdocs/doc/en/handbook: hb-working-features.xml
Previous by date:
gentoo commit in xml/htdocs/doc/en/handbook: hb-install-alpha-medium.xml hb-install-hppa-medium.xml hb-install-ia64-medium.xml hb-install-ppc-medium.xml hb-install-ppc64-medium.xml hb-install-sparc-medium.xml hb-install-x86+amd64-medium.xml
Next by date:
gentoo commit in xml/htdocs/doc/en: inserts.xml
Updated Jun 30, 2012
Summary: Archive of the gentoo-doc-cvs mailing list.
Donate to support our development efforts.
Copyright 2001-2013 Gentoo Foundation, Inc. Questions, Comments? Contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:27:44.000Z
|
6irc5ryovermkmcbw66co655italntwi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69217",
"uncompressed_offset": 40921319,
"url": "buffalo.nas-central.org/w/index.php?oldid=12598&title=Kurobox_Media_Ripper",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://buffalo.nas-central.org/w/index.php?title=Kurobox_Media_Ripper&oldid=12598"
}
|
cccc_CC-MAIN-2013-20
|
Kurobox Media Ripper
From NAS-Central Buffalo - The Linkstation Wiki
Revision as of 14:00, 15 July 2006 by Waite (Talk)
Jump to: navigation, search
Contents
Kurobox Media Ripper
Introduction
The KuroRipper is an addition to the Kurobox NAS system. It allows automatic copying of images,video and audio files from USB media such as USB keys, Compact FLASH, and SD cards. Also, it will rip entire audio CDs to mp3 format and, if avaialable will add the correct tags from the CDDB database to your Kurobox shares. Target directories, along with supported media types is all configurable in usr/local/bin/ripper.conf or from the webmin interface.
The Disk Full Led on your Kurobox will flash when ripping is in operation. It is safe to remove any USB adapters only when the Disk Full LED is not blinking.
Distribution Installation
Install the Media Ripper
Configuring Media Ripper
Via Webmin
Via Command Line
Additional tips
Install Wizd
Share the drives via Samba
To Do
• Make hdparm spin the drive down
• Allow the ripper to rip from Data CDs
• Allow the ripper To rip DVD isos
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:20:54.000Z
|
fgnjezufuouilfcvfntp4hlxoumfirhn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69220",
"uncompressed_offset": 45385455,
"url": "ccsenet.org/journal/index.php/elt/article/view/352",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://ccsenet.org/journal/index.php/elt/article/view/352"
}
|
cccc_CC-MAIN-2013-20
|
Repositioning Recitation Input in College English Teaching
Qing Xu
Abstract
This paper tries to discuss how recitation input helps overcome the negative influences on the basis of second language acquisition theory and confirms the important role that recitation input plays in improving college students’ oral and written English.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
English Language Teaching ISSN 1916-4742 (Print) ISSN 1916-4750 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:01:04.000Z
|
emo7adgf6oqidgl2m33ye6cnsovrlbod
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69221",
"uncompressed_offset": 45401484,
"url": "ccsenet.org/journal/index.php/jsd/article/view/6335/0",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://ccsenet.org/journal/index.php/jsd/article/view/6335/0"
}
|
cccc_CC-MAIN-2013-20
|
Transport Infrastructure, Energy Consumption and Economic Growth Triangle in India: Cointegration and Causality Analysis
Rudra Prakash Pradhan
Abstract
The paper explores the nexus between transport infrastructure (road and rail), energy consumption (oil and electricity) and economic growth in India over the period 1970-2007. Using cointegration and Granger causality test, the paper finds a unidirectional causality from transport infrastructure to economic growth, a unidirectional causality from economic growth to energy consumption and a unidirectional causality from transport infrastructure to energy consumption. The paper at the end suggests that energy and transportation policies should recognize the transport- energy consumption- growth nexus in order to maintain sustainable economic growth in the country.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Journal of Sustainable Development ISSN 1913-9063 (Print) ISSN 1913-9071 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:01:26.000Z
|
dmkfkvpfml3z2rtmqrt3kd467dbuupbx
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69226",
"uncompressed_offset": 53616832,
"url": "cnx.org/content/m33286/latest/content_info",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://cnx.org/content/m33286/latest/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » 聚焦认知心理学
About: 聚焦认知心理学
Module by: Mark Pettinelli. E-mail the author
View the content: 聚焦认知心理学
Metadata
Name: 聚焦认知心理学
ID: m33286
Language: 中文 (zh)
Subject: Social Sciences
License: Creative Commons Attribution License CC-BY 3.0
Authors: Mark Pettinelli (xiornik@kindnessassociation.org)
Copyright Holders: Mark Pettinelli (xiornik@kindnessassociation.org)
Maintainers: Mark Pettinelli (xiornik@kindnessassociation.org)
Latest version: 1.2 (history)
First publication date: Dec 26, 2009 2:20 pm -0600
Last revision to module: Dec 27, 2009 2:15 pm -0600
Downloads
PDF: m33286_1.2.pdf PDF file, for viewing content offline and printing. Learn more.
XML: m33286_1.2.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.2 Dec 27, 2009 2:15 pm -0600 by Mark Pettinelli
Changes:
few
Version: 1.1 Dec 26, 2009 2:25 pm -0600 by Mark Pettinelli
Changes:
new
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Mark Pettinelli
• the title of the work: 聚焦认知心理学
• the Connexions URL where the work can be found: http://cnx.org/content/m33286/1.2/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Pettinelli, M. 聚焦认知心理学, Connexions Web site. http://cnx.org/content/m33286/1.2/, Dec 27, 2009.
American Medical Assocation (AMA) Manual of Style:
Pettinelli M. 聚焦认知心理学 [Connexions Web site]. December 27, 2009. Available at: http://cnx.org/content/m33286/1.2/.
American Psychological Assocation (APA) Publication Manual:
Pettinelli, M. (2009, December 27). 聚焦认知心理学. Retrieved from the Connexions Web site: http://cnx.org/content/m33286/1.2/
Chicago Manual of Style (Bibliography):
Pettinelli, Mark. "聚焦认知心理学." Connexions. December 27, 2009. http://cnx.org/content/m33286/1.2/.
Chicago Manual of Style (Note):
Mark Pettinelli, "聚焦认知心理学," Connexions, December 27, 2009, http://cnx.org/content/m33286/1.2/.
Chicago Manual of Style (Reference, in Author-Date style):
Pettinelli, M. 2009. 聚焦认知心理学. Connexions, December 27, 2009. http://cnx.org/content/m33286/1.2/.
Modern Languages Association (MLA) Style Manual:
Pettinelli, Mark. 聚焦认知心理学. Connexions. 27 Dec. 2009 <http://cnx.org/content/m33286/1.2/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:30:01.000Z
|
h2hygxu4qrelatyqlqlmat2tismhedmi
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69227",
"uncompressed_offset": 53636470,
"url": "cnx.org/content/m42331/1.3/content_info",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://cnx.org/content/m42331/1.3/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Equipotential Lines
About: Equipotential Lines
Module by: OpenStax College. E-mail the author
View the content: Equipotential Lines
Metadata
Name: Equipotential Lines
ID: m42331
Language: English (en)
Summary:
• Explain equipotential lines and equipotential surfaces.
• Describe the action of grounding an electrical appliance.
• Compare electric field and equipotential lines.
Subject: Science and Technology
Keywords: Electric field lines, Equipotential lines, Equipotential surface, Grounding
License: Creative Commons Attribution License CC-BY 3.0
Authors: OpenStax College (info@openstaxcollege.org)
Copyright Holders: Rice University (daniel@openstaxcollege.org)
Maintainers: OpenStax College (info@openstaxcollege.org), OSC Physics Maintainer (info@openstaxcollege.org)
Latest version: 1.3 (history)
First publication date: Jan 17, 2012 2:49 pm -0600
Last revision to module: Jun 13, 2012 2:38 pm -0500
Downloads
PDF: m42331_1.3.pdf PDF file, for viewing content offline and printing. Learn more.
XML: m42331_1.3.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.3 Jun 13, 2012 2:38 pm -0500 by OSC Physics Maintainer
Changes:
Review Changes
Version: 1.2 May 23, 2012 4:47 pm -0500 by OSC Physics Maintainer
Changes:
initial content publication
Version: 1.1 Jan 20, 2012 4:43 pm -0600 by OSC Physics Maintainer
Changes:
Created module
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: OpenStax College
• the title of the work: Equipotential Lines
• the Connexions URL where the work can be found: http://cnx.org/content/m42331/1.3/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
OpenStax College. Equipotential Lines, Connexions Web site. http://cnx.org/content/m42331/1.3/, Jun 13, 2012.
American Medical Assocation (AMA) Manual of Style:
OpenStax College. Equipotential Lines [Connexions Web site]. June 13, 2012. Available at: http://cnx.org/content/m42331/1.3/.
American Psychological Assocation (APA) Publication Manual:
OpenStax College. (2012, June 13). Equipotential Lines. Retrieved from the Connexions Web site: http://cnx.org/content/m42331/1.3/
Chicago Manual of Style (Bibliography):
OpenStax College. "Equipotential Lines." Connexions. June 13, 2012. http://cnx.org/content/m42331/1.3/.
Chicago Manual of Style (Note):
OpenStax College, "Equipotential Lines," Connexions, June 13, 2012, http://cnx.org/content/m42331/1.3/.
Chicago Manual of Style (Reference, in Author-Date style):
OpenStax College. 2012. Equipotential Lines. Connexions, June 13, 2012. http://cnx.org/content/m42331/1.3/.
Modern Languages Association (MLA) Style Manual:
OpenStax College. Equipotential Lines. Connexions. 13 June 2012 <http://cnx.org/content/m42331/1.3/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:18:55.000Z
|
mmblywgkg7f6ugdrwoimzndbyxlsxjpq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69232",
"uncompressed_offset": 60002810,
"url": "crantastic.org/packages/mimR",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://crantastic.org/packages/mimR"
}
|
cccc_CC-MAIN-2013-20
|
mimR (2.6.2)
0 users
A package for graphical modelling in R.
http://genetics.agrsci.dk/~sorenh/public/R/mimRweb
http://cran.r-project.org/web/packages/mimR
An R interface to MIM for graphical modelling in R
Maintainer: Søren Højsgaard
Author(s): Søren Højsgaard <sorenh@agrsci.dk>
License: GPL (>= 2)
Uses: graph, gRbase, MASS, rcom
Reverse depends: gmvalid
Reverse suggests: gmvalid
Reverse enhances: gmvalid
Released over 3 years ago.
2 previous versions
Ratings
Overall:
(0 votes)
Documentation:
(0 votes)
Log in to vote.
Reviews
No one has written a review of mimR yet. Want to be the first? Write one now.
Related packages: R2WinBUGS, SIN, bayesmix, bnlearn, boa, coda, deal, dynamicGraph, gRbase, ggm, giRaph, igraph, mathgraph, qp, rbugs, pcalg, diagram, ergm, gRain, gRc(20 best matches, based on common tags.)
Search for mimR on google, google scholar, r-help, r-devel.
Visit mimR on R Graphical Manual.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:38.000Z
|
vvsoyd2vfu6ytzwo26q5gn6yhv6evu5p
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69254",
"uncompressed_offset": 85380431,
"url": "elinux.org/ECE497_Project_Template",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://elinux.org/ECE497_Project_Template"
}
|
cccc_CC-MAIN-2013-20
|
ECE497 Project Template
From eLinux.org
Jump to: navigation, search
Embedded Linux Class by Mark A. Yoder
Team members: Mark A. Yoder, (List all the team members here with link to their eLinux User page. Use my format.
Contents
Grading Template
I'm using the following template to grade. Each slot is 10 points. 0 = Missing, 5=OK, 10=Wow!
00 Executive Summary
00 Installation Instructions
00 User Instructions
00 Highlights
00 Theory of Operation
00 Work Breakdown
00 Future Work
00 Conclusions
00 Demo
00 Late
Comments: I'm looking forward to seeing this.
Score: 10/100
(Inline Comment)
Executive Summary
Give two sentence intro to the project.
Give two sentences telling what works.
Give two sentences telling what isn't working.
End with a two sentence conclusion.
The sentence count is approximate and only to give an idea of the expected length.
Installation Instructions
Give step by step instructions on how to install your project.
• Include your github path as a link like this to the read-only git site: https://github.com/MarkAYoder/gitLearn.
• Be sure your README.md is includes an up-to-date and clear description of your project so that someone who comes across you git repository can quickly learn what you did and how they can reproduce it.
• Include a Makefile for you code.
• Include any additional packages installed via opkg.
• Include kernel mods.
• If there is extra hardware needed, include links to where it can be obtained.
User Instructions
Once everything is installed, how do you use the program? Give details here, so if you have a long user manual, link to it here.
Highlights
Here is where you brag about what your project can do.
Include a YouTube demo.
Theory of Operation
Give a high level overview of the structure of your software. Are you using GStreamer? Show a diagram of the pipeline. Are you running multiple tasks? Show what they do and how they interact.
Work Breakdown
List the major tasks in your project and who did what.
Also list here what doesn't work yet and when you think it will be finished and who is finishing it.
Future Work
Suggest addition things that could be done with this project.
Conclusions
Give some concluding thoughts about the project. Suggest some future additions that could make it even more interesting.
Embedded Linux Class by Mark A. Yoder
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:13.000Z
|
cz5rfjg6adu62smrv6gwpmxc6ilqnl2g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69286",
"uncompressed_offset": 116810550,
"url": "globalvoicesonline.org/2012/05/26/slovakia-god-can-cure-you/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://globalvoicesonline.org/2012/05/26/slovakia-god-can-cure-you/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
Slovakia: “God Can Cure You”
This post also available in:
Ελληνικά · Σλοβακία: "Ο Θεός μπορεί να σε γιατρέψει"
русский · Словакия: "Бог может излечить вас"
On May 26, approximately 50-60 opponents of the upcoming Gay Pride gathered [sk] in Bratislava for a rally organized by the Association for Protection of Family, together with the Citizens’ Association for Christian Values and Traditions. The main organizer, Jozef Dupkala, offering a helping hand to homosexuals, said: “Your current pride … will end the moment you stand before The Last Court.” He also said: “We came to offer hope to all those who suffer from this condition, homosexuality, to be able to turn to God in order to accept the cure.”
World regions
Countries
Languages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:25.000Z
|
haq7hnisuzisljziyn5j3cpiei7tqjdq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69287",
"uncompressed_offset": 116841838,
"url": "globalvoicesonline.org/2013/03/09/education-vs-reality-in-bolivia/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://globalvoicesonline.org/2013/03/09/education-vs-reality-in-bolivia/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
Education vs. Reality in Bolivia
This post also available in:
Ελληνικά · Βολιβία: Η εκπαίδευση και η πραγματικότητα
Italiano · Bolivia: educazione e realtà
Français · Bolivie : L’éducation et la réalité
Español · Bolivia: La educación y la realidad
On his self named [es] blog, Eduardo Bowles reports [es] on changes to Bolivia's education system. According to the new school programme: “in elementary school there won't be any failed students. According to the new education trends, children should not be educated in a competitive environment”. As part of his analysis, he argues:
The idea is to set up a collaborative environment, where there is compassion, mutual collaboration and other very important values, no doubt about it, but [these values] are not actually related to our daily reality.
World regions
Countries
Languages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:58:42.000Z
|
4ypccrsoyibj4rblr46ndk6kdcjk2cz3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69294",
"uncompressed_offset": 140318480,
"url": "ipkitten.blogspot.com/2005/05/greetings-from-sd.html",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://ipkitten.blogspot.com/2005/05/greetings-from-sd.html"
}
|
cccc_CC-MAIN-2013-20
|
For the half-year to 30 June 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Stefano Barazza, Matthias Lamping and Jeff John Roberts.
Two of our regular Kats are currently on blogging sabbaticals. They are Birgit Clark and Catherine Lee.
Wednesday, 18 May 2005
GREETINGS FROM SD
One very fatigued IPKat is edging towards the end of a long, hard INTA programme here in San Diego. So many points to consider:
* What the current Dilution Bill in the US will actually achieve;
* Who is supporting the Bill, and why?
* The wisdom of the ECJ leaving so much to national courts in its recent Gillette decision (on the use of the word mark GILLETTE by another manufacturer to indicate that its blades fitted Gillette blade holders). In particular, what happens if the way this is done is regarded as honest commercial use in some EU States but not others.
The IPKat is sure that these questions won't go away and looks forward to giving them some heavy thought in the near future.
Subscribe to the IPKat's posts by email here
Just pop your email address into the box and click 'Subscribe':
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:20.000Z
|
fsokauuwubprpedjyijxfton5sore3tb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69298",
"uncompressed_offset": 146113815,
"url": "josm.openstreetmap.de/ticket/5644",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://josm.openstreetmap.de/ticket/5644"
}
|
cccc_CC-MAIN-2013-20
|
Modify
Opened 2 years ago
Closed 2 years ago
#5644 closed defect (fixed)
Search box help not visible if histrory contains long search expressions
Reported by: bilbo Owned by: team
Priority: normal Component: Core
Version: latest Keywords:
Cc:
Description
The box to enter search query in the search dialog accomodates to contain longest search expression in available history.
This have very negative effects, when the search history contains some very long expression, as can be seen on the attached screenshot. (box wider than window and you need to scroll to see the help text)
I think the search box should have fixed size, or at least have some limit.
Attachments (1)
bad_josm_search.png (17.6 KB) - added by bilbo 2 years ago.
Screenshot of bad search dialog
Download all attachments as: .zip
Change History (2)
Changed 2 years ago by bilbo
comment:1 Changed 2 years ago by bastiK
• Resolution set to fixed
• Status changed from new to closed
Modify Ticket
Change Properties
<Author field>
Action
as closed .
as The resolution will be set. Next status will be 'closed'.
The resolution will be deleted. Next status will be 'reopened'.
Author
E-mail address and user name can be saved in the Preferences.
Note: See TracTickets for help on using tickets.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:33.000Z
|
6oygp6gl5eeafseggnikappmuqbe4ogj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69304",
"uncompressed_offset": 159450362,
"url": "lists.maemo.org/pipermail/maemo-developers/2007-April/009817.html",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://lists.maemo.org/pipermail/maemo-developers/2007-April/009817.html"
}
|
cccc_CC-MAIN-2013-20
|
[maemo-developers] wtmp
From: Frantisek Dufka dufkaf at seznam.cz
Date: Wed Apr 18 14:11:38 EEST 2007
Kemal Hadimli wrote:
> On 4/18/07, Eero Tamminen <eero.tamminen at nokia.com> wrote:
>> > Sorry, it is in /var/log
>> That I have, but it's only 6kB after several days of device being
>> on/online.
>
> mine was 62-megs (of course what i did immediately is ln -sf /dev/null
> /var/log/wtmp)
>
> (latest firmware)
>
OK, so I reopened
https://maemo.org/bugzilla/show_bug.cgi?id=448
More information about the maemo-developers mailing list
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:40.000Z
|
sen5vhvvumjtr2obpyvqykj4gpk3zx67
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69322",
"uncompressed_offset": 177951802,
"url": "mojoey.blogspot.com/2012/11/photographer-brian-skerry-at-aquarium.html",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://mojoey.blogspot.com/2012/11/photographer-brian-skerry-at-aquarium.html"
}
|
cccc_CC-MAIN-2013-20
|
Tuesday, November 20, 2012
Photographer Brian Skerry at the Aquarium of the Pacific
Brian Skerry is a National Geographic nature photographer. On December 1, 2012 Skerry opens a photography exhibit at The Aquarium of the Pacific in Long Beach. Admission to the exhibit is included with a general admission ticket to the Aquarium.
Skerry’s images capture once-in-a-lifetime moments with marine life, from a diver happening upon a gargantuan whale at the sea floor to a tiny fish looking out from inside a discarded soda can. Rich colors and luminous settings draw viewers in and transport them to the world found underwater. Skerry has traveled the globe for thirty years documenting the planet’s oceans and aquatic wildlife.
Brian Skerry is worth seeing.
Technorati Tags: ,
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:41.000Z
|
64233xnzehcp5xgns3ijakmfclxt7seg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69328",
"uncompressed_offset": 201237073,
"url": "openwetware.org/index.php?oldid=174838&title=Knight%3ADNA_ligation_using_T4_DNA_ligase",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://openwetware.org/index.php?title=Knight:DNA_ligation_using_T4_DNA_ligase&oldid=174838"
}
|
cccc_CC-MAIN-2013-20
|
Knight:DNA ligation using T4 DNA ligase
From OpenWetWare
Revision as of 21:12, 13 December 2007 by Reshma P. Shetty (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Contents
Materials
• We use the T4 DNA ligase from NEB
• Deionized, sterile H2O
• Purified, linearized vector (in H2O)
• Purified, linearized insert (in H2O)
Ligation Mix
• X μL vector (equivalent to ~50 ng, can use less)
• Y μL insert 1
• Z μL insert 2
• 1 μL 10X Ligase Buffer
• (9.5 - X - Y - Z) μL deionized H2O
• 0.5 μL T4 DNA ligase
• Reshma 19:12, 13 December 2007 (CST): I frequently digest 500 ng of each part and the destination vector. Then I use 2 μL vector, 3 μL insert 1 and 3 μL insert 2 where all three linearized fragments have been purified with a minelute DNA purification.
Calculating Insert Amount
Equimolar ratios may be preferable.
Procedure
1. Add appropriate amount of deionized H2O to sterile 0.6 mL tube
2. Add 1 μL ligation buffer to the tube.
Vortex buffer before pipetting to ensure that it is well-mixed.
Remember that the buffer contains ATP so repeated freeze, thaw cycles can degrade the ATP thereby decreasing the efficiency of ligation. It is recommended that you aliquot the Ligation Buffer into smaller quantities.
3. Add appropriate amount of insert to the tube.
4. Add appropriate amount of vector to the tube.
5. Add 0.5 μL ligase.
Vortex ligase before pipetting to ensure that it is well-mixed.
Also, the ligase, like most enzymes, is in some percentage of glycerol which tends to stick to the sides of your tip. To ensure you add only 0.5 μL, just touch your tip to the surface of the liquid when pipetting.
6. Incubate 20 mins on the benchtop.
7. Place on ice until transformation.
8. Generally 1 μL of ligation mix is sufficient for either chemical transformation or electroporation. The amount of salt in 1 μL ligation mix should not cause arcing.
9. Optional Heat-inactivate by incubating at 65°C for 20 mins. Then do a purification step to remove PEG. (See notes on DNA ligation.
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:16:02.000Z
|
fgko2a4pxn5sppw4n533a5ti4sos63xi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69329",
"uncompressed_offset": 201243983,
"url": "openwetware.org/index.php?oldid=117365&title=Marek%3A_Freeze-down%2FThaw",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://openwetware.org/index.php?title=Marek:_Freeze-down/Thaw&oldid=117365"
}
|
cccc_CC-MAIN-2013-20
|
Marek: Freeze-down/Thaw
From OpenWetWare
Revision as of 05:14, 18 May 2007 by Mcebe (Talk | contribs)
Jump to: navigation, search
Contents
Overview
This short protocol describes how to freeze down and thaw (or bring up) mammalian cells (e.g. HeLa, KEK293, CHO, Jurkat T cells).
Materials
List reagents, supplies and equipment necessary to perform the protocol here.
• 10-50 ml centrifuge tube
• DMSO, Tissue culture (TC)-tested (e.g. Sigma, D2650)
• Freeze-down medium
• 6% DMSO
• Cell culture medium
• Basic TC centriguge (0 - 2500 rpm)
• Freeze down box (this could be simply made from a small styropore box and cotton or from two styropore racks from 15-ml centrifuge tubes )
Procedure
1. Step 1
2. Step 2
• Step 2 has some additional information that goes with it. i.e. Keep at 4°C.
3. Step 3
1. Step 3 has multiple sub-steps within it.
2. Enumerate each of those.
Notes
1. List troubleshooting tips here.
2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
3. Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
Contact
• Who has experience with this protocol?
or instead, discuss this protocol.
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:32:45.000Z
|
emwejxo2fr5wktgxc4kf62vaqji65uun
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69341",
"uncompressed_offset": 218794136,
"url": "quotationsbook.com/quote/16274/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://quotationsbook.com/quote/16274/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
One who looks for a friend without faults will have none. Saying, Hasidic
This quote is about friends and friendship · Search on Google Books to find all references and sources for this quotation.
A bit about Saying, Hasidic ...
We don't have a biography.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:51:00.000Z
|
7oyepbpe4mszuwc5jd2hwxai45vfzkm6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69344",
"uncompressed_offset": 218812599,
"url": "quotationsbook.com/quote/gift/29477/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://quotationsbook.com/quote/gift/29477/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Patience, money and time bring all things to past. Proverb
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:03.000Z
|
cjrjv6wmkwgu4tcbtl72pdmkuktgc72y
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69345",
"uncompressed_offset": 218818094,
"url": "quotationsbook.com/quotes/author/34/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://quotationsbook.com/quotes/author/34/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Adams, J. Donald
We don't have a biography. Please consult wikipedia.
"There are times when I think that the ideal library is composed solely of reference books. They are like understanding friends-always ready to change the subject when you have had enough of this or that."
Adams, J. Donald on libraries
Take a look at recent activity on QB!
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:05:53.000Z
|
vw7yebd3pvia626ygjiiiqbj36s67ctj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69346",
"uncompressed_offset": 218823929,
"url": "quotationsbook.com/quotes/author/4449/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://quotationsbook.com/quotes/author/4449/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Little, Paul
We don't have a biography. Please consult wikipedia.
"The Holy Spirit can't save saints or seats. If we don't know any non-Christians, how can we introduce them to the Savior?"
Little, Paul on evangelism
"Some people think that God peers over the balcony of heaven trying to find anybody who is enjoying life. And when He spots a happy person, He yells, Now cut that out! That concept of God should make us shudder because it's blasphemous!"
Little, Paul on god
"Has it ever struck you that the vast majority of the will of God for your life has already been revealed in the Bible? That is a crucial thing to grasp."
Little, Paul on god
"I was frustrated out of my mind, trying to figure out the will of God. I was doing everything but getting into the presence of God and asking Him to show me."
Little, Paul on god
"Others think it's a choice between doing what we want to do and being happy, and doing what God wants us to do and being miserable."
Little, Paul on god
Take a look at recent activity on QB!
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:19.000Z
|
3ahjb4ojuwsai5stw2hp2ah5zkckxgup
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69367",
"uncompressed_offset": 256999749,
"url": "strategywiki.org/wiki/Command_%26_Conquer:_Generals_-_Zero_Hour/China_Infantry_General_vs._China_Nuke_General",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://strategywiki.org/wiki/Command_%26_Conquer:_Generals_-_Zero_Hour/China_Infantry_General_vs._China_Nuke_General"
}
|
cccc_CC-MAIN-2013-20
|
Command & Conquer: Generals - Zero Hour/China Infantry General vs. China Nuke General
From StrategyWiki, the video game walkthrough and strategy guide wiki
Jump to: navigation, search
This mission would be much more difficult if it weren’t for the fact that the Nuke General’s aim can be easily diverted.
The first nuke will hit your base if you don’t destroy it first. You can destroy it with a combination of multiple MIG attacks and the level three Artillery Barrage. You will lose some MIGs in the process. You will have to hunt down a few stationary Nuke Cannons with a Helix to get to level three before the first nuke fires.
After this, the nukes can be distracted to hit in the wilderness north of your base. Simply park some Helixes in this area as a distraction.
[edit] Walkthrough
Basic startup: Build a Reactor, extra dozer and a Barracks. Build a Supply Center to the west of the Command Center so the Supply Trucks will have access to both Supply Docks. Build an extra Supply Truck.
Research the Capture command and recruit three Mini Gunners. Capture all three oil derricks on the east side of the map. Don’t worry about defending the two furthest to the east. You will at least receive some startup capital to quickly get you rolling.
Alternate plan: Build five Helixes as opposed to three. Have a Helix guard each of the oil derrricks, loaded with troops as described below. You will not need to build any Hackers and you will still have plenty of cash flow.
Build one Gattling Cannon to the east and one to the north to help destroy enemy Helixes and infantry.
Build an Airfield and three Helixes. Queue up three Mini Gunners and three Tank Hunters for each of the Helixes. This will take a while to get them all loaded, but this strategy doesn’t require great speed.
Put them in guard mode on the east, northeast and west part of your base. Be sure they are far out enough that they will protect your base from the long-range Nuke Cannons.
(Again, alternatively, have a fourth and fifth Helix protect the two oil derricks to the east.)
Build a War Factory, a Propaganda Center and a Nuke Missile.
At the same time, build four MIGs. Have them attack the middle Nuclear Missile at least twice. You may lose some aircraft, but that’s okay. Just replace them.
It is really tight as to whether you will reach Level 3 (in order to receive the Level 3 Artillery Barrage) in time to destroy the first Nuclear Missile. You will have to hunt down Nuke Cannons parked in the middle of the map with your Helixes. Unfortunately, you may lose some Helixes in the process because of the garrisoned buildings in the area.
Although I didn’t test this, you can probably survive this first nuclear strike if the others don’t hit your base.
After the first Nuclear Missile (whether destroyed before or after it launches) keep a number of your Helixes north/northeast of your base so that all remaining nukes will explode off in the center of the map. Evidently, the Nuke General’s aim is not very good.
Your base will not be hit the rest of the mission.
A mere three Helixes will provide an excellent defense of your base and you can continue at your own pace to build Power Plants and Nuclear Missiles.
Methodically take out the remaining nukes with your General’s Powers (Carpet Bombs and Artillery Strikes) and nukes. Your Carpet Bombs will only reach the southernmost nukes on both the east and west sides of the map.
There is a Nuclear Truck parked on the east side of the map by the three quonset huts. Carpet Bomb this truck to destroy all of the structures in the area. Your Carpet Bomber can then reach the Nuclear Missile furthest to the north.
If you choose to attack the enemy base by land, avoid all “hot spots,” as the radiation will destroy your vehicles.
The Nuke General does not rebuild his structures, so you can now start targeting away at his base.
It is not necessary to destroy armor, infantry, Bunkers, Gattling Cannons and garrisoned buildings to achieve victory.
Mission accomplished!
There is a alternative if you would dislike to let the general misfire its nukes. You can rush in with..... Black Lotus. The most left and the most right nuclear silos can be captured (at which point they blow up). You can also take over the command centre without any problems. You can train hackers and place them behind the supply stash. No nuke will come there. With flying mobile defenses in the form of helixes and a steady cash flow nukes cant really harm you. Just rebuild whatever he destroys. You can get victory with 3 helixes, a command centre a nuke silo one power plant and a few hackers... Just rebuild or repair where the nuke lands and kill the silos with barrage and a nuke.
Social networking
Personal tools
Namespaces
Variants
Views
Actions
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:25.000Z
|
aczikwgnf4lp4hudmw25syv6yrye5p54
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69409",
"uncompressed_offset": 294824984,
"url": "wikitravel.org/en/Takamatsu",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://wikitravel.org/en/Takamatsu"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Takamatsu
From Wikitravel
Asia : East Asia : Japan : Shikoku : Kagawa : Takamatsu
Jump to: navigation, search
Ritsurin Park
Takamatsu (高松) [1] is the largest city in Kagawa Prefecture on the island of Shikoku, Japan.
[edit] Understand
The city developed over many years as a port town and is located at one of the primary entry points into Shikoku and is therefore known as the "Gateway to Shikoku". In recent years, it has also come to be known as the "Udon Kingdom".
[edit] Climate
Climate Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
Daily highs (°C) 10 11 14 20 25 28 32 33 29 23 17 12
Nightly lows (°C) 2 2 5 10 15 20 24 25 21 15 9 4
Precipitation (mm) 39 48 73 86 100 159 135 92 187 108 62 34
Source: Japan Meteorological Agency [2].
July and August can get quite warm. The winter months of January and February are the coldest, with occasional nighttime freezing temperatures.
[edit] Get in
Before the completion of the Honshū-Shikoku bridges, access between Japan's main island and Takamatsu was limited to sea and air transportation. However, with the bridges in place, convenient train and automobile travel is now possible as well and many more people now travel to and from.
[edit] By plane
The closest major airport to Takamatsu is Kansai International Airport in Osaka. There is a curiously-named bus called the "Airport Limousine" which runs directly between Kansai Airport and Takamatsu that makes seven round trip runs per day (¥3750 one-way; 3.5 hours). Not actually a limo.
Takamatsu has a tiny airport as well but there's only a few places you can get to from it. Service from the Takamatsu Airport to Tokyo's Haneda Airport is offered by both JAL and ANA, Japan's two major airlines. JAL also offers service to Kagoshima, and ANA also offers service to Okinawa. Asiana Airlines offers international service to Seoul Incheon Airport. But cheapest of all is Spring Airlines from Shanghai (twice a week, Tuesday/Friday), with fares starting at just ¥3000 each way. Time schedule for all of these flights (in Japanese) [3].
Buses connect the Takamatsu Airport and Takamatsu Station roughly twice per hour (¥740 one-way; 40 minutes).
[edit] By train
Train service between Okayama, on Japan's main island of Honshū, and Takamatsu began operation in 1988 after construction of the Great Seto Bridge, allowing the train line to cross the Seto Inland Sea. It is the only railway link between Honshū and Shikoku.
For getting to Takamatsu, the ideal train to ride is the Marine Liner (マリンライナー), which runs directly between Okayama Station and Takamatsu Station. Trains run twice per hour in both directions (¥1,470 one-way; 55 minutes). Like all JR trains, the ride is free for those with a Japan Rail Pass. It is also important to note that because the Marine Liner is classified as a 'rapid' (快速 kaisoku) train, the Seishun 18 Ticket is valid on this train.
A limited express train (特急 tokkyū) called the Uzushio (うずしお) runs hourly to Takamatsu from Tokushima (One hour, ¥3070). A few Uzushio trains run between Takamatsu and Okayama on the exact same route as the Marine Liner; you have the option of using those trains if you have a Japan Rail Pass, but generally you should use the cheaper and more frequent Marine Liner.
Okayama Station, being a primary station on the bullet train line (shinkansen), is a convenient place to connect to and from other parts of Japan: Hiroshima, 1 hr 40 min; Osaka, 2 hrs; Tokyo, 4.5 hrs; and more...
An overnight sleeper train called the Sunrise Seto (サンライズ瀬戸) makes daily runs between Takamatsu and Tokyo Station. The train ride lasts about 9 1/2 hours. One-way prices vary, but a regular seat will cost at least ¥15,000, and a sleeper car will cost at least ¥20,000. Tickets and exact pricing are available from a JR ticket office or Japanese travel agency.
If you're interested in overnight travel, you'll be better off taking a bus (see below). But if you already have a Japan Rail Pass you can consider splitting up your journey, spending the night at a hotel along the way. For example, for a trip from Tokyo you could stay overnight in Okayama and then leave for Takamatsu on the first Marine Liner the next morning. If you are lucky to find a cheap business hotel you are likely to save money on your overall lodging costs.
[edit] By bus
A number of bus companies, including JR Bus and Takamatsu Express, operate buses to and from major cities in the Kansai area. Prices may very slightly from company to company but in general the prices and trip times are nearly identical. Buses can be booked online.
• Namba Station in Osaka to Takamatsu, 3 hrs 20 min, ¥3800 one-way, 48 round-trips daily.
• San'nomiya Station in Kobe to Takamatsu, 2 hrs 30 min, ¥3600 one-way, 27 round-trips daily.
• Kyoto Station in Kyoto to Takamatsu, 3 hrs 40 min, ¥4800 one-way, 7 round-trips daily.
Depending on the bus company, names of the above buses may include 'Foot Bus', 'Taka-nan bus', 'Takamatsu-Express Osaka-go', 'Takamatsu-Express Kobe-go', 'Takamatsu-Express Kyoto-go', and more.
Bus service is also available to and from Hiroshima on a bus named 'Setouchi'. (3 hrs 45 min, ¥4000 one-way, 5 round-trips daily).
Night bus service to Tokyo is also available from JR Bus. The 'Dream-Takamatsu-go' runs twice nightly in both directions between Tokyo Station and Takamatsu Station; one bus stops at Shinjuku en route. The ride takes approximately 10 hours and costs ¥10,000 one-way, ¥18,200 round-trip.
For a cheaper overnight trip, you can travel on discount bus operator Willer Express [4] between Tokyo and Okayama starting from ¥6000, then pay ¥1470 to travel to Takamatsu on the Marine Liner train.
[edit] By ferry
• Jumbo Ferry. This ferry runs 4 times daily between Kobe and Takamatsu. At both ends of the ferry, buses connect the ferry boarding point to the nearest major station — San'nomiya Station and Takamatsu Station, respectively. The Kobe-side connecting bus costs ¥200 and takes 5 minutes, the Takamatsu-side connecting bus is free and takes 15 minutes. The ferry sails under the Akashi Straits Bridge, and udon is available on board. Kobe to/from Takamatsu one-way ¥1800, round-trip ¥3300; bicycles ¥2140 extra; cars ¥4790 extra. edit
• Utaka-Kokudō Ferry. This ferry offers regular services between the Uno area of Tamano in Okayama Prefecture and Takamatsu. The trip takes about 55 minutes, and there are 44 round-trips daily. The ferry boarding points at both ends are close to the respective nearest train station. The ferry sails across the Seto Inland Sea between a number of islands. One-way ¥390; bicycles ¥440 extra; cars ¥1610 extra. edit
[edit] Get around
[edit] Rental Cycle
Takamatsu is a fairly walkable city and the downtown is pretty easy to navigate on foot, though a bicycle can improve things quite a bit; the city is just big enough where a bike is really the ideal mode of getting around. Luckily, it is extremely bike-friendly was designed with bike travel in mind. After even a short time in the city center it's hard to not notice the higher rate of people on bikes in Takamatsu compared to most cities in Japan of comparable size.
To match the city's bike-friendly design, Takamatsu has one of the best rental cycle systems in Japan; you can keep your rental bike overnight and it is extremely inexpensive overall. The system is so good and there are so many bikes available that many locals use the system as well, unlike most rental cycles in Japan which are designed exclusively for tourists. You can rent a bike for just ¥100 per day ... and by "day" they don't mean until the end of said day, they mean a full 24-hour period from the moment you rent the bike. So, if you arrive in the afternoon, stay one night, and then leave in the morning; that only requires one "day" of bicycle rental and ¥100. Even better, you can keep your bike overnight, so there are no problems biking to a hotel in the evening and then returning the bike in the morning. It is possible to rent the same cycle for up to 72 hours – all you have to do is inform the staff when you rent the bike that you want it for more than 24 hours. With this extended option, the price of the bike is ¥100 per 24-hour period, so it isn't any more expensive than normal.
There are four rental cycle stations around town and the easiest to locate is in the basement of the bicycle parking area located in front of Takamatsu Station. If you walk out of the station, just look for some stairways leading underground with bike signs above. One key aspect of the rental process is that you will need a photo ID to rent a bike for the first time. Before your first rental you'll be asked to fill out a short application and submit some kind of official photo ID. A few minutes later you'll be issued a renter ID card and for future rentals you will only need this card. Travelers are unlikely to need a card for subsequent rentals, but the few minutes spent filling out the application to get a Takamatsu rental cycle will without a doubt pay off big time when it comes to exploring the city. While it may help to know some Japanese, filling out the application and renting a bike in general with no Japanese should not be a challenge as the staff will understand what you want and at least one of them should be able to manage basic English.
[edit] Train
The Kotoden (琴電), officially known as the Takamatsu-Kotohira Electric Railroad, is also a viable means of getting around parts of downtown Takamatsu. In particular, the Kotoden is convenient for going between Ritsurin Park, Kawaramachi, and the Takamatsu Station/Castle area. The JR lines, utilized more for inter-city travel, don't run terribly often and are not very well-suited for getting around town, particularly the city center.
[edit][add listing] See
Twisting pine trees at Ritsurin Park
[edit] Downtown
• Ritsurin Park (栗林公園 ritsurin kōen), 1-20-16 Ritsurin-cho (5 min walk from Ritsurin Kōen Station (Kotoden), exit station and walk straight along the road. Also, a 3 min walk from Ritsurin Kōen Kitaguchi Station (JR) and also accessible by bus), +81 087 833-7411, [5]. Sunrise to sunset (varies by month). A beautiful and very large Japanese landscape garden built for the Sanuki and Sasuma lords and has been designated a Japanese National Treasure. It is full of intriguing items and spectacular views; it is likely to cause even those who have lived in Japan long-term to have a "Wow, I'm really in Japan!" moment. Although it is not one of the official top three gardens of Japan, it is undoubtedly one of Japan's most impressive gardens, and it benefits from generally being less crowded than its counterparts which are members of the illustrious top 3. Some of the garden's highlights include the Engetsu-kyo Bridge (primary symbol of the park), the Okedoi-no-Taki Waterfall, the 'Red Wall of Rocks', a lotus pond, a large number of Japanese pine trees including the turle+crane rock, as well as other impressive sights. The park also contains three tea houses, a restaurant, and a folk craft museum. You can experience tea ceremony lite at the tea houses for small additional fee. On the map you receive when you purchase your ticket (and on the website), you'll find a number of walking routes, including one specifically designed for handicap visitors. ¥400 (adults), ¥170 (children). (34.329591,134.043968) edit
• Tamamo Park (玉藻公園 tamamo kōen), 2-1 Tamamo-cho (5 min walk from Takamatsu Station. Directly behind Takamatsu-Chikkō Station, origin of the Kotoden line), +81 087 851-1521, [6]. 7AM-6PM Apr-Sep, 8:30AM-5PM Oct-Mar, closed Dec 29-Jan 3. A picturesque park conveniently located very close to the main station area. It is home to the old site of Takamatsu Castle, which played an important role in the city's history. The main tower of the castle, dismantled during the Meiji era, is currently in the process of being rebuilt. There are a number buildings within the complex, and in early April it is a popular place to take in the cherry blossoms. ¥200 adults, ¥100 children. edit
• The Kagawa Museum (香川県立ミュージアム kagawa kenritsu myūjiam), 5-5 Tamamo-cho, +81 087 822-0002, [7]. Tu-Su 9AM-5PM, closed Dec 27-Jan 1, closed Golden Week. Contains exhibits on the history, traditions, and people of Kagawa Prefecture, formerly known as Sanuki Province. Much of the information is only available in Japanese, however a free English audio guide is available for the permanent Kagawa history exhibit on the top floor. ¥400. (34.349708,134.053266) edit
• Takamatsu Symbol Tower (高松シンボールタワー), Sunport 2-1 (200m NE of Takamatsu Station.), +81 087 811-1676, [8]. This building has several observation decks with views of the sea and nearby peninusulas. There is also a shopping mall with many restaurants in the eastern building. (34.352879,134.046464) edit
[edit] Yashima
Ten minutes by train to the east is Yashima (屋島), a peninsula famous as the site of the Battle of Yashima in the Genpei Wars. There are many sites to see for those interested in the local history. To get to Yashima, take either the local train, from Takamatsu-Chikkō Station with one transfer, or the JR train, from Takamatsu Station. Either one takes about 15 minutes.
• Yashima Temple (屋島寺 Yashima-ji), Higashimachi 1808, Yashima, +81 087 841-9418. Free. (34.357945,134.101224) edit
• Yashima Temple Museum. edit
• New Yashima Aquarium (新屋島水族館 Shin-Yashima Suizokukan), Higashimachi 1785-1, Yashima, +81 087 841-2678 (, fax: +81 087 843-9659), [9]. 9AM-5PM, closed Jan 1-3. Adults ¥1200, JHS/HS students ¥700, children ¥300. (34.358587,134.09991) edit
• Shikokumura (四国村), 91 Nakamachi, Yashima, +81 0878 43-3111, [10]. Nov-Mar 8:30AM-5:30PM, Apr-Oct 8:30AM-6PM. An interesting open-air museum showing old houses collected from all around Shikoku. Inside the open-air museum there is a small art museum with works of Western artists including Pablo Picasso. The building has a nice garden with a nice panorama and was designed by Tadao Ando. It's about 20 minutes from the center of town. Take a Kotoden train from Takamatsu-Chikko Station to Kawaramachi Station, transfer to the Shido Line, and disembark at Kotoden Yashima. Adults ¥800, high school students ¥500, children ¥300. (34.343799,134.108251) edit
• Yashima Shrine (屋島神社 Yashima Jinja), 屋島中町140, +81 087 841-9475. This shrine was originally built in 1652, and has been rebuilt since. (34.345679,134.107771) edit
• Tamamo Breakwater, (5 mins from Takamatsu station). The breakwater makes for a nice stroll at sunset, with an illuminated red lighthouse at the end. edit
[edit][add listing] Do
There are two big festivals in Takamatsu – one in the summer and the other in the winter.
• Sanuki Takamatsu Festival, (In front of Takamatsu Station and near the sea.), [11]. The first day is the opening; the second day is a fireworks festival; the last day is a dance festival. Visitors can enjoy the central park, the shopping arcade, and "Sanport". edit
• Winter Festival, [12]. See beautiful Christmas displays at the central park for a month. edit
• Firefly Festival, [13]. Held in June.. edit
• Hyoge Festival. The 2nd Sunday in September.. edit
[edit][add listing] Buy
Takamatsu has a number of long arcade-style shopping streets, called shotengai (商店街), giving the city's shopping a more traditional feel. You'll find shops of all sorts on these streets, much as you would at a mall, as well as lots of udon shops. They are concentrated in the portion of the city between Takamatsu Station and Kawaramachi. By name, they are:
• Hyōgo-machi (兵庫町)
• Katahara-machi (片原町)
• Marugame-machi (丸亀町)
• Lion Avenue (ライオン通 Raion-dōri)
• South Shinmachi (南新町 Minami-shinmachi)
• Tokiwa-gai (常磐街)
• Tamachi (田町)
[edit][add listing] Eat
Kake udon
[edit] Udon
Takamatsu is extremely well-known throughout Japan for its udon, one of the three major types of Japanese noodle dishes. Udon noodles are distinctive in that they are white, fairly thick, and chewy.
Kagawa Prefecture is famous for this food, and the type made within the prefecture is sometimes called Sanuki udon, 'Sanuki' being Kagawa's name before the modern era. While this can be considered a regional specialty of Kagawa, the Sanuki variety is so widely-loved throughout Japan that it is often thought of as the 'normal' type, and is what most people imagine when they hear the word 'udon'. Despite udon being so widespread, Takamatsu does it better and cheaper than anywhere else in the country. There are literally hundreds of udon shops within the city limits. Because local foods are often a driving force in Japanese tourism, many people flock to the city for the udon, often doing "chain-eating" tours around the city to famous shops.
Udon is an extremely budget-friendly food, and it's a simple but tasty item that is easy to eat even for those who don't especially take to Japanese food, so travelers should make an effort to eat udon at least once while in Takamatsu.
The average Takamatsu udon shop has a variety of udon dishes available. These are some of the standard types:
• Kake udon — (Hot) The most basic variety. The noodles come in a hot dashi and soy-flavored broth and will likely have sliced onions thrown in. Some places may also add a slice of kamaboko (fish sausage) as well. You're likely to have a pinch of ginger added to the broth.
• Kitsune udon — (Hot) Like kake udon, but with a large slab of fried tofu in the bowl.
• Tempura udon — (Hot) Also like kake udon, but with a some tempura thrown in for good measure. Typically the tempura will be shrimp plus a vegetable or two, however at the cheapest places the tempura will be kaki-age, a vegetable-shrimp patty.
• Kama'age udon — (Hot) Identical to zaru udon in manner of eating, however noodles come hot instead of cold. As far as taste is concerned, it's quite similar to kake udon.
• Zaru udon — (Cold) Cold noodles come on a wooden tray. From there, you pick them up, dip them into a soy-based broth that comes with the dish, and then eat.
There are many more types – different toppings (raw egg, for example) lead to different names. It's rare for a typical bowl of udon to exceed ¥1000, and not uncommon for the simpler types to hover around ¥400. ¥100 bowls are even available at some places. Feel free to ask locals about good udon shops – they are sure to know some.
• Tsurumaru (手打ちうどん 鶴丸), 古馬場町9-34 (About halfway between Kataharamachi Station and Kawaramachi Station on the road running along the Kotoden Line.), +81 087 821-3780. 11AM-2PM, 8PM-3AM. One of the more noteworthy udon shops in town. Specializes in curry udon. An English menu is available. ¥400-1200 per bowl. (34.342497,134.05237) edit
[edit][add listing] Drink
[edit][add listing] Sleep
There are cheap business hotels around JR Takamatsu Station and Ritsurin-koen.
• Golden Time, 2-1-7 Kawaramachi (Kotoden Kawaramachi Station), +81 0878-97-3177, [14]. Nice capsule hotel with several varieties of saunas. It's for men only, though. ¥3000. edit
• Takamatsu Century Hotel (高松センチュリーホテル), 1-4-19 Nishikimachi, +81 0878-51-0558, [15]. checkin: 3PM; checkout: 11AM. A short walk from JR Takamatsu Station. All rooms have LAN Internet access. Large Western-style business hotel, well-suited for single travelers or large groups. Rooms from ¥5775 twin, meals ¥500-1200. edit
• Sanukinoyu Dormy Inn (さぬきの湯 ドーミーイン高松), 1-10-10 Kawaramachi (Kotoden Kawaramachi Station), +81 0878-32-5489, [16]. A modern Western-style hotel with a pleasant rotemburo (open-air bath) at the top. Rooms from ¥10,000 double. edit
• Toyoko Inn Takamatsu Hyogomachi (東横INN高松兵庫町), Hyogo-machi 3-1 (Several blocks S/SW of Takamatsu Station, next to Lawson.), +81 087-821-1045, [17]. checkin: 4PM; checkout: 10AM. This is a branch of the national business hotel chain. The rooms are clean and comfortable, though not large. Japanese-style breakfast is included in the price. There is wired internet in each room and computers for use in the lobby. Reservations can be made online in English, though the clerk is not likely to speak much. Single for ¥5980. (34.346251,134.048071) edit
• Castle Hotel, 4-8 Tsuruyamachi, Takamatsu (On the left hand side right after crossing the railway when coming from JR station). checkin: 12pm; checkout: 10am. This hotel could easily be your best budget japanese style hotel experience. Japanese style rooms have a tea table, tv, kettle, fridge, a separate sleeping area with futon and a real japanese bath. Every room has yukata (kimono style robe) ready for guests. Friendly owner speaks good english. Don't get confused as the hotel is not marked in English. It's the first building after the railway crossing. The same railway crossing won't let you sleep early or late as it starts beeping every ten minutes from 6am to midnight. Double for ¥3500. (34.346556,134.054706) edit
[edit] Get out
Takamatsu is the main entry point for Shikoku and from here the entire island is your oyster.
• Kotohira, site of the famed Kompira Shrine, is an hour away by Kotoden train.
• Marugame, the site of Marugame Castle, one of Japan's few remaining original castles.
• Mount Ishizuchi, the tallest peak in Shikoku, is about two hours away.
• Naoshima, a small island on Seto Inland Sea with superb contemporary art museums, is one hour away by boat.
• Tokushima, capital of Tokushima Prefecture, is most famous for its Awa Odori Festival.
• Kochi, is famous for the beautiful Kochi Castle, which is one of Japan's few remaining original castles.
Easy day trips to the mainland:
• Okayama, home to the beautiful Korakuen Garden, one of Japan's top three gardens, as well as the beginning of the Kibiji District Trail
• Kurashiki, famous for the Bikan Historic District, one of Japan's largest and best preserved historic neighborhoods.
• Tsuyama A wonderful little town famous for Kakuzan Park, which contains the ruins of Tsuyama Castle and thousands of cherry blossoms within its precints, the historic Joto Street, and the beautiful Shurakuen Garden.
Also, depending on timing and visa, Shanghai is an option, with Spring Airlines and its typically low fares.
Routes through Takamatsu
MatsuyamaN Sakaide JCT W E Sanukinaruto
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
A more complete article exists in Japanese. If you are familiar with the language, please help with translation!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:19.000Z
|
bkgk47qnnmuovslw4n3vtg5rqumq3u67
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69414",
"uncompressed_offset": 305102361,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyCatalogue/24312AD7376BA76BCA2570A4007A6816",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyCatalogue/24312AD7376BA76BCA2570A4007A6816?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
2033.6.55.001 - Census of Population and Housing: Socio-Economic Indexes for Areas (SEIFA), Tasmania - Data Cube only, 2001
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 05/10/2006 Reissue
Page tools: Print Page Print All RSS Search this Product
• About this Release
22/08/2007 Note: The data cube has been modified to include location names for easier data analysis.
05/10/2006 Note: A new document Details.rtf has been added to the downloadable zip file 05 October 2006. This new rtf file contains help documentation that defines and explains some of the fields in the spreadsheets also provided in the zip file.
ABOUT THIS RELEASE
Socio-Economic Indexes for Areas 2001 (SEIFA 2001) - Data only product, which provides the four indexes developed by the ABS in .XLS format. The ABS has developed indexes to allow ranking of regions/areas, providing a method of determining the level of social and economic wellbeing in that region.
The four indexes are:
Index of Advantage\Disadvantage
Index of Disadvantage
Index of Economic Resources
Index of Education and Occupation
These indexes show where the affluent (as opposed to just high income earning) live; where disadvantaged (as opposed to the unemployed) live: and where the highly skilled and educated (as opposed to the tertiary educated people) live.
SEIFA 2001 provides information and rankings for a wide range of geographic areas.
This product is the Data Only component of the Census of Population and Housing: Socio-Economic Indexes for Areas (SEIFA), Tasmania - 2033.6.30.001.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:03:36.000Z
|
7dpi4mrizwgozhra7dr43mxy2riapkou
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69415",
"uncompressed_offset": 305109788,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/86FC4FFB01C124A9CA2570B500168970",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/86FC4FFB01C124A9CA2570B500168970?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
4334.0 - National Health Survey: Private Health Insurance, Australia, 1995
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 28/05/1998
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
Contains statistics showing the level of private health insurance in Australia, and selected characteristics of those with and without cover.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:19.000Z
|
dmqst6jtddwmvb743ofqgugevcogozsd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69416",
"uncompressed_offset": 305116599,
"url": "www.abs.gov.au/Ausstats/abs%40.nsf/Previousproducts/AB3AA77D00D06A45CA256B350010B401",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.abs.gov.au/Ausstats/abs@.nsf/Previousproducts/AB3AA77D00D06A45CA256B350010B401?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2002
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 25/01/2002
Page tools: Print Page RSS Search this Product
Contents >> Population >> Bibliography
ABS publications
• Australian Demographic Statistics (3101.0).
• Australian Demographic Trends (3102.0).
• Australian Demography (Commonwealth Bureau of Census and Statistics, Bulletins produced 1900-1969).
• Australian Historical Population Statistics (3105.0.65.001).
• Australian Social Trends (4102.0).
• Births, Australia (3301.0).
• Census of Population and Housing, 30 June 1981: summary characteristics of persons and dwellings, Australia (2443.0).
• Census of the Commonwealth of Australia, 3rd April 1911, Volume II (Commonwealth Bureau of Census and Statistics).
• Deaths, Australia (3302.0).
• Demographic Estimates and Projections: Concepts, Sources and Methods. Available in the Statistical Concepts Library on the ABS Internet site at http://www.abs.gov.au
• Estimated Resident Population by Country of Birth, Age and Sex, Australia (3221.0).
• Experimental Estimates of the Aboriginal and Torres Strait Islander Population, 30 June 1991-30 June 1996 (3230.0).
• Experimental Projections of the Aboriginal and Torres Strait Islander Population, 30 June 1996-30 June 2006 (3231.0).
• Family Characteristics, Australia (4442.0).
• Household and Family Projections, Australia 1996-2021 (3236.0).
• Household Estimates, Australia (3229.0).
• Labour Force Status and Other Characteristics of Families, Australia (6224.0).
• Marriages and Divorces, Australia (3310.0).
• Migration, Australia (3412.0).
• Overseas Arrivals and Departures, Australia (3401.0).
• Population by Age and Sex, Australian States and Territories (3201.0).
• Population Projections, Australia 1999 to 2101 (3222.0).
• Regional Population Growth, Australia and New Zealand (3218.0)
• Year Book Australia 1994 (1301.0).
• Year Book Australia 1988 (1301.0).
• Year Book Australia 2001 (1301.0).
Other publications and references
Australian Citizenship Council 2000, Australian Citizenship for a New Century, available on the Internet site of the Australian Department of Immigration and Multicultural Affairs (the Citizenship Council page at http://www.immi.gov.au/citizenship/report.htm).
Australian Institute of Aboriginal and Torres Strait Islander Studies 1994, Encyclopedia of Aboriginal Australia, Aboriginal Studies Press, Canberra. Also available on CD-ROM.
Bureau of Immigration, Multicultural and Population Research 1978, Australian Immigration - Consolidated Statistics, No. 10, AGPS, Canberra.
Department of Immigration and Multicultural Affairs:
• Annual Report (various years), DIMA, Canberra.
• 1999, Australian Citizenship, 1996 Census: Statistical Report No. 26, DIMA, Canberra.
• 2000, Fact Sheet 66, Australian Citizenship, DIMA, Canberra.
• Australian Immigration: Consolidated Statistics (various nos, various years), DIMA, Canberra.
• 1995, 1996, 1997, 1998, 1999, Immigration Update, DIMA, Canberra.
• Protecting the Border: Immigration Compliance, December 1999.
• 2000, Immigration Aspects, 2000 edition.
• 2001, Fact Sheet 80, Locating Overstayers in Australia, DIMA, Canberra.
• 2001, Fact Sheet 81, Unauthorised Arrivals by Air and Sea, DIMA, Canberra.
Hugo, G. 1986, Australia's Changing Population, Oxford University Press, Melbourne.
Hugo, G. 1999, Demographic Trends Influencing Housing Needs and Demands In Australia. Paper presented to AHURI Workshop on Innovation in Housing, Melbourne.
Hugo G. 2001, "A Century of Population Change in Australia", in Year Book Australia 2001 (1301.0).
Evans, M. 1988, "Choosing to be a citizen: the time-path of citizenship", in Australia International Migration Review, Vol. 22, No. 2.
Statistics New Zealand, National Population Estimates, March 2001 quarter.
United Nations Development Programme (UNDP) 2000, Human Development Report 2000, UNDP, New York, Oxford, Oxford University Press. Also available for downloading from the UNDP Internet site (see below) at www.undp.org/hdr2000/home.html
United Nations 1999, 1997 Demographic Yearbook, United Nations, New York.
United Nations 1999, World Population Prospects, 1998 revision.
U.S. Bureau of the Census, International Data Base, at http://www.census.gov/ipc/www/idbsum.html
Internet sites
Australian Institute of Aboriginal and Torres Strait Islander Studies, at http://www.aiatsis.gov.au
Commonwealth Department of Immigration and Multicultural Affairs, at http://www.immi.gov.au. The Australian Immigration Statistics page is at http://www.immi.gov.au/statistics/
United Nations Development Programme, at www.undp.org
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:18:29.000Z
|
udspfnnct5xwkvmeftilkehpklfsgfi2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69422",
"uncompressed_offset": 326671459,
"url": "www.antweb.org/description.do?genus=camponotus&name=anthrax&project=calants&rank=species&subfamily=formicinae",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.antweb.org/description.do?subfamily=formicinae&genus=camponotus&name=anthrax&rank=species&project=calants"
}
|
cccc_CC-MAIN-2013-20
|
Nearctic: California > Formicidae > Formicinae > Camponotus > Camponotus anthrax
See all Camponotus anthrax in All Antweb or Bolton World Catalog
or in
Species: Camponotus anthrax
Name Status:
Taxonomic Hierarchy:
Subfamily: Formicinae Genus: Camponotus
Taxonomic History (provided by Barry Bolton, 2013)
Camponotus anthrax Wheeler, 1911d PDF: 96 (s.w.q.m.) U.S.A. AntCat AntWiki
Taxonomic history
Combination in Camponotus (Camponotus): Forel, 1914a PDF: 266; in Camponotus (Myrmentoma): Emery, 1920b PDF: 257.
See also: Snelling, 1988 PDF: 59.
Distribution:
BC
Taxon Page Author History
Taxonomic Treatment (provided by Plazi)
Ward, P. S., 2005:
E2 [endemic to California floristic province (Hickman, 1993)]
Specimen Data Summary
Found most commonly in these habitats: 5 times found in chaparral, 1 times found in oak-juniper woodland
Elevations: collected from 360 - 1140 meters, 753 meters average
3 Specimens Imaged | View All 15 Specimens for this species
CASENT0005339
CASENT0249363
CASENT0249364
Enlarge Map
TOOLS:
View:
- Browse Specimens for this species (15 examples)
- View Camponotus anthrax in Google Earth
Comparison Tool:
- Compare images of the Specimens within this species
Catalog:
- See Hymenoptera Name Server
Download:
Specimen Data:
- KML
- Tab-delimited
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:08.000Z
|
pbneyfzrq6gaero7p2h6dun2nerbeai2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69427",
"uncompressed_offset": 355652266,
"url": "www.biomedcentral.com/1471-2407/12/454/abstract",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.biomedcentral.com/1471-2407/12/454/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Effect of the MDM2 promoter polymorphisms SNP309T>G and SNP285G>C on the risk of ovarian cancer in BRCA1 mutation carriers
Merete Bjørnslett1,2, Stian Knappskog3,4, Per E Lønning3,4 and Anne Dørum5,6*
Author Affiliations
1 Department of Medical Genetics, Oslo University Hospital – The Norwegian Radium Hospital, Oslo, Norway
2 Institute of Clinical Medicine, University of Oslo, Oslo, Norway
3 Section of Oncology, Institute of Medicine, University of Bergen, Bergen, Norway
4 Department of Oncology, Haukeland University Hospital, Bergen, Norway
5 Department of Gynecological Oncology, Oslo University Hospital – The Norwegian Radium Hospital, PO Box 4953, Nydalen, N-0424, Oslo, Norway
6 Faculty of Medicine, University of Oslo, Oslo, Norway
For all author emails, please log on.
BMC Cancer 2012, 12:454 doi:10.1186/1471-2407-12-454
Published: 5 October 2012
Abstract
Background
While BRCA mutation carriers possess a 20-40% lifetime risk of developing ovarian cancer, knowledge about genetic modifying factors influencing the phenotypic expression remains obscure. We explored the distribution of the MDM2 polymorphisms SNP309T>G and the recently discovered SNP285G>C in Norwegian patients with BRCA related ovarian cancer.
Methods
221 BRCA related ovarian cancer cases (BRCA1; n = 161 and BRCA2; n = 60) were tested for the MDM2 polymorphisms. Results were compared to healthy controls (n = 2,465).
Results
The SNP309G allele was associated with elevated OR for ovarian cancer in BRCA1 mutation carriers (SNP309TG: OR 1.53; CI 1.07-2.19; p = 0.020; SNP309GG: OR 1.92; CI 1.19-3.10; p = 0.009; SNP309TG+GG combined: OR 1.61; CI 1.15-2.27; p = 0.005). In contrast, the SNP285C allele reduced risk of BRCA1 related ovarian cancer in carriers of the SNP309G allele (OR 0.50; CI 0.24-1.04; p = 0.057). Censoring individuals carrying the SNP285C/309G haplotype from the analysis elevated the OR related to the SNP309G allele (OR 1.73; CI 1.23-2.45; p = 0.002). The mean age at disease onset was 3.1 years earlier in carriers of SNP309TG+GG as compared to carriers of SNP309TT (p = 0.068). No such associations were found in BRCA2 related ovarian cancer.
Conclusions
Our results indicate the SNP309G allele to increase and the SNP285C allele to reduce the risk of BRCA1 related ovarian cancer. If confirmed in independent studies, this finding may have implications to counseling and decision-making regarding risk reducing measures in BRCA1 mutation carriers.
Keywords:
Ovarian cancer; BRCA; MDM2 SNP285; MDM2 SNP309
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:30:35.000Z
|
fslvbzw656v6pzpcqngzhnmj6q62hwgj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69428",
"uncompressed_offset": 355676667,
"url": "www.biomedcentral.com/1471-2458/6/114/abstract",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.biomedcentral.com/1471-2458/6/114/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Mental health: A cause or consequence of injury? A population-based matched cohort study
Cate M Cameron1*, David M Purdie2, Erich V Kliewer3,4,5 and Rod J McClure1
Author Affiliations
1 School of Medicine, Griffith University, Meadowbrook, Australia
2 Queensland Institute of Medical Research, Brisbane, Australia
3 Department of Epidemiology and Cancer Registry, CancerCare Manitoba, Winnipeg, Canada
4 Department of Community Health Sciences, University of Manitoba, Winnipeg, Canada
5 School of Public Health, University of Sydney, Sydney, Australia
For all author emails, please log on.
BMC Public Health 2006, 6:114 doi:10.1186/1471-2458-6-114
Published: 2 May 2006
Abstract
Background
While a number of studies report high prevalence of mental health problems among injured people, the temporal relationship between injury and mental health service use has not been established. This study aimed to quantify this relationship using 10 years of follow-up on a population-based cohort of hospitalised injured adults.
Methods
The Manitoba Injury Outcome Study is a retrospective population-based matched cohort study that utilised linked administrative data from Manitoba, Canada, to identify an inception cohort (1988–1991) of hospitalised injured cases (ICD-9-CM 800–995) aged 18–64 years (n = 21,032), which was matched to a non-injured population-based comparison group (n = 21,032). Pre-injury comorbidity and post-injury mental health data were obtained from hospital and physician claims records. Negative Binomial regression was used to estimate adjusted rate ratios (RRs) to measure associations between injury and mental health service use.
Results
Statistically significant differences in the rates of mental health service use were observed between the injured and non-injured, for the pre-injury year and every year of the follow-up period. The injured cohort had 6.56 times the rate of post-injury mental health hospitalisations (95% CI 5.87, 7.34) and 2.65 times the rate of post-injury mental health physician claims (95% CI 2.53, 2.77). Adjusting for comorbidities and pre-existing mental health service use reduced the hospitalisations RR to 3.24 (95% CI 2.92, 3.60) and the physician claims RR to 1.53 (95% CI 1.47, 1.59).
Conclusion
These findings indicate the presence of pre-existing mental health conditions is a potential confounder when investigating injury as a risk factor for subsequent mental health problems. Collaboration with mental health professionals is important for injury prevention and care, with ongoing mental health support being a clearly indicated service need by injured people and their families. Public health policy relating to injury prevention and control needs to consider mental health strategies at the primary, secondary and tertiary level.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:08.000Z
|
tk4v2h7gp4jw3xdydn5xego3dbg4yws5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69429",
"uncompressed_offset": 355689187,
"url": "www.biomedcentral.com/1472-6963/9/172",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.biomedcentral.com/1472-6963/9/172"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Long-term care cost drivers and expenditure projection to 2036 in Hong Kong
Roger Y Chung1, Keith YK Tin1, Benjamin J Cowling1, King P Chan1, Wai M Chan2, Su V Lo3,4 and Gabriel M Leung1*
Author Affiliations
1 School of Public Health, Li Ka Shing Faculty of Medicine, The University of Hong Kong, Hong Kong SAR, PR China
2 Family and Elderly Health Services, Department of Health, Government of the Hong Kong SAR, PR China
3 Research Office, Food and Health Bureau, Government of the Hong Kong SAR, PR China
4 Strategy and Planning Division, Hospital Authority, Hong Kong SAR, PR China
For all author emails, please log on.
BMC Health Services Research 2009, 9:172 doi:10.1186/1472-6963-9-172
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1472-6963/9/172
Received:13 March 2009
Accepted:24 September 2009
Published:24 September 2009
© 2009 Chung et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Hong Kong's rapidly ageing population, characterised by one of the longest life expectancies and the lowest fertility rate in the world, is likely to drive long-term care (LTC) expenditure higher. This study aims to identify key cost drivers and derive quantitative estimates of Hong Kong's LTC expenditure to 2036.
Methods
We parameterised a macro actuarial simulation with data from official demographic projections, Thematic Household Survey 2004, Hong Kong's Domestic Health Accounts and other routine data from relevant government departments, Hospital Authority and other LTC service providers. Base case results were tested against a wide range of sensitivity assumptions.
Results
Total projected LTC expenditure as a proportion of GDP reflected secular trends in the elderly dependency ratio, showing a shallow dip between 2004 and 2011, but thereafter yielding a monotonic rise to reach 3.0% by 2036. Demographic changes would have a larger impact than changes in unit costs on overall spending. Different sensitivity scenarios resulted in a wide range of spending estimates from 2.2% to 4.9% of GDP. The availability of informal care and the setting of formal care as well as associated unit costs were important drivers of expenditure.
Conclusion
The "demographic window" between the present and 2011 is critical in developing policies to cope with the anticipated burgeoning LTC burden, in concert with the related issues of health care financing and retirement planning.
Background
Among developed economies, there have been progressively vocal concerns expressed about how to fund long-term care (LTC) for their ageing populations, given generally low fertility rates which are only partly compensated for by immigration [1-5]. This problem is particularly acute in Hong Kong because its fertility rate is the lowest on a sustained basis [6] and its life expectancy is one of the longest in the world [7]. People aged 65 or over will increase by 176% in the next 30 years to 2036, while individuals aged 80 or over will rise even more rapidly by 277% within the same period [8]. This is inevitable for Hong Kong as large birth cohorts of baby boomers plus those born to the large migration waves of young workers during the 1950s and 1960s reach old age over the period [9]. The gravity of the potential burden becomes immediately apparent from inspecting the comparison of total and elderly dependency trends with China, Singapore, Japan and the average OECD countries in Figure 1.
Figure 1. Projected elderly, total dependency ratios based on official United Nations statistics, 1950-2050 [39].
It remains unclear, however, how these changing demographic patterns would translate into expenditure estimates, which in turn are critical for medium to long term budgetary planning and policy responses. In addition, what are the key drivers of LTC spending and would they be amenable to policy interventions? Hong Kong has yet to develop, or begun public discussion of, a comprehensive system-wide response to the potential funding pressures and service provision gap. Nevertheless, in 1997 in the first policy address of the Chief Executive since the repatriation, the government earmarked "care for the elderly" as a major strategic initiative and established the statutory Elderly Commission. Since then, there have been a number of policy initiatives during the past decade, such as the implementation of a standardised care needs assessment, based on the minimum dataset (MDS) instrument, to derive an objective priority list of elders eligible for community-based and institutional services, and the contracting out of residential care services to achieve better efficiency although the quality of such have been the subject of much debate and controversy. Here we offer a first systematic, quantitative examination of the extent of the problem now and in the future.
Strictly speaking Hong Kong does not have an LTC "system", as opposed to a patchwork of services in having to deal with sporadic needs of the aged population as and when they arose historically; although there have been a myriad of sub-system level internal needs assessment exercises and external consultancy reports over the years. Figure 2 summarises the structural ecology of LTC in Hong Kong currently. Institutional care has traditionally been mostly provided by the public or non-profit sector, the latter directly subvented by the former, although under the more recently introduced "bought place" scheme, private operators in addition to non-governmental organisations (NGOs) have been contracted to provide beds. The publicly financed Hospital Authority (HA), responsible for over 90% of total health care bed-days in the territory, also provides long-stay infirmary, psychiatry, mentally handicapped and hospice beds (see also Table 1). Non-institutional services fall under the remit of the government Social Welfare Department (SWD) and subvented NGOs (providing home care and day care), the Department of Health (DH) (providing primary preventive care at district level elderly health centres), and the HA (providing hospice care and community geriatrics outreach care by both medics and nurses, the latter two also covering older adults residing in institutions). Finally direct (mostly cash) subsidies of various types - socially indigent, physically or mentally disabled, demographically defined (Table 1) - are available to those eligible within and outside institutions.
Table 1. Long-term care services, corresponding units of utilisation and covariables in regressions to predict service use
Figure 2. An overview of Hong Kong's long-term care system.
In terms of financing source or agent for LTC, unlike say Japan (an East Asian, albeit much larger, neighbour also with a rapidly ageing/aged demographic structure and at a similarly advanced stage of economic development) with a social insurance model of LTC or Singapore (a city-state like Hong Kong with just over half its population size which runs an opt-out "Eldershield" severe disability insurance programme to benefit those at least 65 years, funded through debits from the population-wide medical savings accounts), the incidence of funds to support LTC services comes from government general revenue on the public side and direct out-of-pocket spending for privately purchased care, in approximately a 9:1 ratio [10,11].
Projections of LTC need, demand and associated expenditure have been conducted in various national settings [1,12-17] and by international organisations such as OECD [2], using a range of different methodologies. Two general categories of techniques have prevailed. One approach is to use a state-transition Markov model to simulate the experience of a cohort of older adults as they transition through different health and disability states at regular time intervals, according to a predefined set of transition probabilities [5] parameterised by longitudinal (panel) data [4,18]. However, Hong Kong does not have the requisite individual-level panel information [18]. On a conceptual level, Hong Kong's older population was very recently formed mostly by migrants during and after the Second World War. In fact over 80% of those aged at least 65 years were born in mainland China, whereas most birth cohorts since the 1960s were locally born. Therefore, the inherent historical heterogeneity of different cohorts of older adults presents additional difficulties to adopting the Markovian approach. An alternative methodology relies on the demographic extrapolation of current and projected future needs, while explicitly acknowledging the impact of local epidemiologic transition. One of the most comprehensive and policy-relevant projection models based on this approach is the study by the Personal Social Services Research Unit (PSSRU) in the UK [1]. With the requisite data available in the local context, we adopted this approach to project Hong Kong's total LTC expenditure to the year 2036.
In the following sections, we first detail the actuarial methods underlying the projection model, then summarise empirical results and finally draw conclusions that are directly relevant to policymaking in terms of future health and LTC financing reform.
Methods
Definitional boundaries
We considered LTC services according to the OECD definition [2], which refers LTC to a range of often basic services needed for persons who are dependent on help for carrying out basic activities of daily living. LTC aims at making the current unwell condition more bearable. It included health and social care, social security benefits as well as assessment and care management relevant to meeting LTC needs. Table 1 sets out the different types of LTC services and allowance benefits included.
We focused on older adults aged at least 60 years.
Data [see Additional File 1: Supplementary Table S1 for details] Baseline utilisation levels of LTC services were variously estimated from the Thematic Household Survey 2004 (THS 2004; Ninstitutional = 4114, Nnon-institutional = 4812, where sampling weights were applied in the analysis to represent the entire 60+ population as at 2004) that was specially commissioned to examine LTC issues, and from data provided by the SWD, HA, DH and relevant NGOs. Actual and projected population profiles were obtained from the Hong Kong Annual Digest of Statistics [19] and Hong Kong Population Projections 2007-2036, both published by the Government Census and Statistics Department. Baseline unit costs and allowances were derived from the latest set of Hong Kong's domestic health accounts [20], government budget estimates, as well as relevant government departments and organisations as above.
Additional file 1. Supplementary Tables. This additional file includes 7 tables supplementary to the main text of the manuscript (Supplementary Table S1-S7).
Format: DOC Size: 350KB Download file
This file can be viewed with: Microsoft Word Viewer
For the purposes of international comparability to other countries' expenditure estimates and inter-temporal comparability of the proportion of gross domestic product (GDP) spent on LTC within the local context, we expressed all expenditure estimates as a proportion of GDP. The predicted annual growth of per capita GDP was derived from internal projected estimates of the Financial Services and the Treasury Bureau, as at the first quarter of 2006.
Start and end dates
We specified the base year to be 2004 given the time of administration of the Thematic Household Survey and the most recent cost estimates derived for that year. Projected estimates were to the year 2036, to coincide with the availability of official demographic projections.
The projection model
Conceptual basis
We took a macro simulation approach following the UK PSSRU's LTC projection model [1,21]. We estimated three key linked outcomes that determine LTC spending: 1) the future numbers of older people requiring LTC; 2) the likely level of demand for LTC services and disability benefits for older people; and 3) the costs associated with this demand (inflated to the year to which the projection year relates). The PSSRU long-term care (LTC) model [1] estimates total LTC expenditure, Et, for each year t using the following equation:
(1)
where
SERNOjt represents the projected utilisation volumes in year t for service j (j = 1 to k). cjt is the unit cost of the care service inflated to the year t. pij is the probability of a person in age group-sex profile i (i = 1 to g) receiving service j, while ni is the number of older persons in the corresponding profile i.
Statistical details
For services that were covered by THS 2004, we specified separate multivariable logistic regression equations for each service (Table 1) to estimate the age-sex specific probability of receiving such, as follows:
(2)
where Yj is the utilisation for service j, xc (c = 1 to q) are covariables, and ac the parameter of the corresponding covariables. Covariables considered were based on the PSSRU framework, model fit and parsimony of the regression equations, and also dictated by data availability. They included age group, sex, the validated Chinese version of Minimum Data Set-Home Care (MDS-HC) as a proxy for disability [22], co-habitation pattern (viz marital status and household composition), housing type, housing tenure, and financial means (viz monthly household income and education attainment). Data of these covariables were derived from THS 2004, their descriptive statistics are presented in Additional File 1: Supplementary Table S2, and their distributions per age group and sex are presented in Additional File 1: Supplementary Table S3. The predicted probability of service utilisation associated with each subject, , is derived from the following equation:
(3)
where x's are covariables, and 's their corresponding parameter estimates.
To derive the future numbers of older people requiring LTC, we took the official projected demographic estimates and populated ten age-sex strata: (60-64, male); ...; (80+, male); (60-64, female); ...; (80+, female). We then multiplied the probability of use, as estimated above, by the number of older adults in each stratum, yielding age-sex-service specific utilisation volume as an output for the likely level of demand for LTC services and disability benefits for older people. We assumed constant age-sex-specific intensities of utilisation; thus, the level of demand for LTC services and disability benefits incorporated both the probability and intensity of utilisation. We adjusted for under-/mis-reporting and telescoping [23] by calibrating the predicted volume of service to match observed utilisation patterns (as obtained from relevant government departments) by age group and sex, and applied the resulting correction factors estimated for the base year to all subsequent years. Since our estimation of LTC demand was based on utilisation volumes of the formal LTC service recipients, it did not necessarily include all people who are in need of LTC. To project the unit costs of the services for 2005 to 2036, annual growth in unit costs were set at the average historical rates of change over the period 1999 to 2006. Finally in estimating the associated expenditure, we multiplied the relevant age-sex-specific unit cost by the predicted volume of receiving each service.
We assessed model fit of the regression equations by area under the receiver operating characteristics (ROC) curves and where possible we tried to specify the most parsimonious model. We performed internal validation of each regression model by bootstrapping, where we ran 1,000 iterations by sampling with replacement [Additional File 1: Supplementary Table S4].
For services that were not covered by THS 2004, mostly relating to assessment and care management as well as HA services, we carried out the projection exercise based on past trends of utilisation and unit costs obtained from relevant government departments. Specifically, spending on assessment and care management for the base year was estimated as per the government budgetary subheads of "Services for the Elderly" and "Social Security" programmes of SWD. To project such expenditure for future years, we accorded the same growth rate as that of the number of disabled older people [1], in turn a function of secular demographic change and the associated MDS-HC scores.
For services provided by the HA, we first derived the likely number of HA service recipients, by type, pro rata to the total projected number of older adults, as per the average ratios during 2004 to 2006. Growth in unit costs, by service type, was projected based on the historical rates of change from 1993 to 2004.
Additional File 1: Supplementary Table S5 describes the distribution of utilisation rates of LTC services per age group and sex, whereas Additional File 1: Supplementary Table S6 shows the average unit costs per year of the services.
Projection model assumptions and sensitivity scenarios
[see Additional File 1: Supplementary Table S7 for details]
Base case
We assumed that the age-sex-specific probability of service utilisation would remain constant as per the base year of 2004. Real annual growth in unit costs, based on historical trends over the period 1999 to 2006, were respectively set at 2.44%, 4%, 3.5%, and 2% for SWD institutional services, HA services, SWD non-institutional services, and social allowance benefits.
Based on the parameters of the base case, we also tested three hypothetical scenarios by varying the unit cost growth rate and/or population size and structure ceteris paribus. They are the "demographic change only," "unit cost change only," and "neither demographic nor unit cost change" scenarios. In the "demographic change only" scenario, we isolated the effect of an ageing and growing population (i.e., demographic changes according to the government population projections by age and sex) by setting the unit cost growth parameters to zero relative to other goods and services in the general economy; i.e., assuming neither utilisation patterns nor relative unit costs change from the baseline in 2004. In the "unit cost change only" scenario, in contrast, we isolated the effect of relative unit cost changes by assuming that the population size and structure would not change from baseline. Finally, in the "neither demographic nor unit cost change" scenario, we estimated total LTC spending assuming no change in the population or relative cost from 2004. Clearly these scenarios are implausible in reality but can illustrate the relative contributions of demography and relative cost structure as spending determinants.
Demographic effect
We tested the robustness of the model projections to changes in household composition and marital status.
Given increasingly prevalent trends of older adults living alone that are likely to continue into the future [19,24], we assumed that the proportion of singleton households would reach 12% among males and 18% among females aged 70-74 years by 2036. The rate of change was linearly averaged out over the intervening years. The corresponding proportions for the other age-sex groups were scaled pro rata relative to their association with the 70-74 reference group in 2004.
Empirical observations suggest significant changes in marriage and divorce patterns that may be sustained [24,25]. Accordingly we assumed that among 70-74 men (women), the proportion of being separated/divorced/widowed would drop to 10% (15%), the proportion of being single would reach 10% (10%), thus the proportion of being married would become 80% (75%) by 2036, again implemented evenly over time. Similarly, the corresponding proportions in the other age groups were derived on a pro rata basis relative to the referent 70-74 age categories as at 2004 for each sex separately.
Compression of disability
Future secular changes in age-sex specific disability remain controversial [26,27]. On the optimistic side [28], the Brookings assumption specifies that the number of years with disability would remain constant: as life expectancy rises, the number of years without disability would increase by a similar amount. Operationally this involves moving the age-sex-specific disability prevalence forward by one year for each year increase in life expectancy. The double-Brookings scenario assumes that for every additional year of life, disability rates advance by two years; whereas the half-Brookings assumption only shifts the disability rate by half a year.
Informal care shift
Informal care refers to assistance given by spouses, other household members, relatives outside the household, neighbours, friends and domestic helpers. We explored the substitutional effect of informal care and the impact of the changing availability of such [29]. Of note, we do not attempt to monetarise the value of informal care or of its opportunity costs [29,30].
We assumed the availability of informal care would decline over time as the labour participation rate increases and traditional family structures and values move away from direct LTC provision within the family context. We incrementally reduced the number of individuals receiving informal care by 0.5, 1, and 2% annually and substituted for this decline by increasing the use of institutional and non-institutional services, matched to level of need as measured by the MDS-HC score according to a matching algorithm set forth by SWD as per current practice [31,32]. There were two matching schemes for the shift to non-institutional services, while there were three matching schemes for the shift to institutional services [see Additional File 1: Supplementary Table S7 for details].
Residential to community care shift
To reflect secular trends in deinstitutionalisation, we substituted an equivalent number of individuals who would otherwise be in institutional care with community-dwelling persons requiring formal non-institutional services. We reduced the number receiving institutional care by 1, 2, and 3% every 10 years. The compensatory services affected by such were similarly estimated based on the MDS-HC disability matching scheme [31,32]. There were six matching schemes as detailed in Additional File 1: Supplementary Table S7.
Carer-blind
This scenario supposes the same level of formal LTC service receipt regardless of the availability of informal care, which in effect reduces reliance on home or self help. Therefore we assumed that the proportion who would be "living alone" to gradually (i.e., by uniform time-dependent increments) reach 100% by 2036 for all age groups and both sexes.
Cost-pressure
Given the highly labour intensive nature of LTC, where technology-driven productivity gains are likely limited, we treated changes in unit costs with the 'Baumol effect' such that relative prices tend to rise compared to other goods and services in the general economy [33]. We increased the annual percentage growth of unit cost by an additional 0.5% (scenario 1) and 1% (scenario 2) over those in the base case.
Cost-containment
In contrast, we also explored the effect of constraining the cost pressures as described, likely exerted through public sector supply side measures. Correspondingly we decreased the annual percentage growth by 0.5% (scenario 1) and 1% (scenario 2) below the base case's growth rates.
Income elasticity
It is plausible that income growth in the economy could push up LTC expenditure due to greater demand for higher quality services. However, empirical evidence on income elasticity of LTC expenditure is scarce, and is usually assumed to be zero as we did in the base case [2]. Nevertheless, we tested the sensitivity of our results assuming income elasticity of 0.25 (scenario 1), 0.5 (scenario 2), and 1 (scenario 3) based on annual per capita GDP growth.
Additional File 1: Supplementary Table S7 summarises the assumptions underlying the base case, the hypothetical scenarios, and all sensitivity analyses.
All analyses were implemented in R version 2.5.0. All monetary values are expressed in real (i.e., inflation-adjusted) terms in 2004 dollars.
Results
Figure 3 shows the main results of predicted total spending on LTC to the year 2036 for the base case, the hypothetical scenarios and the different sensitivity scenarios. The secular trend for all models reflects changes in the elderly dependency ratio over time (Figure 1), except for hypothetical scenarios 2 and 3, which disregarded demographic changes. The comparative results of the base case and the hypothetical scenarios demonstrate that demographic changes have a larger impact than changes in unit costs on overall LTC expenditure. Specifically, as a proportion of GDP, it was predicted to increase from 1.4% in 2004, with a very temporary reprieve due to the demographic window until 2011, to 3.0% in 2036.
Figure 3. Estimated total expenditure on long-term care as a proportion (%) of GDP. Sub-figure: (a) base case + three hypothetical scenarios, (b) base case + demographic effect, (c) base case + compression of disability, (d) base case + informal care shift, (e) base case + institutional care shift to non-institutional care, (f) base case + carer-blind, (g) base case + cost-pressure, (h) base case + cost-containment, (i) base case + income elasticity.
In relative terms by service mix, the proportion allocated to institutional services is projected to increase from 37% in 2004 to 46% in 2036, while social allowance benefits would correspondingly decline from 49% to 40% during the same interval. Of note, whereas the larger proportion of social allowances are encashed, a smaller portion goes towards paying for institutional and non-institutional care directly. The proportion allocated to non-institutional services is projected to remain steady at around 13%. Figure 4 also shows that funding source (private vs. public) is highly correlated with type of service.
Figure 4. Projected proportions of expenditure for base case every ten years from 2004 to 2034*. Sub-figure: (a) total long-term care by service types, (b) total long-term care by funding source, (c) institutional care by funding source, (d) non-institutional care by funding source. * Projected proportions of expenditure for social allowances and assessment & care management are not shown because they are respectively 100% public and 100% public throughout the projection period.
Taken together, the various sensitivity scenarios yielded a range of spending estimates from 2.2% to 4.9% of GDP by 2036 (Figure 3). The highest estimates resulted from assuming the number of older adults receiving informal care would decrease by 2% annually which was substituted by a corresponding increase in government subvented institutional services. In fact, in all instances where the availability of informal care was reduced, LTC spending rose to varying degrees (i.e., progressively more expensive from "carer-blind" to substitution by non-institutional services and institutional care). In contrast, total spending could however become as low as 2.2% (2.6%) of GDP in 2036 if costs were to be controlled to the extent that it would grow less rapidly than productivity gains in the general economy by 1% (0.5%). Similarly, LTC spending could be contained between 2.3% and 2.5% if deinstitutionalisation, viz substitution by home care and day care, would prove successful.
In comparison, changes in unit costs under the 'cost-pressure' scenarios resulted in less variance from the base case. Total LTC expenditure per GDP would reach 3.5% and 4.1% by the end of the projection period respectively for average annual marginal unit cost growth of 0.5% and 1%.
Changes in household composition, marital status or compression of disability, to the extent of our sensitivity analyses [Additional File 1: Supplementary Table S7], made little difference to the projected estimates. Similarly, for scenarios with income elasticities of 0.25, 0.5 and 1, total spendings were all projected to be only slightly above the base case's through to 2036.
Discussion
Our findings show that, in parallel to secular changes in the elderly dependency ratio, Hong Kong's total spending on LTC would decrease from 1.4% of GDP in 2004 until reaching the same spending level by 2011, but thereafter show monotonic increases reaching 3.0% in 2036 (with an average annual growth rate of 3.1%). Thus the demographic window between the present and 2011 affords Hong Kong a critical period to discuss and debate policy options that would address this burgeoning financial burden. Moreover, demographic changes brought about by ageing are more important in driving the growth of LTC expenditure than non-demographic changes such as unit cost growth. Hong Kong's average annual spending growth rate is 1.1% higher (in absolute terms) than the OECD average over the period from 2005 to 2025, reflecting the intensity of ageing demographics locally compared to other high-income economies [34].
We outline some potential caveats. First, ours is an actuarial illustration of plausible scenarios and should not be taken as precise quantitative predictions of the future. Inherent in our linear extrapolations is the disregard of dynamic behavioural changes in response to policy interventions or macro-economic forces otherwise. Numerous other assumptions of the projection model, although explicitly detailed here, limited the range of the results and are all liable to deviations from actual circumstances in the future. Second, a major part of our data was based on THS 2004; thus the usual biases of a population-based survey would apply to our estimates. In mitigation, the predicted utilisation patterns were adjusted with reference to the age group-sex distribution of the observed utilisation patterns to control for under-/mis-reporting. Third, we should ideally have access to longitudinal panel data following a prospective cohort of ageing adults, which would have allowed us to implement an econometric model instead thus being able to take into account the dynamical nature of change. However, even were such available, social changes between a historical cohort and future generations of older adults would likely limit the interpretation of the empirical observations. Fourth, by grouping together all older persons aged 80 or above, the model is unable to disaggregate potential heterogeneity among the oldest-old whose dependency on formal or institutionalised LTC would be particularly acute. However, this was necessitated for the sake of statistical robustness of the model given the very small collective sample size of the 80+ group, lest the stratified cells contain too many zero counts. Fifth, expressing the future LTC financing burden as a proportion of GDP necessarily requires the projection of general economic growth (albeit based on rigorous statistical treatment of historical trends and implemented independently by the Government Economist). This has added an extra layer of uncertainty to the estimates that should be borne in mind when interpreting the results, but which reinforces our first caveat. Last, when considering the dual policy areas of health and LTC financing, there is some double-counting of expenditure due to overlapping definitional boundaries by convention in the two sets of literature. To be specific, these overlaps include all HA services, DH's elderly health centres, nursing homes, day care services, enhanced home and community care, as well as elderly with MDS level 7 or above residing in subvented and self-financed care and attention homes and private homes. They accounted for 31% of the total LTC expenditure in 2004, and our projections indicate that this proportion would rise to 37% by 2036. Acknowledging and accounting for such is especially important as Hong Kong is at present undergoing a consultation exercise on supplementary health financing with particular emphasis on post-65 health care needs [35]. Therefore clear distinction between LTC and health care definitional boundaries must be maintained between two closely related policy areas.
LTC planning should not be treated in isolation from the closely related policy issues of health care financing, where spending tends to be concentrated among the elderly, and retirement planning in general. A thorough and comprehensive examination of all three areas deserves special emphasis in Hong Kong, which has traditionally espoused a self-reliant society, rather than adopting the welfare state model of say continental Europe. While such a laissez-faire approach has allowed it to prosper and lift its largely immigrant population of young workers out of poverty since the 1950s, it poses an enormous challenge to policymakers who now have to deal with the same rapidly ageing individuals as they require health and long-term care and demand a share in the fruits of development.
Currently about one-tenth of LTC spending traces its incidence from private pockets while public sources provide the remaining majority. Looking into the future, given current patterns, public finances appear poised to be further saddled by the projected higher expenditure, not only in absolute but also relative terms. Compared to OECD economies, all of which levy substantially higher and broader-based taxes than Hong Kong, the local public revenue base as currently constituted is unlikely able to sustain this growing financial burden [2]. Coupled with the twinned set of health care expenses, which we projected to grow from 5.2% GDP in 2004 to 9.2% by 2033 [36], recurrent allocations would have to increase from 19.6% to 36.8% of total government budget by 2033 ceteris paribus which would crowd out other policy areas requiring public finances such as education, social welfare (except LTC) and security.
The issue of (non-disability related) social allowances, particularly given their large share of total LTC spending, should be considered together with the sufficiency of general retirement savings. Since 2000, Hong Kong has mandated that all workers and employers contribute, up to a cap, 5% of wages to a personal provident fund account from which withdrawal is only allowed post-65. Whether this progressively maturing retirement savings scheme could obviate at least some of the old age allowances currently in place remains to be examined although there would be tremendous political pressure against government withdrawing from such age-based welfare support.
There are several generalisable lessons that may be useful for and from other countries, especially those with a similar demographic and socioeconomic profile (e.g., Switzerland, Israel) and geo-cultural background (e.g., Singapore, Japan and mainland Chinese coastal urban centres). First, whereas there is an increasing tendency for Hong Kong residents to retire across the border in the Pearl River Delta (PRD) region of mainland China [37], the issue of whether such should be encouraged through economic incentives, given the much lower cost base of providing LTC north of the border thereby allowing further containment of total spending, needs further fleshing out and debate. In part this would depend on the long-term geopolitical integration of Hong Kong into the PRD and whether portability of welfare benefits such as post-retirement social and health care are generally extended to the PRD. Second, the 1999 Harvard Report [38] recommended an individual savings account (MEDISAGE), modelled after the Singaporean Medisave and ElderShield programme, to finance LTC in Hong Kong. Although only scant details were provided and no consensus was reached, renewed dialogue on the viability of such a programme should be vigorously pursued before the demographic window closes, and especially in the light of the recent health system reform consultation exercise [35]. Third, different countries have experimented with different ways of raising resources to support LTC. Japan, for example, with one of the longest living populations in the world, has recently mandated LTC social insurance in keeping with the same approach to health financing. This may be an alternative path for Hong Kong to consider although the appealing inter-temporal risk pooling with self inherent in the Singaporean savings account design would be lost.
Strengths of our study include:- 1) implementation of the model adapted from the validated methods of the UK PSSRU team [1,21] and further modified according to OECD specifications for international comparability [2]; 2) parameterisation of the model with locally relevant and up-to-date empirical data, including a recent special survey of representative samples of institutional and community-dwelling older adults; 3) objective needs assessment of and prediction of service use by LTC-related demographic and non-demographic factors such as the validated Chinese version MDS-HC, marital status, household composition, housing tenure and type, monthly household income and educational attainment; 4) robust uncertainty analysis by bootstrapping; and 5) identification of the impact of various "control knobs" or potential cost drivers by testing the base case against a wide range of sensitivity scenarios.
Conclusion
Two key take-home messages can be drawn from this projection exercise. First, in contrast to health care costs, demographic changes brought about by ageing are more important in driving LTC spending growth than non-demographic changes such as unit cost growth. In short, rapidly-ageing Hong Kong will inevitably bear an increasing LTC burden, unless there is a dramatic change in its population policy vis-à-vis substantially increased immigration of mainland Chinese or mass emigration of retirees. Second, the period between the present and 2011 is critical in developing policies to cope with the LTC burden alongside with the issues of health care financing and retirement planning. Irrespective of the eventual policy responses to Hong Kong's ageing population thus LTC need or demand, the reliable prediction of the associated financial liability in the medium to long run, as presented in this study, adds to the evidence base from which such can begin to be formulated and debated.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
RYC participated in the design of the study, acquisition and analysis of the data, interpretation of the results, drafting and revision of the manuscript. KYKT contributed to the design of the study, acquisition and analysis of the data, interpretation of the results and revision of the manuscript. BJC participated in the design of the study, analysis of the data, and revision of the manuscript. KPC participated in the analysis of the data and revision of the manuscript. WMC and SVL participated in the conception and design of the study, acquisition of the data, as well as revision of the manuscript. GML contributed to the conception and design of the study, acquisition of the data, interpretation of the results, and revision of the manuscript. All authors read and approved the final manuscript.
Acknowledgements
This study was funded by a Public Policy Research grant from the Hong Kong Research Grants Council (7010-PPR-3). RYC is supported by a research postgraduate studentship from the University of Hong Kong.
We thank the Elderly Division of the Labour and Welfare Bureau (formerly of the Health, Welfare and Food Bureau) for facilitating data access; the Social Welfare Department, Department of Health, Hospital Authority and inter-RAI (especially the regional team consisting of Iris Chi, Angela Leung and Kin Sun Chan) for helpful assistance in clarifying definitional boundaries and supplying input data.
The opinions expressed here are the authors' own and do not necessarily reflect those of the data suppliers or the authors' home institutions.
References
1. Wittenberg R, Comas-Herrera A, King D, Malley J, Pickard L, Darton R: Future demand for long-term care, 2002 to 2041: projections of demand for long-term care for older people in England. Canterbury: Personal Social Services Research Unit, London School of Economics; 2006.
2. Organisation for Economic Cooperation and Development: Projecting OECD health and long-term care expenditures: what are the main drivers? OECD Economics Department working paper no. 477. Paris: Organisation for Economic Cooperation and Development; 2006.
3. Hancock R, Comas-Herrera A, Wittenberg R, Pickard L: Who will pay for long-term care in the UK? Projections linking macro- and micro-simulation models.
Fiscal Studies 2003, 24:387-426.
4. Stone R: Long-term care for the elderly with disabilities: current policy, emerging trends, and implications for the twenty-first century. New York: Millbank Memorial Fund; 2000.
5. Karlsson M, Mayhew L, Plumb R, Rickayzen B: Future costs for long-term care: cost projections for long-term care for older people in the United Kingdom.
Health Policy 2006, 75:187-213. PubMed Abstract | Publisher Full Text
6. Yip PS, Lee J, Chan B, Au J: A study of demographic changes under sustained below-replacement fertility in Hong Kong SAR.
Social Science & Medicine 2001, 53:1003-9. PubMed Abstract | Publisher Full Text
7. World Development Indicators [http://go.worldbank.org/U0FSM7AQ40] webcite
The World Bank 2009.
8. Census and Statistics Department, Government of the Hong Kong Special Administrative Region: Hong Kong population projections 2007-2036. Hong Kong: Government Logistics Department; 2007.
9. Yip P, Lee J, Law CK: Implications of the demographic transition. In Hong Kong's health system: reflections, perspectives and visions. Edited by Leung GM, Bacon-Shone J. Hong Kong: Hong Kong University Press; 2006:61-80.
10. Chan ACM, Phillips DR: Policies on ageing and long-term care in Hong Kong. In Ageing and long-term care: National policies in Asia-Pacific. Edited by Phillips DR, Chan ACM. Canada: The International Development Research Centre Books; 2002.
11. Chu LW, Chi I: Long-term care and hospital care for the elderly. In Hong Kong's health system: reflections, perspectives and visions. Edited by Leung GM, Bacon-Shone J. Hong Kong: Hong Kong University Press; 2006:223-252.
12. Lagergren M: Whither care of older persons in Sweden? - a prospective analysis based upon simulation model calculations, 2000-2030.
Health Policy 2005, 74:325-34. PubMed Abstract | Publisher Full Text
13. Birch S: Health human resources planning for the new millennium: Inputs in the production of health, illness and recovery in populations.
Canadian Journal of Nursing Research 2002, 33:109-14. PubMed Abstract
14. Manton KG, Gu X: Changes in the prevalence of chronic disability in the United States black and non-black population above age 65 from 1982 to 1999.
Proceedings of the National Academy of Sciences 2001, 98:6354-9. Publisher Full Text
15. Singer BH, Manton KG: The effects of health changes on projections of health service needs for the elderly population of the United States.
Proceedings of the National Academy of Sciences USA 1998, 95:15618-22. Publisher Full Text
16. Zweifel P, Felder S, Meiers M: Ageing of population and health care expenditure: a red herring?
Journal of Health Economics 1999, 8:485-96. Publisher Full Text
17. Bowen T: Scientific and prospective evaluation of health costs and health needs arising from the aging of the population. Financial Report for Directorate General V. European Commission, Brussels; 2000.
18. Stallard E, Yee RKW: Non-insured home and community-based long-term care incidence and continuance tables. Schaumburg, Illinois: Society of Actuaries; 1999.
19. Census and Statistics Department, Government of the Hong Kong Special Administrative Region: Hong Kong annual digest of statistics 2007. Hong Kong: Government Logistics Department; 2007.
20. Leung GM, Tin KYK, Yeung RYT, Rannan-Eliya R, Leung ESK, Lam DWS, Lo SV: Domestic health expenditure in Hong Kong: 1989/90 to 2001/02.
Hong Kong Medical Journal 2006, 12:47-55. PubMed Abstract | Publisher Full Text
21. Wittenberg R, Pickard L, Comas-Herrera A, Davies B, Darton R: Demand for long-term care: finance for elderly people. Canterbury: Personal Social Services Research Unit, London School of Economics; 1998.
22. Kwan CW, Chi I, Lam TP, Lam KF, Chou KL: Validation of Minimum Data Set for Home Care assessment instrument (MDS-HC) for Hong Kong Chinese elders.
Clinical Gerontologist 2000, 21:35-48. Publisher Full Text
23. Tsui EL, Leung GM, Woo PP, Choi S, Lo SV: Under-reporting of inpatient services utilisation in household surveys - a population-based study in Hong Kong.
BMC Health Services Research 2005, 5:31. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
24. Census and Statistics Department, Government of the Hong Kong Special Administrative Region: Women and men in Hong Kong key statistics. Hong Kong: Government Logistics Department; 2007.
25. Census and Statistics Department, Government of the Hong Kong Special Administrative Region: Hong Kong monthly digest of statistics: marriage and divorce trends in Hong Kong, 1981 to 2006. Hong Kong: Government Logistics Department; 2007.
26. Bone MR, Bebbington AC, Jagger C, Morgan K, Nicholaas G: Health expectancy and its uses. London: HMSO; 1995.
27. Dunnell K: Population review: (2) Are we healthier?
Population Trends 1995, 82:12-18. PubMed Abstract
28. Wiener JM, Illston LH, Hanley RJ: Sharing the Burden: strategies for public and private long-term care insurance. Washington: The Brookings Institution; 1994.
29. Nuttall SR, Blackwood RJL, Bussell BMH, Cliff JP, Cornall MJ, Cowley A, Gatenby PL, Webber JM: Financing long-term care in Great Britain.
Journal of the Institute of Actuaries 1994, 121:1-68.
30. Richards E, Wilsdon T, Lyons S: Paying for long term care. London: Institute for Public Policy Research; 1996.
31. Chi I, Lam TP, Lam KF: Consultancy study on gate-keeping initiative for elderly service: final report. Hong Kong: Centre on Ageing, The University of Hong Kong; 2000.
32. Chou KL, Chi I, Leung ACT, Wu YM, Liu CP: Validation of Minimum Data Set for nursing home in Hong Kong Chinese elders.
Clinical Gerontologist 2001, 23:43-54. Publisher Full Text
33. Baumol WJ: Health care, education and the cost of disease: a looming crisis for public choice.
Public Choice 1993, 77:17-28. Publisher Full Text
34. Population Division, Department of Economic and Social Affairs, United Nations: World population ageing 1950-2050. UN, New York; 2001.
35. Food and Health Bureau, Government of the Hong Kong Special Administrative Region: Your health your life: healthcare reform consultation document. Hong Kong: Government Printers; 2007.
36. Leung GM, Tin KYK, Chan WS: Hong Kong's health spending projections through 2033.
Health Policy 2007, 81:93-101. PubMed Abstract | Publisher Full Text
37. Chou KL: Cross-border retirement migration plan in Hong Kong middle-aged adults.
Habitat International 2007, 31:366-374.
38. Hsiao W, Yip W, on behalf of the Harvard Team: Improving Hong Kong's health care system: why and for whom? Hong Kong: Government Printers; 1999.
39. Population Division, Department of Economic and Social Affairs, United Nations: World population prospects: the 2006 revision population database. UN, New York; 2007.
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1472-6963/9/172/prepub
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:27.000Z
|
66g3c7agj57jfubljwdtet3a37e3us56
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69434",
"uncompressed_offset": 411973206,
"url": "www.crummy.com/features/hall/craps/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.crummy.com/features/hall/craps/"
}
|
cccc_CC-MAIN-2013-20
|
Fast Jack's Floating Hall of Craps
The roulette table pays nobody except him that keeps it. Nevertheless a passion for gaming is common, though a passion for keeping roulette tables is unknown.
--George Bernard Shaw
Fast Jack here. Ever since I was a boy, I've loved the game of craps. Specifically, I've loved running games of craps. In high school I wrote a craps game for the TI-82 calculator that was blindingly fast. It was so fast, my classmates took to calling me Fast Jack.
(Actually, they called me Fast Jack because I was on the track team, but that makes a lousy story.)
Craps is a friendly game. As with all games of chance, if you play long enough you'll lose all your money, but it happens slowly enough that you stay on good terms with the fellow running the game (eg. myself). As I matured, I became fascinated with this aspect of the game. I became determined to discover exactly what the odds were of winning any particular game of craps.
That's why I wrote this Python simulation. It will play many, many games of craps (far more than I could hope to play with you face-to-face) and analyze the results. Enjoy!
Number of games (1-10000)
The Rules
The rules are simplicity itself (themselves?). You roll two dice. If the sum is a 2,3, or 12, you lose. If the sum is a 7 or an 11, you win. Otherwise, you make note of the sum and keep rolling the dice until you get a 7 (in which case you lose) or the number you initially rolled (in which case you win). Most games are over in one or two rounds, but a game can go on for arbitrarily many rounds.
The Source
I believe in running an honest game. That's why I support the open source movement. The CGI, The Simulation object, and the CrapsGame object are all avaliable for your perusal.
Leonard's Notes
I don't know how intuitive the table printed out by the CGI is; it's basically taken verbatim from a C++ program I wrote in 1996. That program was also the birthplace of the character of Fast Jack. If you think you can do a better stats table, be my guest.
One thing I'd like to add to this program is the ability to play around with the rules of craps (eg. you win or lose on different numbers); stay tuned.
I did write a craps program for the TI-82 when I was in high school. It wasn't particularily fast, though.
This document (source) is part of Crummy, the webspace of Leonard Richardson (contact information). It was last modified on Saturday, August 18 2007, 03:10:23 Nowhere Standard Time and last built on Saturday, May 18 2013, 09:01:56 Nowhere Standard Time.
Crummy is © 1996-2013 Leonard Richardson. Unless otherwise noted, all text licensed under a Creative Commons License.
Document tree:
http://www.crummy.com/
features/
hall/
craps/
Site Search:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:42:17.000Z
|
czljg4u22j7d5gpijheihtthhkfusb5m
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69440",
"uncompressed_offset": 444962618,
"url": "www.eea.europa.eu/data-and-maps/figures/average-age-of-road-vehicles",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/figures/average-age-of-road-vehicles"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55238 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Data and maps / Maps and graphs / Average age of road vehicles
Average age of road vehicles
Created : Dec 01, 2010 Last modified : Nov 29, 2012 11:40 AM
Topics: ,
The graph shows the average age of passenger cars, light-duty vehicles, heavy duty vehicles, two-wheelers and buses, in 1995 and 2009.
Download
European data
Metadata
Related content
Filed under: ,
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:24.000Z
|
74sc6y753aeb6ecy4l6tmxjm7tbbdo3e
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69441",
"uncompressed_offset": 444978274,
"url": "www.eea.europa.eu/data-and-maps/figures/share-of-renewable-electricity-in-gross-electricity-consumption-in-eu-27-in-2006-and-2010-indicative-targets",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/figures/share-of-renewable-electricity-in-gross-electricity-consumption-in-eu-27-in-2006-and-2010-indicative-targets"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55615 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Data and maps / Maps and graphs / Share of renewable electricity in gross electricity consumption in EU-27 in 2006 (and 2010 indicative targets)
Share of renewable electricity in gross electricity consumption in EU-27 in 2006 (and 2010 indicative targets)
Created : Nov 12, 2009 Published : Jan 28, 2009 Last modified : Nov 29, 2012 11:41 AM
Topics: ,
Large hydro: hydropower stations with a capacity higher than 10 MW
Download
Metadata
Additional information
National indicative targets for the share of renewable electricity in 2010 are taken from Directive 2001/77/EC. Notes to their 2010 indicative targets are made by Italy, Luxembourg, Austria, Portugal, Finland and Sweden in the Directive; Austria and Sweden note that reaching the target is dependent on climatic factors affecting hydropower production. Sweden considers 52 % a more realistic figure if long-term models on hydrologic and climatic conditions are applied. Countries are ranked in order of the magnitude of the difference between their current share of renewable electricity and their 2010 target (as a percentage difference), from smallest to largest.
Related content
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:59.000Z
|
35tgnjbxx7lkkp3hknrub35ouy2nggvx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69442",
"uncompressed_offset": 445012981,
"url": "www.eea.europa.eu/publications/NOS02/mail_password_form",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.eea.europa.eu/publications/NOS02/mail_password_form?userid="
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55613 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Publications / EU Noise Policy WG4 on Noise Mapping
Lost Password
For security reasons, we store your password encrypted, and cannot mail it to you. If you would like to reset your password, fill out the form below and we will send you an email at the address you gave when you registered to start the process of resetting your password.
To reset your password visit Reset Eionet account password page.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:09.000Z
|
wdhk2dorvfmaaderjnpsw25metls7zqp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69445",
"uncompressed_offset": 458731684,
"url": "www.familysearch.org/learn/wiki/en/Prussia-Hohenzollern_Church_Directories",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Prussia-Hohenzollern_Church_Directories"
}
|
cccc_CC-MAIN-2013-20
|
Prussia-Hohenzollern Church DirectoriesEdit This Page
From FamilySearch Wiki
Back to Prussia - Hohenzollern Page
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 4 September 2012, at 01:38.
• This page has been accessed 104 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:09:41.000Z
|
qg3mjp2sjbo2ecl5yppnavja6z7d43bg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69455",
"uncompressed_offset": 498225684,
"url": "www.grandtheftwiki.com/Easton_LTA",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.grandtheftwiki.com/Easton_LTA"
}
|
cccc_CC-MAIN-2013-20
|
Easton LTA
From Grand Theft Wiki
Jump to: navigation, search
Easton
Liberty City Subway station
Station information
Lines Algonquin Inner Line
Algonquin Outer Line
Services Algonquin Inner Line, Algonquin Outer Line
Platforms 4
Tracks 4
Other
Borough Algonquin
Next north East Park: Algonquin Inner Line
Hove Beach (Broker Line): A/J
Next south City Hall: Algonquin Inner Line
Emerald: Algonquin Outer Line
Easton is an underground subway station in Grand Theft Auto IV, in the Liberty City Subway system, serving the K/C trains of the Algonquin Inner Line and the A/J trains of the Algonquin Outer Line.
Description
Easton is the main transfer station of the LTA system, with two lines of the subway converging there: the Algonquin Inner Line and the Algonquin Outer Line (which connect to the E/B Bohan Line and 3/8 Broker Line, respectively). The station is the final stop on the A/J Algonquin Outer Line; in Broker, the line becomes known as the 3/8 Broker Line.
Easton station is a three-entrance station extending from The Triangle to Easton in central Algonquin, Liberty City. Two of its entrances are located to the east on both sides of Columbus Avenue between Iron and Hematite Streets, along the border between The Triangle and Easton, while the westernmost entrance is located at Burlesque in The Triangle.
The station is notable for its unique design as a subway station. In addition to its conventional entrances towards the east, the entrance at Burlesque is embedded into the Daily Globe building and bears a unique and modern facade, a cross of entrances of the Times Square – 42nd Street station at 42nd Street and 7th Avenue [1][2][3]. The station also features a long underground concourse connected to all three exits and two stations, as well as wide hallways to and from the entrances and concourse.
Nearby attractions include Star Junction (to the west), the Triangle Building and Grand Easton Terminal (to the east).
Gallery
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:50:43.000Z
|
azjhgxf3orns4vt2335jgu4aovtizk6e
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69458",
"uncompressed_offset": 509006432,
"url": "www.hindawi.com/journals/edu/2012/126313/ref/",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.hindawi.com/journals/edu/2012/126313/ref/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Education Research International
Volume 2012 (2012), Article ID 126313, 10 pages
doi:10.1155/2012/126313
Research Article
Technology in the Aid of Delivering Economic Content to Teachers: Virtual Economics v. 3
Center for Economic Education, Georgia College State & University, Campus Box 14, Milledgeville, GA 31061, USA
Received 20 March 2012; Revised 6 June 2012; Accepted 6 June 2012
Academic Editor: Jan Elen
Copyright © 2012 John R. Swinton and Benjamin Scafidi. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Linked References
1. J. A. Mackey, A. D. Glenn, and D. R. Lewis, “Improving teacher training for precollege economic education,” Journal of Economic Education, vol. 8, no. 2, pp. 118–123, 1977.
2. W. B. Walstad, “Economic education in U.S. High schools,” Journal of Economic Perspectives, vol. 15, no. 3, pp. 195–210, 2001. View at Scopus
3. R. J. Highsmith, “A study to measure the impact of in-service institutes on the students of teachers who have participated,” Journal of Economic Education, vol. 5, no. 2, pp. 77–81, 1974.
4. D. L. Thorton and G. M. Vredeveld, “In-service education and its effects on secondary students: a new approach,” Journal of Economic Education, vol. 8, no. 2, pp. 93–99, 1977.
5. H. M. Schober, “The effects of inservice training on participating teachers and students in their economics classes,” Journal of Economic Education, vol. 15, no. 4, pp. 282–295, 1984.
6. T. F. Cargill, J. Jurosky, and J. Wendel, “Implementing economics standards: a pilot transition program,” Journal of Economic Education, vol. 39, no. 2, pp. 126–134, 2008. View at Publisher · View at Google Scholar · View at Scopus
7. W. B. Walstad, “Effectiveness of a USMES in-service economic education program of elementary school teachers,” Journal of Economic Education, vol. 11, no. 1, pp. 1–12, 1979.
8. W. Bosshardt and M. Watts, “Instructor effects in economics in elementary and junior high schools,” Journal of Economic Education, vol. 25, no. 3, pp. 195–211, 1994.
9. W. Bosshardt and M. Watts, “Instructor effects and their determinants in precollege economic education,” Journal of Economic Education, vol. 21, no. 3, pp. 265–276, 2001. View at Scopus
10. M. Watts and W. Bosshardt, “How instructors make a difference: panel data estimates from principles of economics courses,” Review of Economics and Statistics, vol. 73, no. 2, pp. 336–340, 1991.
11. P. W. Grimes, “Economic education for at-risk students: an evaluation of choices & changes,” The American Economist, vol. 39, no. 1, pp. 71–83, 1995.
12. C. L. Harter and J. H. Harter, “Assessing the effectiveness of financial fitness for life in eastern Kentucky,” Journal of Applied Economics and Policy, vol. 28, no. 1, pp. 20–33, 2009.
13. J. R. Swinton, T. DeBerry, B. Scafidi, and H. C. Woodard, “The impact of financial education workshops for teachers on Students’ economic achievement,” Education Economics, vol. 24, pp. 63–77, 2007. View at Scopus
14. J. R. Swinton, T. DeBerry, B. Scafidi, and H. C. Woodard, “Does in-service professional learning for high school economics teachers improve student achievement?” Education Economics, vol. 18, no. 4, pp. 395–405, 2010. View at Publisher · View at Google Scholar · View at Scopus
15. J. R. Swinton, B. Scafidi, and H. Woodard, The Impact of the Teaching High School Economics Workshop for Teachers on Student Achievement. Georgia College & State University Economics of Education Policy Center Working Paper, 2011.
16. W. B. Walstad and S. Buckles, “The national assessment of educational progress in economics: findings for general economics,” American Economic Review, vol. 98, no. 2, pp. 541–546, 2008. View at Publisher · View at Google Scholar · View at Scopus
17. J. D. Angrist and V. Lavy, “Does teacher training affect pupil learning? Evidence from matched comparisons in Jerusalem public schools,” Journal of Labor Economics, vol. 19, no. 2, pp. 343–369, 2001. View at Publisher · View at Google Scholar · View at Scopus
18. B. A. Jacob and L. Lefgren, “The impact of teacher training on student achievement: quasi-experimental evidence from school reform efforts in Chicago,” Journal of Human Resources, vol. 39, no. 1, pp. 50–79, 2004. View at Scopus
19. P. Bressoux, “The effects of Teachers' training on Pupils' achievement: the case of elementary schools in France,” School Effectiveness and School Improvement, vol. 7, no. 3, pp. 252–279, 1996. View at Scopus
20. M. M. Kennedy, Form and Substance in In-Service Teacher Education. Research Report from the National Institute for Science Education, University of Wisconsin, Madison, Wis, USA, 1998.
21. R. K. Blank, N. de las Alas, and C. Smith, Does Teacher Professional Development Have Effects on Teaching and Learning?: Analysis of Evaluation Findings from Programs for Mathematics and Science Teachers in 14 States, The Council for Chief State School Officers (CCSSO)Report, Washington, DC, USA, 2008.
22. K. Sosin, B. J. Blecha, R. Agarwal, R. L. Bartlett, and J. I. Daniel, “Efficiency in the use of technology in economic education: some preliminary results,” American Economic Review, vol. 94, no. 2, pp. 253–258, 2004. View at Publisher · View at Google Scholar · View at Scopus
23. M. Bertrand, E. Duflo, and S. Mullainathan, “How much should we trust differences-in-differences estimates?” Quarterly Journal of Economics, vol. 119, no. 1, pp. 249–275, 2004. View at Publisher · View at Google Scholar · View at Scopus
24. J. D. Angrist and J. Pischke, Mostly Harmless Econometrics, Princeton University Press, Princeton, NJ, USA, 2009.
25. A. B. Krueger, Understanding the Magnitude and Effect of Class Size on Student 19. Achievement in The Class Size Debate, Edited by L. Mishel and R. Rothstein, Economics Policy Institute, Washington, DC, USA, 2002.
26. Council for Economic Education (CEE), Virtual Economics v.3: An Interactive Center for Economic Education—Features, http://ve.councilforeconed.org/features/.
27. Georgia Department of Education (GaDOEd), Standards, Instruction and Assessment Testing: End of Course Tests (EOCT), http://public.doe.k12.ga.us/ci_testing.aspx?PageReq=CI_TESTING_EOCT.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:02:36.000Z
|
xucl6ronywsutesu3nssz2n46lxt75mh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69462",
"uncompressed_offset": 526892227,
"url": "www.indiaenvironmentportal.org.in/category/thesaurus/industrial-disasters?page=4",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.indiaenvironmentportal.org.in/category/thesaurus/industrial-disasters?page=4"
}
|
cccc_CC-MAIN-2013-20
|
As the Andhra Pradesh government ordered an inquiry into Wednesday night’s explosion at the plant of the Rashtriya Ispat Nigam Limited (RINL) which left at least 12 people dead, it emerged that sen
Bhopal: The Centre had barred the Indian Council for Medical Research (ICMR) from publishing the Bhopal gas tragedy-related research work for nine years, information under the RTI Act has revealed.
The Supreme Court on Thursday directed the Central Pollution Control Board to file a comprehensive affidavit on the “character and content” of reported contamination of ground water in Bhopal's Arifnagar area due to the 1985 Union Carbide gas tragedy.
A Bench of Justice Altamas Kabir and Justice J. Chelameshwar also asked the Board's counsel Vijay Panjwani to recommend measures to overcome the contamination and action to be taken in this regard.
A dispute over the authority of U.S. accident investigators heads to federal court here Wednesday, in a case pitting the U.S.
Supreme Court order on the disposal of toxic waste lying in the factory of Union Carbide India Ltd dated 04/04/2012.
Hydrofluoric acid (HF) leaked from an alkylation unit at BP Plc's 406,570-barrels-per-day refinery in Texas City, Texas on Tuesday morning, triggering alarms in the plant and warnings to area resid
The death toll from an explosion at a chemical plant in northern China last week has risen to 25, with four missing and 46 others injured, state media reported.
The Indian Olympic Association’s repeated pleas to have Dow hemicals removed as a sponsor of the London Olympics may have fallen on deaf ears but now the Indian government has intervened with a new
Five organisations of the survivors of the 1984 Union Carbide disaster in Bhopal on Sunday burnt an effigy of Jacques Rogge, president of the International Olympics Committee to protest the apex bo
The American company, Dow Chemicals, should not be sponsoring the Olympics, said the Union Minister for Environment and Forests, Ms Jayanthi Natarajan.
Pages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:52.000Z
|
556dbfjp56xidabutvaqonydome7vy3k
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69463",
"uncompressed_offset": 533636394,
"url": "www.isfdb.org/cgi-bin/diffselect.cgi",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.isfdb.org/cgi-bin/diffselect.cgi?1030252"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: The Earth-Tube
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Review of: The Earth-Tube
Book Author: Gawain Edwards
Reviewer: Everett F. Bleiler
Year: 1991
Type: REVIEW
Select 2 publications to diff:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:51:49.000Z
|
6aytmy4gcnjl65wtpoyqhrj4qgqz554e
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69491",
"uncompressed_offset": 639163210,
"url": "www.openwetware.org/wiki/840:153g:Projects/project20",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.openwetware.org/wiki/840:153g:Projects/project20"
}
|
cccc_CC-MAIN-2013-20
|
840:153g:Projects/project20
From OpenWetWare
Jump to: navigation, search
Search this Project
Customize your entry pages
Team Members
• Xiaoyang Feng
• Maliha Saggaf
• Srikanth Sistla
Cloning and expression of neutral protease gene from B. Stearothermophilus (TIC)
• The gene (nprT) responsible for producing the thermostable enzyme 'neutral protease' will be extracted from a thermophilic bacteria called Bacillus Stearothermophilus. This enzyme functions to hydrolyze specific proteins including fibronectin, collagen IV and also collagen I. The gene nprT was then sequenced using NCBI Genbank with the accession number M11446.1. It contains 1881 bp with no introns. This is because ideally, bacterias do not contain introns. We are currently working on designing 2 sets of primers, one containing Biobrick compatible ends and the other one shall not contain Biobrick compatible ends. The next step is to amplify the targeted gene using PCR. Then, we shall cleave the plasmid and the nprT, followed by ligation of the two.When this process is successfully done, the plasmid shall then be transformed into competent E.coli. At this point, we culture the E.coli at high temperature ( the specific temperature is to be determined ), and determine if neutral protease shall be produced. The necessary tests to detect the production of neutral protease shall then be done.Only then, we would know if the transformation was successful or not.
primers
• 20_thermo_F: 5’ ATG AAC AAA CGG GCG ATG C
• 20_thermo_R: 5’ TTA ATA CAC TCC AAC CGC ATT G
• 20_thermowithbio_F: 5’ GAATTCGCGGCCGCTTCTAG ATG AAC AAA CGG GCG ATG C
• 20_thermowithbio_R: 5’ TACTAGTAGCGGCCGCTGCAG TTA ATA CAC TCC AAC CGC ATT G
promoters
• 1.Part:BBa_K091112 (first choice)
http://partsregistry.org/wiki/index.php?title=Part:BBa_K091112
• 2.Part:BBa_K206001
http://partsregistry.org/wiki/index.php?title=Part:BBa_K206001
• 3.Part:BBa_I0500
http://partsregistry.org/wiki/index.php?title=Part:BBa_I0500
Primary source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC219205/pdf/jbacter00220-0018.pdf
Secondary Source
*1. http://www.springerlink.com/content/2176020225j772uh/
*2. http://mic.sgmjournals.org/content/134/7/1883.long
First presentation
http://openwetware.org/wiki/Image:Project_Proposal.pptx
Final presentation
http://openwetware.org/wiki/Image:TIC_group_20.pptx
Important Results and Milestones
• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:02:08.000Z
|
rhjb3a2eww2p5nxqfdunamrdlke4uojw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69492",
"uncompressed_offset": 639176470,
"url": "www.openwetware.org/wiki/User:ClarkeS",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.openwetware.org/wiki/User:ClarkeS"
}
|
cccc_CC-MAIN-2013-20
|
User:ClarkeS
From OpenWetWare
Jump to: navigation, search
Contents
Bio
Sean Clarke
saclarke at mit
48-208
directory info
I am a Biological Engineering (BE, MIT Course XX) graduate student in the Alm lab (48-324). Our focus is on microbial ecology and the evolution of microbial genomes. My work is on engineering genetic diversity and stress tolerance in Vibrio splendidus. I hope to determine what alleles and loci contribute to environmental stress tolerance using experimental evolution and resequencing.
Past life and credentials
My background is in mechanical engineering and design, but not of things quite as small as BioBricks.
Other research interests
• Food microbiology
• Microbiomes of the built environment
• How bacteria move and live in cities
• Engineering microbial stress tolerance
• Relating stress tolerance to genetic loci
• Resequencing evolved microbes
• Scaling of engineered biology to industrial purposes
• Design and use of replicating biological machines
• Technologies/vocabularies to make biological engineering easier
• Ethics and philosophy of science instruction for scientists/engineers
• Biomimicry, bioscaffolds for material processing
• Recycling/"cradle to cradle" design of biological systems
• Usability of biological design software and equipment
• Biomineralization
Classes
• BE.400
• BE.410
• BE.420
• BE.430
• 5.95 Teaching College-Level Science and Engineering
• 7.81 Systems Biology Excellent class, Alex van Oudenaarden
• 18.085 Applied Math for Engineers with the indefatigable Gil Strang, who might have taught your parents and is still revising his book daily.
• 7.56 Graduate Cell Biology, with an emphasis on yeast, Profs. Stephen Bell and Frank Solomon
• 1.89 Environmental Microbiology with Martin Polz
• OEB.192 Microbial Evolution with Chris Marx, a great subject that is not taught enough
• directed evolution seminar
Past Projects
• My first project at MIT was during the summer of 2005 when I tried the Orthogonal cloning of clpXP from E. coli into yeast. I was more successful at learning molecular biology techniques by making mistakes than at cloning into yeast. This work is continuing in someone else's more capable hands.
Notes
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:26.000Z
|
vkhyxltopcemx37kmtk4cqxrgnuovwt5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69498",
"uncompressed_offset": 705093199,
"url": "www.seroundtable.com/google-images-framebuster-14429.html",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.seroundtable.com/google-images-framebuster-14429.html"
}
|
cccc_CC-MAIN-2013-20
|
Google Images Busts The Frame Busters
Dec 8, 2011 • 8:51 am | (11) by | Filed Under Google Search Engine
A WebmasterWorld thread has discussion from webmasters who started to notice that their framebuster scripts no longer bust the Google Image search frames on Google Images.
When you do a search on Google Image search and click on a result, Google shows you the image in a larger view with more details. You can then click through to the image to see more. But many webmasters do not like that Google shows the image in a frame on their site, they want the traffic. So they deploy code to bust the frame and take you to their site.
Google has disabled many framebuster scripts so that the searcher stays on Google's search results preview page.
Levo in the forums said, "Well, apparently Google Image started iframing using "sandbox" - an HTML5 attribute, which disables scripts on the page." So it works on some browsers, not all.
You can learn more about the sandbox attribute and how it works.
Have you seen this?
Forum discussion at WebmasterWorld.
Previous story: Google Search Cursor Goes Missing
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:14:37.000Z
|
6f2ldisq6jd3zj2kamsd3xjxjgiayetn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69513",
"uncompressed_offset": 806428668,
"url": "www.werelate.org/wiki/Place:Ancram%2C_Columbia%2C_New_York%2C_United_States",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.werelate.org/wiki/Place:Ancram%2C_Columbia%2C_New_York%2C_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:Ancram, Columbia, New York, United States
NameAncram
TypeTown
Coordinates42.05°N 73.633°W
Located inColumbia, New York, United States
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Ancram, New York is a town in Columbia County, New York, United States. The population was 1,573 at the 2010 census. The town was named after a location in Scotland.
The Town of Ancram is in the eastern part of the county.
History
the text in this section is copied from an article in Wikipedia
Originally part of the Land Grant to the Livingston family, this area on the Roeliff-Jansen Kill was originally called "Livingston Forge" after the iron foundry on the river. Throughout the eighteenth century. the Livingston forge created metal products for the community, and the town was sometimes known as "Scotchtown" due to the immigrants of Scottish ancestry to flocked there. As the Revolution drew near, the factory produced shot, cannonballs, and perhaps most importantly, the chain which stretched across the Hudson River at West Point.
After the Revolution, the town was established from part of the Town of Livingston in 1803, but was then called the "Town of Gallatin." In 1814, the name was changed to "Ancram," after the town in Scotland where the Livingstons had their origins. Part of Ancram was taken to form a new Town of Gallatin in 1830.
Mining of iron and lead was important in the early economy, and the town of Ancramdale was originally known as "Ancram Lead Mines"
The hamlet of Boston Corners was formerly part of the town of Mount Washington, Massachusetts, and was annexed to Ancram on April 13, 1857.
Research Tips
External Links
• Outstanding guide to Ancram family history and genealogy resources (FamilySearch Research Wiki). Birth, marriage, and death records, town histories, cemeteries, churches, newspapers, libraries, and genealogical societies.
This page uses content from the English Wikipedia. The original content was at Ancram, New York. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:04.000Z
|
bkgje35qihu452o3lectxdw67vdrbbgf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69514",
"uncompressed_offset": 806435874,
"url": "www.werelate.org/wiki/Place:Bilac,_S%c3%a3o_Paulo,_Brazil",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.werelate.org/wiki/Place:Bilac,_S%c3%a3o_Paulo,_Brazil"
}
|
cccc_CC-MAIN-2013-20
|
Place:Bilac, São Paulo, Brazil
Watchers
NameBilac
Alt namesVila de Nipolandiasource: Family History Library Catalog
TypeCity
Coordinates21.4°S 50.467°W
Located inSão Paulo, Brazil
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Bilac is a municipality in the state of São Paulo in Brazil. The population in 2003 is 6,410 and the area is 157.73 km². The elevation is 431 m.
Bilac, old town and district of the city arose from Penápolis piece of land belonging to Brazil Plantation Trade Union and today is a small city in São Paulo State, which is located in the northwest of the state.
In 1917 the blend of land attracted many families who settled in the town, which received the designation of Stream of the Colony (Córrego da Colônia), by engineers of the time.
The company promoted Brazil Plantation Trade Union, in 1927, blending of their land, attracting several settlers, among them, Fernando Rodrigues, Francisco Lopes Rodrigues, Jose Goncalves and Hicoiti Yoshiy that with their families, have settled in the region, calling it "stream of the colony (Córrego da Colônia)"
Later, the Vila Conceição Company, consisting of Osvaldo Martins, Sakae Sato, Shoe Anzai and Toshio Yoshiy, bought land and then proceeded to blend the earth, then when the first house was built of timber belonging to Mr John Nery, followed by several other buildings and attracting more people moving the economy and bringing the progress for the region.
On February 10, 1923 the City Council voted to lift Birigui of the village to the condition of town, giving it the name of "Vila Nossa Senhora da Conceição", in honor of local patron. The progress of the town once was felt, with the facility in 1928, the public cemetery and in 1930, the district police.
After 10 years, on 18 August 1933 is high for the District of Peace with “Nipolândia” name, in homage to the great Japanese colony in the region. However, the current name (Bilac) came under Decree No. 9775 of November 30, 1928 in order to honor the great poet brother, Olavo Brás Martins dos Guimarães Bilac. Six years later, on November 30, 1944, by Decree-Law No. 14,334, the District of Bilac was elevated to the category of city, installed on January 1, 1945, with the Districts of Peace of Bilac Piacatu and then built the Gabriel de Monteiro on 24 December 1948. Bilac of Piacatu was dismembered in 1953, becoming council.
April 18, 1925 - when it was done deed of donation for the heritage. It celebrates the anniversary of the city on April 18.
Research Tips
This page uses content from the English Wikipedia. The original content was at Bilac. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:31.000Z
|
zd5vdg53p2vhqckpbfstkj4xtrjalqcm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69515",
"uncompressed_offset": 806460156,
"url": "www.werelate.org/wiki/Place:Silvertown,_Greater_London,_England",
"warc_date": "2013-11-22T14:34:07.000Z",
"warc_filename": "<urn:uuid:b52e96e8-9278-4b2b-9f03-e4c7cb327461>",
"warc_url": "http://www.werelate.org/wiki/Place:Silvertown,_Greater_London,_England"
}
|
cccc_CC-MAIN-2013-20
|
Place:Silvertown, Greater London, England
Watchers
NameSilvertown
TypeDistrict
Located inGreater London, England
the text in this section is copied from an article in Wikipedia
Silvertown is an industrialised district on the north bank of the Thames in the London Borough of Newham. It was named after Samuel Winkworth Silver's former rubber factory which opened in 1852, and is now dominated by the Tate & Lyle sugar refinery and the John Knight ABP animal rendering plant.
Research Tips
This page uses content from the English Wikipedia. The original content was at Silvertown. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:20:24.000Z
|
f6sp6iebpuqhfcvjsqyevjqdmfewpz33
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69520",
"uncompressed_offset": 2480494,
"url": "abs.gov.au/ausstats/abs%40.nsf/second%2Blevel%2Bview?issue=Mar+2007&prodno=9314.0.55.001&prodno=9314.0.55.001&tabname=Related+Products&viewtitle=Sales+of+New+Motor+Vehicles%2C+Electronic+Delivery~Mar+2007~Previous~20%2F04%2F2007",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://abs.gov.au/ausstats/abs@.nsf/second+level+view?ReadForm&prodno=9314.0.55.001&viewtitle=Sales%20of%20New%20Motor%20Vehicles,%20Electronic%20Delivery~Mar%202007~Previous~20/04/2007&tabname=Related%20Products&prodno=9314.0.55.001&issue=Mar%202007&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
9314.0.55.001 - Sales of New Motor Vehicles, Electronic Delivery, Mar 2007
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 20/04/2007
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:11:22.000Z
|
jg5q7stg3rqqtpnnfw4wt532eeg5avaz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69527",
"uncompressed_offset": 12484592,
"url": "archive.mises.org/10124/haines-vs-frank/",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://archive.mises.org/10124/haines-vs-frank/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/10124/haines-vs-frank/
Haines vs. Frank
June 11, 2009 by
Representative Barney Frank couldn’t handle questioning by CNBC’s Mark Haines regarding the government’s interference with executive compensation. Rather than attempt to have an intelligent discussion on the subject, he elected to storm off mid-interview.
Visit msnbc.com for Breaking News, World News, and News about the Economy
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:23.000Z
|
lkx6kfoeiw3lvgz4r5ybcjyqzsecixgv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69528",
"uncompressed_offset": 13723297,
"url": "arthritis-research.com/content/12/3/R84/",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://arthritis-research.com/content/12/3/R84/"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Provision of preventive health care in systemic lupus erythematosus: data from a large observational cohort study
Jinoos Yazdany1*, Chris Tonner1, Laura Trupin1, Pantelis Panopalis2, Joann Z Gillis3, Aimee O Hersh4, Laura J Julian1, Patricia P Katz1, Lindsey A Criswell5 and Edward H Yelin1
Author Affiliations
1 Division of Rheumatology, University of California, San Francisco, UCSF Box 0920, San Francisco, CA 94143-0920, USA
2 Division of Rheumatology, McGill University Health Center 1, 650 Cedar Avenue, Room A6-123, Montreal, QC H3G 1A4, Canada
3 Division of Rheumatology, National Jewish Hospital, 1400 Jackson?Street, Denver, CO 80206, USA
4 Division of Pediatric Rheumatology, University of California, San Francisco, 533 Parnassus Avenue, San Francisco, CA 94143 - 0107, USA
5 Division of Rheumatology, University of California, San Francisco, 374 Parnassus Avenue, San Francisco, CA 94143 - 0500, USA
For all author emails, please log on.
Arthritis Research & Therapy 2010, 12:R84 doi:10.1186/ar3011
See related editorial by Burgos and Alarcón, http://arthritis-research.com/content/12/3/124
The electronic version of this article is the complete one and can be found online at: http://arthritis-research.com/content/12/3/R84
Received:12 October 2009
Revisions received:16 April 2010
Accepted:12 May 2010
Published:12 May 2010
© 2010 Yazdany et al.; licensee BioMed Central Ltd.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Introduction
Cancer and infections are leading causes of mortality in systemic lupus erythematosus (SLE) after diseases of the circulatory system, and therefore preventing these complications is important. In this study, we examined two categories of preventive services in SLE: cancer surveillance (cervical, breast, and colon) and immunizations (influenza and pneumococcal). We compared the receipt of these services in SLE to the general population, and identified subgroups of patients who were less likely to receive these services.
Methods
We compared preventive services reported by insured women with SLE enrolled in the University of California, San Francisco Lupus Outcomes Study (n = 685) to two representative samples derived from a statewide health interview survey, a general population sample (n = 18,013) and a sample with non-rheumatic chronic conditions (n = 4,515). In addition, using data from the cohort in both men and women (n = 742), we applied multivariate regression analyses to determine whether characteristics of individuals (for example, sociodemographic and disease factors), health systems (for example, number of visits, involvement of generalists or rheumatologists in care, type of health insurance) or neighborhoods (neighborhood poverty) influenced the receipt of services.
Results
The receipt of preventive care in SLE was similar to both comparison samples. For cancer surveillance, 70% of eligible respondents reported receipt of cervical cancer screening and mammography, and 62% reported colon cancer screening. For immunizations, 59% of eligible respondents reported influenza immunization, and 60% reported pneumococcal immunization. In multivariate regression analyses, several factors were associated with a lower likelihood of receiving preventive services, including younger age and lower educational attainment. We did not observe any effects by neighborhood poverty. A higher number of physician visits and involvement of generalist providers in care was associated with a higher likelihood of receiving most services.
Conclusions
Although receipt of cancer screening procedures and immunizations in our cohort was comparable to the general population, we observed significant variability by sociodemographic factors such as age and educational attainment. Further research is needed to identify the physician, patient or health system factors contributing to this observed variation in order to develop effective quality improvement interventions.
Introduction
Over the last several decades, the prognosis of patients with systemic lupus erythematosus (SLE) has improved dramatically, with five-year survival now above 95% in developed countries [1]. This increased survival has necessitated adjustment of clinical care for this population, with the complications and co-morbidities of the disease gaining greater attention. Infection and malignancy are the two leading causes of mortality in SLE after diseases of the circulatory system [1]. We sought to examine receipt of several preventive services that may influence these outcomes in a large, community-based cohort of individuals with SLE.
Previous literature suggests that individuals with chronic diseases may receive fewer preventive services than the general population [2-5]. In the rheumatic diseases, studies examining cancer screening in rheumatoid arthritis and SLE have yielded similar results [2,5]. The reasons for these findings remain unclear, but hypotheses include that management of the primary disease may dominate provider and patient time, responsibility for preventive services may span several physicians and specialties, and resources may be limited - both in terms of patient time and because chronically ill patients are often underinsured [6]. In SLE, factors specific to the condition, such as the unpredictable nature of disease exacerbations and concerns about vaccine safety in immunocompromised hosts, may also potentially hinder attention to preventive services.
In this study, we sought to examine two categories of preventive services: cancer surveillance (cervical, breast, and colon) and immunizations (influenza and pneumococcal). We compared the receipt of preventive services in SLE to the general population, and identified specific subgroups of patients with SLE who are less likely to receive these services. In addressing this latter aim, we attempted to examine not only characteristics of individuals (for example, sociodemographic and disease related factors), but also characteristics of health systems (for example, number of outpatient visits, involvement of generalist providers or rheumatologists in patient care, type of health insurance) and characteristics of neighborhoods (that is, neighborhood poverty level).
Materials and methods
Data sources
LOS
Data were derived from the University of California, San Francisco (UCSF) Lupus Outcomes Study (LOS), a longitudinal observational study of 1,179 English-speaking individuals with SLE. Details on study methodology have been reported previously [7]. Briefly, study respondents participate in an annual telephone survey, providing information about their demographic characteristics, socioeconomic status, medications, disability, general health and social functioning, health care utilization, health insurance coverage, and disease activity [7]. Recruitment for the study took place in several settings in an attempt to capture the full spectrum of SLE, including academic rheumatology offices (23%), community rheumatology offices (11%), and community-based sources such as SLE support groups, the Internet, and media advertisements (66%). All patients have carried a diagnosis of SLE from a physician, and we further confirmed these diagnoses by a formal review of the medical record to document American College of Rheumatology Criteria for SLE [8].
Items regarding receipt of preventive health services were introduced in the fourth annual LOS interview, conducted between March 2005 and February 2006; 797 individuals participated in that interview. Of the 797, 14 (2%) were excluded from the sample. Four individuals were excluded because they resided outside the United States at the time of the interview. Ten individuals were excluded because they reported having no health insurance; this group was too small to make robust conclusions regarding lack of insurance. Of the remaining 783 individuals, 5% were dropped from the sample because of the following missing data: below poverty status (n = 10; 1%); HMO (n = 18, 2% did not know if they were in a HMO or not); area poverty level (n = 13; 2% lived in areas with no geocoded data either because they resided in new residential areas that were developed after the 2000 Census was conducted, or because they had moved since the geographic match was performed). For the analysis comparing LOS service receipt to population controls (described below), we included 685 of these respondents; men were excluded (n = 57) to facilitate comparisons with the controls. For the second part of the study examining predictors of receipt of preventive services, men were included, yielding a total sample of 742 individuals.
CHIS
For the population comparison, we analyzed primary data from the California Health Interview Survey (CHIS), a random-digit-dial telephone survey administered to households in California [9]. The CHIS sample is representative of California's non-institutionalized population. We chose CHIS because the survey included all the variables of interest, and because a majority of LOS respondents reside in California. Response rates of CHIS are comparable to other statewide telephone surveys (approximately 49.8% among adults interviewed in 2005). We report receipt of preventive services in the LOS compared to two subsamples of CHIS. The first included the overall CHIS sample as a general population comparison, and the second included only CHIS respondents reporting chronic medical conditions (asthma, diabetes mellitus, or heart disease). Among the 4,515 individuals with chronic diseases, 1,595 (35%) had asthma, 3,399 (75%) had diabetes, and 3,255 (72%) had heart disease.
For most preventive services, we analyzed CHIS interviews from the same calendar year as these services were queried from LOS respondents (2005). However, for pneumococcal immunization, we used CHIS data from 2003, the most recent year in which data on this service were available. To more closely approximate the LOS population, we included only data from CHIS respondents ≥ 18 years, who spoke English, were female and reported having health insurance. This resulted in a sample size of 18,013 for the CHIS general population comparison, and 4,515 for the CHIS chronic medical condition comparison.
Measures
We examined receipt of five preventive care services, including cancer screenings (mammography, colon cancer screening, and cervical cancer screening), and immunizations (influenza and pneumococcal). For cancer screening, we evaluated receipt of care advocated by the United States Preventive Services Task Force recommendations [10]. We examined screening mammography over the previous year in women ≥ 40 years with no history of breast cancer. Cervical cancer screening was examined in the previous year among women 18 to 65 years who did not report a hysterectomy and had no history of cervical cancer. Colon cancer screening (defined as a colonoscopy in the last 10 years or a flexible sigmoidoscopy plus fecal occult blood in the last five years) was examined in those ≥ 50 years with no history of colorectal cancer.
We used the Centers for Disease Control (CDC) recommendations and the recently developed quality indicators for SLE to determine eligibility for immunizations [11-13]. We examined influenza immunization in the previous year among individuals receiving immunosuppressive therapy or age ≥ 50 years. For pneumococcal immunization, we determined whether individuals receiving immunosuppressive therapy or those ≥ 65 years had ever received the vaccine.
We applied the same inclusion and exclusion criteria to the CHIS data. For immunizations, eligibility for the CHIS general population was defined by age (≥ 50 years for influenza, and ≥ 65 years for pneumococcal). For the CHIS population reporting chronic medical conditions, all respondents were considered eligible for influenza immunization, and those ≥ 50 years were considered eligible for pneumococcal vaccine (the CHIS survey only queries receipt of pneumococcal vaccine in those ≥ 50 years).
We considered factors previously associated with receipt of preventive services as potential covariates when examining predictors of receipt of preventive services in the LOS. These included sociodemographic factors such as age, sex, race/ethnicity (Caucasian versus other), education (high school education or less, some college, or college graduate), and poverty (household income less than 125% of the Federal poverty threshold). To examine the influence of disease status, we used the Systemic Lupus Activity Questionnaire (SLAQ), a self-report instrument [14,15], and the Short Form-36 Physical Functioning Scale (SF-36) [16].
Because we were interested in whether health care access variables influence the receipt of preventive care, we also considered: 1) the total number of physician visits over the last year; 2) whether a generalist provider was involved in care (including all physicians or nurse practitioners functioning as primary care providers); 3) whether a rheumatologist was involved in care; 4) the type of health insurance used (public health insurance, including Medicare or Medicaid, or private health insurance, including employer-based plans). The health insurance variables were further stratified by enrollment in a health maintenance organization (HMO), given that some HMOs, particularly prepaid group practices, place special emphasis on preventive care [17,18].
Previous research suggests that community characteristics may hinder access to preventive care in some populations [19]. We therefore evaluated whether a contextual variable, neighborhood poverty, influenced receipt of preventive care services. To obtain information about study participants' neighborhood poverty, data from the 2000 U.S. Census were matched to participants' residential addresses through a process known as geocoding, described in detail elsewhere [20]. Geocoding procedures were conducted using the Environmental Systems Research Institute ArcGIS software by Sonoma Technology (Petaluma, CA, USA).
All respondents provided informed consent to participate in the study. The UCSF Committee on Human Research approved the study protocol.
Statistical analysis
We compared unadjusted frequencies of receiving preventive services in the LOS to the two CHIS samples. We used SUDAAN 10.0 (Research Triangle Park, NC, USA) in order to account for the CHIS sampling design. Because the samples differed significantly in terms of age and education, we calculated age and education standardized estimates from CHIS to reduce confounding.
We used multivariate logistic regression models to examine whether specific subgroups of patients in the LOS were less likely to receive each preventive service. Each of the models included demographic factors, health care access factors, health status, and neighborhood poverty level. We used SAS 9.2 (SAS Institute, Cary, NC, USA) for this portion of the analysis.
In addition to examining each preventive service individually, we were also interested in examining the overall quality of preventive care in the LOS. We therefore developed pass frequencies [21] (defined as the percentage of times that each service was received among eligible individuals) for the two immunizations, three cancer screening procedures, and all five of these services combined. In these analyses, respondents contributed one observation for each eligible service, and thus there were between one and five observations per respondent. We accounted for these repeated measures in our regression models. We present the adjusted pass frequencies from these models, which provide estimates of the probability of individuals receiving preventive services controlling for all of the other variables of interest. This analysis was completed in SUDAAN 10.0.
Results
Patient characteristics
The characteristics of subjects enrolled in the LOS and CHIS are listed in Table 1. To facilitate comparisons with CHIS, males were excluded from the comparative analysis between the two samples (the LOS analysis sample consists of 685 women and 57 men). Both samples are primarily Caucasian (among individuals included in the LOS analysis, 68% were Caucasian, 9% Latino, 7% African-American, 8% Asian/Pacific Islander, and 6% other; among individuals in CHIS, 75% were Caucasian, 9% Latino, 5% African-American, 7% Asian/Pacific Islander, and 4% other). The number of individuals living below poverty was similar between the samples. Although levels of college education were comparable between the two samples, LOS respondents reported higher educational attainment overall. A similar percentage of individuals in the two samples were enrolled in Medicaid. However, a higher percentage of LOS respondents report Medicare coverage. In the LOS, 19% of individuals reported having no primary care provider, and 16% reported that a rheumatologist was not involved in care. Respondents had a mean of 16 physician visits per year.
Table 1. Characteristics of women in the Lupus Outcomes Study (LOS) and the California Health Interview Survey (CHIS)
Receipt of preventive health services in the LOS versus CHIS
Table 2 summarizes the percentage of eligible patients enrolled in the LOS and CHIS who received recommended cancer screening and immunizations. We found that the crude frequency of receipt of services in persons with SLE was comparable to the general population for almost all services examined, with the exception of receipt of pneumococcal immunization. LOS respondents were less likely to report pneumococcal immunization than the CHIS general population, but frequencies were similar to those with chronic conditions enrolled in CHIS. Those enrolled in CHIS were less likely to receive influenza immunization than LOS respondents. In addition to examining the crude frequencies reported in Table 2, we also standardized the LOS sample to CHIS by age and education. These standardized frequencies yielded the same conclusions as those discussed above.
Table 2. Receipt of preventive services by women in the Lupus Outcomes Study and the general population
Predictors of receipt of individual preventive health services in the LOS
Consistent with previous literature on the receipt of preventive health services in the general medical population, different predictors were identified for the different services examined (Table 3). Older individuals were more likely to receive four of the services: influenza immunization, pneumococcal immunization, colon cancer screening and mammography. Race/ethnicity did not predict the receipt of most services, except that non-Caucasian LOS respondents were more likely to report mammography. Those with a college education were more likely to receive most services, although this only reached statistical significance for cervical cancer screening and immunizations. Individuals living below poverty were less likely to receive cervical cancer screening. Although enrollment in an HMO did influence receipt of preventive services, the findings varied across services. For example, those enrolled in HMOs appeared more likely to receive immunizations, but less likely to receive cancer screening.
Table 3. Predictors of receiving preventive services in men and women enrolled in the Lupus Outcomes Study
Those reporting a visit to a generalist physician in the last year were more likely to receive many of the preventive services examined (influenza and pneumococcal immunizations, cervical cancer screening). Individuals seeing a rheumatologist in the last year were more likely to receive influenza immunizations. Total physician visits increased the likelihood of receiving services, reaching statistical significance for all cancer screening tests. More disease activity, as measured by the SLAQ, was associated with fewer immunizations, as was higher physical functioning. We did not see any significant effects by neighborhood poverty level once personal socioeconomic status was taken into account.
Predictors of receipt of overall preventive health services in the LOS
Table 4 lists the pass frequencies for immunizations, cancer screening tests, and all preventive services combined in the LOS. The first sample of 1,117 observations represents patients who were eligible for either influenza or pneumococcal immunizations. Since one person may be eligible for both, this sample includes repeated measures. The sample in the second column represents 1,364 observations eligible for colon cancer screening, mammography or cervical cancer screening. The last sample of 2,481 observations combines the previous two samples to represent all observations eligible for preventive services.
Table 4. Adjusted pass frequencies for receipt of preventive services by men and women in the Lupus Outcomes Study
As demonstrated in the last column, the frequency of receiving preventive services increased with age but no differences were noticed between men and women, by income, or by race/ethnicity. The frequency of receiving preventive services also increased with higher educational attainment. Having a generalist physician involved in clinical care increased the likelihood of receiving preventive services, as did the total number of outpatient physician visits. Having a rheumatologist involved in care increased the likelihood of receiving immunizations. Those with managed care and public insurance have higher immunization frequencies but lower frequencies of cancer screening. Cancer screening was more likely for those with private insurance. Lastly, increased SLAQ scores and higher SF-36 physical function scores were associated with lower immunization frequencies. We did not observe a difference in the receipt of preventive services by neighborhood poverty level.
Discussion
Although the overall receipt of cancer screening procedures and immunizations in the UCSF LOS was relatively high and comparable to the general population, we observed considerable variation among sociodemographic subgroups. In particular, individuals with SLE who were younger and reported less educational attainment were significantly less likely to receive preventive services. In addition, health system factors, such as the involvement of a generalist provider in care and total physician visits, were also associated with the receipt of preventive health care services in SLE.
Although immunization frequencies in SLE have not previously been reported, our finding that about 60% of eligible patients receive pneumococcal or influenza immunization is consistent with studies in other rheumatic diseases [22]. The finding that 40% of patients remain unvaccinated is notable given that approximately one-third of deaths in SLE are attributable to infections [23], and several studies have found that respiratory infections, including those attributable to Streptococcus pneumoniae, are the leading cause of serious infections in SLE [24,25]. We did not investigate specific reasons for non-immunization, which might include patient preferences, contraindications, failure of providers to offer the vaccine, or cost. In SLE, suboptimal immunization frequencies may also partly reflect long-standing concerns about vaccine safety that arose after early reports of fatalities or increased disease activity following immunization [26,27]. However, several decades of scientific research have now failed to corroborate these early concerns [28]. Based on this evidence, recently developed quality indicators for SLE have established influenza and pneumococcal immunization in this population as a minimally acceptable standard of care [13]. Our study suggests that individuals with lower educational attainment are at particularly high risk of not receiving immunizations, a finding that is consistent with a growing body of evidence that individuals with less education may receive poorer quality health care [29,30].
About one third of patients in our cohort did not receive recommended cancer screening tests. As in the case with immunizations, younger patients and those with less educational attainment were less likely to receive recommended cancer screening. Although we expected that those enrolled in HMOs would be more likely to receive cancer screening given the emphasis of these organizations on preventive care, this was not the case. However, consistent with other recent studies, individuals with a higher number of physician visits were more likely to receive cancer screening services [31,32]. No specific cancer surveillance guidelines for SLE have been published to date, although at a minimum, it seems reasonable that SLE patients should receive cancer surveillance tests recommended for the general population. One previous study has examined cancer surveillance rates in Canadian SLE patients using a tertiary-care clinic cohort. In that study, researchers surveyed 146 patients regarding receipt of cancer screening tests in the last year. Unlike our study that found screening rates similar to the general population, rates in that cohort fell well below general population cancer screening rates in Canada [5].
Our study also suggests that both a higher number of physician visits and involvement of primary care providers in SLE management are associated with improved preventive health care quality. As short-term mortality from SLE declines and clinical care increasingly shifts toward the long-term prevention and management of co-morbidities and complications, effectively coordinating care between specialists and primary care providers is a priority. Such coordination, however, may prove challenging in SLE, where clinical care often spans multiple specialists who sometimes practice at significant geographic distances from each other [33,34]. Increasing awareness among primary care providers about the higher risk of specific long-term complications in SLE, and improving care coordination by specialists caring for SLE patients through various practice innovations, such as automatic reminders in electronic medical records, may help improve the quality of preventive health care in this population.
Studying health services in SLE is challenging given the low prevalence of the disease. Most research to date has drawn from tertiary care specialty clinics, which may not adequately represent the entire population with SLE. Although not a random sample of the population of patients with SLE, our study has attempted to partly address this gap by drawing from community-based sources. Nevertheless, our study has limitations. First, because the LOS participants speak English and have health insurance, we cannot generalize our findings to non-English speaking individuals or those without health insurance - two groups that are at great risk of receiving poorer quality health care. Conducting this research in non-English speaking and indigent populations should be prioritized in future studies. Second, participants in the LOS may not be directly comparable to those in CHIS. Although we had a sufficient number of observations to standardize our sample based on age and education and included only insured individuals in our analyses, additional standardization by potential confounding factors such as race/ethnicity and type of health insurance was not possible. Third, our study did not include at least one variable found in previous research to influence the receipt of preventive services: medical comorbidities [31]. Incorporating a measure of comorbidity in future studies on the topic is therefore warranted. Fourth, our study did not assess the specific reasons for not receiving preventive services, and therefore we cannot determine whether gaps in care are secondary to patient, provider or health system factors. Finally, our data derive from self-report. Previous studies have demonstrated that self-report is a reasonable, although not perfect, proxy for various preventive health services [31,35-38].
Conclusions
Our findings demonstrate that there remains room for improvement in the quality of care for two important categories of preventive service in SLE, particularly in younger patients and those with lower educational attainment. Although individuals in the LOS appear to receive preventive services at frequencies similar to CHIS, receipt of services in both groups is suboptimal. Given the higher burden of infections and malignancies in SLE, identifying strategies to abate these long-term outcomes in SLE is an important goal. Coordinated, multidisciplinary care that involves generalist providers may offer an opportunity to improve the provision of preventive health services in SLE.
Abbreviations
CDC: Center for Disease Control; CHIS: California Health Interview Survey; HMO: health maintenance organization; LOS: Lupus Outcomes Study; SF-36: Short-Form 36; SLAQ: Systemic Lupus Activity Questionnaire; SLE: systemic lupus erythematosus; UCSF: University of California San Francisco.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
JY, PP, AH, LJ, PK and EY contributed to the study design. JY, LT, PK, LC and EY contributed to acquisition of data. JY, CT and EY contributed to analysis and interpretation of data. JY, PP, JZG, AH, PK, LC and EY contributed to manuscript preparation. JY, CT and LT contributed to statistical analysis.
Acknowledgements
This study was supported by the ACR/REF (Yazdany), Arthritis Foundation (Yazdany and Yelin), State of California Lupus Fund, AHRQ/NIAMS 1 RO1 HS013893 (Yelin), NIAMS P60-AR-053308 and the Rosalind Russell Medical Research Center for Arthritis. The study was also carried out in part in the General Clinical Research Center, Moffit Hospital, University of California, San Francisco, with funds provided by the National Center for Research Resources, 5 M01 RR-00079, U.S. Public Health Service.
References
1. Bernatsky S, Boivin JF, Joseph L, Manzi S, Ginzler E, Gladman DD, Urowitz M, Fortin PR, Petri M, Barr S, Gordon C, Bae SC, Isenberg D, Zoma A, Aranow C, Dooley MA, Nived O, Sturfelt G, Steinsson K, Alarcon G, Senecal JL, Zummer M, Hanly J, Ensworth S, Pope J, Edworthy S, Rahman A, Sibley J, El-Gabalawy H, McCarthy T, et al.: Mortality in systemic lupus erythematosus.
Arthritis Rheum 2006, 54:2550-2557. PubMed Abstract | Publisher Full Text
2. Kremers HM, Bidaut-Russell M, Scott CG, Reinalda MS, Zinsmeister AR, Gabriel SE: Preventive medical services among patients with rheumatoid arthritis.
J Rheumatol 2003, 30:1940-1947. PubMed Abstract | Publisher Full Text
3. Beckman TJ, Cuddihy RM, Scheitel SM, Naessens JM, Killian JM, Pankratz VS: Screening mammogram utilization in women with diabetes.
Diabetes Care 2001, 24:2049-2053. PubMed Abstract | Publisher Full Text
4. Selby L, Kane S, Wilson J, Balla P, Riff B, Bingcang C, Hoellein A, Pande S, de Villiers WJ: Receipt of preventive health services by IBD patients is significantly lower than by primary care patients.
Inflamm Bowel Dis 2008, 14:253-258. PubMed Abstract | Publisher Full Text
5. Bernatsky SR, Cooper GS, Mill C, Ramsey-Goldman R, Clarke AE, Pineau CA: Cancer screening in patients with systemic lupus erythematosus.
J Rheumatol 2006, 33:45-49. PubMed Abstract | Publisher Full Text
6. Yarnall KS, Pollak KI, Ostbye T, Krause KM, Michener JL: Primary care: is there enough time for prevention?
Am J Public Health 2003, 93:635-641. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
7. Yelin E, Trupin L, Katz P, Criswell L, Yazdany J, Gillis J, Panopalis P: Work dynamics among persons with systemic lupus erythematosus.
Arthritis Rheum 2007, 57:56-63. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
8. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF, Schaller JG, Talal N, Winchester RJ: The 1982 revised criteria for the classification of systemic lupus erythematosus.
Arthritis Rheum 1982, 25:1271-1277. PubMed Abstract | Publisher Full Text
9. The California Health Interview Survey [http://www.chis.ucla.edu] webcite
10. United States Preventive Services Task Force. Guide to Clinical Preventive Services, 2009 [http://www.ahrq.gov/clinic/pocketgd.htm] webcite
11. Harper SA, Fukuda K, Uyeki TM, Cox NJ, Bridges CB, Centers for Disease Control and Prevention (CDC) Advisory Committee on Immunization Practices (ACIP): Prevention and control of influenza: recommendations of the Advisory Committee on Immunization Practices (ACIP).
MMWR Recomm Rep 2004, 53:1-40. PubMed Abstract | Publisher Full Text
12. Prevention of Pneumococcal Disease: recommendations of the Advisory Committee on Immunization Practices (ACIP)
MMWR Recomm Rep 1997, 46:1-24. PubMed Abstract | Publisher Full Text
13. Yazdany J, Panopalis P, Gillis JZ, Schmajuk G, MacLean CH, Wofsy D, Yelin E: A quality indicator set for systemic lupus erythematosus.
Arthritis Rheum 2009, 61:370-377. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
14. Yazdany J, Yelin EH, Panopalis P, Trupin L, Julian L, Katz PP: Validation of the systemic lupus erythematosus activity questionnaire in a large observational cohort.
Arthritis Rheum 2008, 59:136-143. PubMed Abstract | Publisher Full Text
15. Karlson EW, Daltroy LH, Rivest C, Ramsey-Goldman R, Wright EA, Partridge AJ, Liang MH, Fortin PR: Validation of a Systemic Lupus Activity Questionnaire (SLAQ) for population studies.
Lupus 2003, 12:280-286. PubMed Abstract | Publisher Full Text
16. Ware J, Snow K, Kosinski M, Gandek B: SF-36 Health Survey. Manual and Interpretation Guide. Boston, Massachusetts: The Health Institute, New England Medical Center; 1993.
17. Miller RH, Luft HS: HMO plan performance update: an analysis of the literature, 1997-2001.
Health Aff (Millwood) 2002, 21:63-86. PubMed Abstract | Publisher Full Text
18. Wang YR, Pauly MV: Difference in the use of preventive services between fee-for-service plans and HMOs: is more better?
Am J Manag Care 2003, 9:293-301. PubMed Abstract | Publisher Full Text
19. Zenk SN, Tarlov E, Sun J: Spatial equity in facilities providing low- or no-fee screening mammography in Chicago neighborhoods.
J Urban Health 2006, 83:195-210. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
20. Trupin L, Tonner MC, Yazdany J, Julian LJ, Criswell LA, Katz PP, Yelin E: The role of neighborhood and individual socioeconomic status in outcomes of systemic lupus erythematosus.
J Rheumatol 2008, 35:1782-1788. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
21. Zingmond DS, Wilber KH, Maclean CH, Wenger NS: Measuring the quality of care provided to community dwelling vulnerable elders dually enrolled in Medicare and Medicaid.
Med Care 2007, 45:931-938. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
22. Pradeep J, Watts R, Clunie G: Audit on the uptake of influenza and pneumococcal vaccination in patients with rheumatoid arthritis.
Ann Rheum Dis 2007, 66:837-838. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
23. Abu-Shakra M: Do improved survival rates of patients with systemic lupus erythematosus reflect a global trend?
J Rheumatol 2008, 35:1906-1908. PubMed Abstract | Publisher Full Text
24. Goldblatt F, Chambers S, Rahman A, Isenberg DA: Serious infections in British patients with systemic lupus erythematosus: hospitalisations and mortality.
Lupus 2009, 18:682-689. PubMed Abstract | Publisher Full Text
25. Noel V, Lortholary O, Casassus P, Cohen P, Genereau T, Andre MH, Mouthon L, Guillevin L: Risk factors and prognostic influence of infection in a single cohort of 87 adults with systemic lupus erythematosus.
Ann Rheum Dis 2001, 60:1141-1144. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
26. Fox R: Disseminated lupus erythematosus: an allergic disease?
Arch Path 1943, 36:311-315.
27. Ayvazian L, Badger T: Disseminated lupus erythematosusoccurring among student nurses.
N Engl J Med 1948, 239:565-570. PubMed Abstract
28. O'Neill SG, Isenberg DA: Immunizing patients with systemic lupus erythematosus: a review of effectiveness and safety.
Lupus 2006, 15:778-783. PubMed Abstract | Publisher Full Text
29. Schneider EC, Cleary PD, Zaslavsky AM, Epstein AM: Racial disparity in influenza vaccination: does managed care narrow the gap between African Americans and whites?
JAMA 2001, 286:1455-1460. PubMed Abstract | Publisher Full Text
30. Fiscella K, Franks P, Doescher MP, Saver BG: Do HMOs affect educational disparities in health care?
Ann Fam Med 2003, 1:90-96. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
31. Walter LC, Lindquist K, Nugent S, Schult T, Lee SJ, Casadei MA, Partin MR: Impact of age and comorbidity on colorectal cancer screening among older veterans.
Ann Intern Med 2009, 150:465-473. PubMed Abstract
32. Fenton JJ, Cai Y, Weiss NS, Elmore JG, Pardee RE, Reid RJ, Baldwin LM: Delivery of cancer screening: how important is the preventive health examination?
Arch Intern Med 2007, 167:580-585. PubMed Abstract | Publisher Full Text
33. Gillis JZ, Yazdany J, Trupin L, Julian L, Panopalis P, Criswell LA, Katz P, Yelin E: Medicaid and access to care among persons with systemic lupus erythematosus.
Arthritis Rheum 2007, 57:601-607. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
34. Yazdany J, Gillis JZ, Trupin L, Katz P, Panopalis P, Criswell LA, Yelin E: Association of socioeconomic and demographic factors with utilization of rheumatology subspecialty care in systemic lupus erythematosus.
Arthritis Rheum 2007, 57:593-600. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
35. Rauscher GH, Johnson TP, Cho YI, Walk JA: Accuracy ofself-reported cancer-screening histories: a meta-analysis.
Cancer Epidemiol Biomarkers Prev 2008, 17:748-757. PubMed Abstract | Publisher Full Text
36. Skull SA, Andrews RM, Byrnes GB, Kelly HA, Nolan TM, Brown GV, Campbell DA: Validity of self-reported influenza and pneumococcal vaccination status among a cohort of hospitalized elderly inpatients.
Vaccine 2007, 25:4775-4783. PubMed Abstract | Publisher Full Text
37. Irving SA, Donahue JG, Shay DK, Ellis-Coyle TL, Belongia EA: Evaluation of self-reported and registry-based influenza vaccination status in a Wisconsin cohort.
Vaccine 2009, 27:6546-6549. PubMed Abstract | Publisher Full Text
38. Mangtani P, Shah A, Roberts JA: Validation of influenza and pneumococcal vaccine status in adults based on self-report.
Epidemiol Infect 2007, 135:139-143. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:53.000Z
|
fcpt6jbift6jhhaeaua6zybqngrbvoge
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69529",
"uncompressed_offset": 13752751,
"url": "arthritis-research.com/content/15/1/R21/email",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://arthritis-research.com/content/15/1/R21/email"
}
|
cccc_CC-MAIN-2013-20
|
Email this article to a friend
High prevalence of spondyloarthritis and ankylosing spondylitis among familial Mediterranean fever patients and their first-degree relatives: further evidence for the connection
Servet Akar*, Ozgul Soysal, Ali Balci, Dilek Solmaz, Vedat Gerdan, Fatos Onen, Mehmet Tunca and Nurullah Akkoc
Arthritis Research & Therapy 2013, 15:R21 doi:10.1186/ar4154
Fields marked * are required
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:14.000Z
|
5rncdkzvuwx7a5m7nbswquxnulbisjrk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69530",
"uncompressed_offset": 15181612,
"url": "ask.libreoffice.org/en/question/7221/combining-bullets-and-numbering/",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://ask.libreoffice.org/en/question/7221/combining-bullets-and-numbering/"
}
|
cccc_CC-MAIN-2013-20
|
Ask Your Question
0
combining bullets and numbering [closed]
asked 2012-10-27 16:14:18 +0200
This post is a wiki. Anyone with karma >750 is welcome to improve it.
updated 2013-02-01 16:42:04 +0200
qubit
5693 3 48 41
I just am having fits trying to continue previous numbering after two or three levels of bullets in Writer.odt. I've tried help several times and just don't get it. Writer wants to restart numbering but if I attempt to continue previous numbering it goes to the previous level of bullet instead. I worked with dragging a character down from a previous numbered paragraph with no joy. I'll keep struggling in hopes I can answer my own question but help from a wise one would be sheer bliss.
Sincere regards to the community. MK
delete reopen flag offensive retag edit
The question has been closed for the following reason "question is not relevant or outdated" by qubit
close date 2013-03-02 08:14:24.126217
Donate
LibreOffice is made available by volunteers around the globe, backed by a charitable Foundation. Please support our efforts: Your donation helps us to deliver a better product!
Question tools
Follow
subscribe to rss feed
Stats
Asked: 2012-10-27 16:14:18 +0200
Seen: 56 times
Last updated: Oct 27 '12
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:21:51.000Z
|
s3qo2vyvilvu76yvnhpxcng6bdvafxk7
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69567",
"uncompressed_offset": 53771987,
"url": "cnx.org/content/col10550/1.21/content_info",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://cnx.org/content/col10550/1.21/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Fast Fourier Transforms
About: Fast Fourier Transforms
Collection type: Book
Book by: C. Sidney Burrus. E-mail the author
View the content: Fast Fourier Transforms
Metadata
Name: Fast Fourier Transforms
ID: col10550
Language: English (en)
Summary: This book uses an index map, a polynomial decomposition, an operator factorization, and a conversion to a filter to develop a very general and efficient description of fast algorithms to calculate the discrete Fourier transform (DFT). The work of Winograd is outlined, chapters by Selesnick, Pueschel, and Johnson are included, and computer programs are provided.
Collection Subtype: Book
Subject: Mathematics and Statistics, Science and Technology
Keywords: Cooley Tukey FFT, Fast Fourier Transform, FFT, PFA, Prime Factor Algorithm, WFTA, Winograd Fourier Transform Algorithm
License: Creative Commons Attribution License CC-BY 2.0
Authors: C. Sidney Burrus (csb@rice.edu)
Copyright Holders: C. Sidney Burrus (csb@rice.edu)
Maintainers: C. Sidney Burrus (csb@rice.edu), Daniel Williamson (dcwill@cnx.org)
Latest version: 1.21 (history)
First publication date: Jun 2, 2008 11:56 am GMT-5
Last revision to collection: Apr 10, 2010 1:35 pm GMT-5
Version History
Version: 1.22 Nov 18, 2012 9:58 pm US/Central by C. Sidney Burrus
Changes:
republication
Version: 1.21 Apr 10, 2010 1:35 pm GMT-5 by C. Sidney Burrus Currently viewing this version.
Changes:
clean up
Version: 1.20 Sep 9, 2009 1:29 pm GMT-5 by Daniel Williamson
Changes:
added google analytics code
Version: 1.19 Aug 24, 2009 10:15 am GMT-5 by C. Sidney Burrus
Changes:
font change
Version: 1.18 Apr 5, 2009 11:05 am GMT-5 by C. Sidney Burrus
Changes:
8.5x11 size, 12 pt font
Version: 1.17 Apr 5, 2009 10:40 am GMT-5 by C. Sidney Burrus
Changes:
parameters
Version: 1.16 Apr 4, 2009 9:25 pm GMT-5 by C. Sidney Burrus
Changes:
para
Version: 1.15 Apr 4, 2009 9:13 pm GMT-5 by C. Sidney Burrus
Changes:
para
Version: 1.14 Apr 4, 2009 8:40 pm GMT-5 by C. Sidney Burrus
Changes:
parameters
Version: 1.13 Apr 4, 2009 8:29 pm GMT-5 by C. Sidney Burrus
Changes:
parameters
Version: 1.12 Apr 4, 2009 3:15 pm GMT-5 by C. Sidney Burrus
Changes:
8.5x11
Version: 1.11 Apr 4, 2009 10:20 am GMT-5 by C. Sidney Burrus
Changes:
New version CnXML
Version: 1.10 Nov 26, 2008 9:55 am US/Central by Daniel Williamson
Changes:
changed parameters
Version: 1.9 Oct 5, 2008 11:34 am GMT-5 by C. Sidney Burrus
Changes:
added Appendix 4
Version: 1.8 Sep 16, 2008 1:48 pm GMT-5 by Daniel Williamson
Changes:
removed empty subcollection
Version: 1.7 Sep 3, 2008 10:02 pm GMT-5 by C. Sidney Burrus
Changes:
added Appendix 3
Version: 1.6 Sep 2, 2008 2:20 pm GMT-5 by C. Sidney Burrus
Changes:
role changes
Version: 1.5 Jul 24, 2008 9:46 pm GMT-5 by C. Sidney Burrus
Changes:
change roles
Version: 1.4 Jul 18, 2008 5:15 pm GMT-5 by Daniel Williamson
Changes:
code blocks edited
Version: 1.3 Jul 18, 2008 11:05 am GMT-5 by Daniel Williamson
Changes:
add section comments
Version: 1.2 Jul 18, 2008 10:18 am GMT-5 by Daniel Williamson
Changes:
image and role corrections
Version: 1.1 Jul 14, 2008 2:16 pm GMT-5 by Daniel Williamson
Changes:
Created Collection
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 2.0), you must include
• the authors' names: C. Burrus
• the title of the work: Fast Fourier Transforms
• the Connexions URL where the work can be found: http://cnx.org/content/col10550/1.21/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 2.0) of this work:
American Chemical Society (ACS) Style Guide:
Burrus, C. Fast Fourier Transforms, Connexions Web site. http://cnx.org/content/col10550/1.21/, Apr 10, 2010.
American Medical Assocation (AMA) Manual of Style:
Burrus C. Fast Fourier Transforms [Connexions Web site]. April 10, 2010. Available at: http://cnx.org/content/col10550/1.21/.
American Psychological Assocation (APA) Publication Manual:
Burrus, C. (2010, April 10). Fast Fourier Transforms. Retrieved from the Connexions Web site: http://cnx.org/content/col10550/1.21/
Chicago Manual of Style (Bibliography):
Burrus, C.. "Fast Fourier Transforms." Connexions. April 10, 2010. http://cnx.org/content/col10550/1.21/.
Chicago Manual of Style (Note):
C. Burrus, "Fast Fourier Transforms," Connexions, April 10, 2010, http://cnx.org/content/col10550/1.21/.
Chicago Manual of Style (Reference, in Author-Date style):
Burrus, C. 2010. Fast Fourier Transforms. Connexions, April 10, 2010. http://cnx.org/content/col10550/1.21/.
Modern Languages Association (MLA) Style Manual:
Burrus, C.. Fast Fourier Transforms. Connexions. 10 Apr. 2010 <http://cnx.org/content/col10550/1.21/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:55.000Z
|
g7mq3tqjsgrtem4zw3i7tk7gzx7a4zfo
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69568",
"uncompressed_offset": 53778381,
"url": "cnx.org/content/m24398/1.1/content_info",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://cnx.org/content/m24398/1.1/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » English in Town - 02
About: English in Town - 02
Module by: Siyavula Uploaders. E-mail the author
View the content: English in Town - 02
Metadata
Name: English in Town - 02
ID: m24398
Language: English (en)
Subject: Humanities
License: Creative Commons Attribution License CC-BY 3.0
Authors: Siyavula Uploaders (support@siyavula.org.za)
Copyright Holders: Siyavula Uploaders (support@siyavula.org.za)
Maintainers: Siyavula Uploaders (support@siyavula.org.za)
Latest version: 1.1 (history)
First publication date: Jun 3, 2009 2:52 am -0500
Last revision to module: Jun 3, 2009 3:25 am -0500
Downloads
PDF: m24398_1.1.pdf PDF file, for viewing content offline and printing. Learn more.
XML: m24398_1.1.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.1 Jun 3, 2009 3:25 am -0500 by Siyavula Uploaders
Changes:
Add solid lines
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Siyavula Uploader
• the title of the work: English in Town - 02
• the Connexions URL where the work can be found: http://cnx.org/content/m24398/1.1/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Uploader, S. English in Town - 02, Connexions Web site. http://cnx.org/content/m24398/1.1/, Jun 3, 2009.
American Medical Assocation (AMA) Manual of Style:
Uploader S. English in Town - 02 [Connexions Web site]. June 3, 2009. Available at: http://cnx.org/content/m24398/1.1/.
American Psychological Assocation (APA) Publication Manual:
Uploader, S. (2009, June 3). English in Town - 02. Retrieved from the Connexions Web site: http://cnx.org/content/m24398/1.1/
Chicago Manual of Style (Bibliography):
Uploader, Siyavula. "English in Town - 02." Connexions. June 3, 2009. http://cnx.org/content/m24398/1.1/.
Chicago Manual of Style (Note):
Siyavula Uploader, "English in Town - 02," Connexions, June 3, 2009, http://cnx.org/content/m24398/1.1/.
Chicago Manual of Style (Reference, in Author-Date style):
Uploader, S. 2009. English in Town - 02. Connexions, June 3, 2009. http://cnx.org/content/m24398/1.1/.
Modern Languages Association (MLA) Style Manual:
Uploader, Siyavula. English in Town - 02. Connexions. 3 June 2009 <http://cnx.org/content/m24398/1.1/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:02.000Z
|
bnzx6dpybxwb374kghiwhwczx3vgvcba
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69580",
"uncompressed_offset": 78062369,
"url": "dotnetkicks.com/tags/fanboyism",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://dotnetkicks.com/tags/fanboyism"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
By tag: fanboyism
showing: of
0
kicks
IE8, Microsoft and the Reverse Fanboys (Unpublished)
As the beta test of IE8 recently became available we are quickly approaching the release of another version of Internet Explorer. Much frustration has been expressed about the issues (or supposed issues ) in this beta. Some of this concern is definitely understandable, however, I think some of the n...
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:58:41.000Z
|
ssznjohhneg4g5zrvaeoz4pgr5mnqukk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69587",
"uncompressed_offset": 86315239,
"url": "elinux.org/index.php?action=history&title=File%3ABeagleBone_P9_256x256.jpg",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://elinux.org/index.php?title=File:BeagleBone_P9_256x256.jpg&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Revision history of "File:BeagleBone P9 256x256.jpg"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
• (cur | prev) 08:57, 4 June 2012Morgaine (Talk | contribs). . (472 bytes) (+472). . (Pinout table of BeagleBone P9 Expansion Header. From http://beagleboard.org/static/BONESRM_latest.pdf * This work is licensed under the Creative Commons Attribution-Share Alike 3.0 Unported License. To view a copy of this license, visit http://creativec)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:00.000Z
|
jw54zazkwwh4ilu2tulk5kezi6sfrn4f
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69605",
"uncompressed_offset": 115124802,
"url": "globalvoicesonline.org/2007/12/06/china-internet-censorship-on-trial-day-two/",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://globalvoicesonline.org/2007/12/06/china-internet-censorship-on-trial-day-two/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
China: Internet censorship on trial, day two
This post also available in:
Español · China: Censura en Internet a juicio, día dos
Is publicly notarized proof that your internet service provider has blocked your company website strong enough to seek damages? Just a week after National Legal System Propaganda Day, Shanghai-based IT blogger Du “Yetaai” Dongjin will have his second day in court where it is expected the defendant, China Telecom, will continue to challenge Du's evidence: courtroom 12, 5/F, #1 Intermediate People's Court at #1200 Hongqiao Rd., Shanghai, 1:45pm on December 11, 2007.
In a Dec. 2 post, Du writes on his Blogspot blog Very Beginner (also blocked):
公民杜冬劲于今年四月二十八日起诉上海电信违反服务协议。而原告的初衷，反对黑箱式监管互联网，带有强烈的宪法诉讼意愿。其在声明中说，结合上海市浦东新区法院的一审判决书和其中列举的证据,我们认为原告所列事实准确，所诉合情合理。根据我们日常的上网经验，我们也确认很多网站的访问在国内受到了无端禁止。然而，即便明知某个网站没有违反中华人民共和国法律，也无法通知有关部门承担责任，改正错误。杜冬劲在本讼中列举的证据，充分证明上海电信参与了监管这些网站的行为。中国电信全资拥有上海电信，结合我们分布各省的事实，中国电信难辞其绺。
On April 28 this year, citizen Du Dongjin brought action against Shanghai Telecom for violation of service agreement. The complainant's intent, to fight black box-style of internet supervision by means of a lawsuit, has strong constitutional grounding. He states: with the combination of the judgment passed by the court in Shanghai's New Pudong district and the evidence enumerated therein, we feel that the facts put forth by the complainant are accurate, and that the lawsuit is fair and reasonable. According to our daily experiences of using the internet, we can also confirm that the visitation of many websites from here in China has been subject to gratuitous prohibition. Yet, while knowing full well that such websites are not in violation of the laws of the People's Republic of China, there are no means by which to notify a relevant department to assume responsibility and fix the error. Du Dongjin has listed evidence in regard to this litigation which amply proves that Shanghai Telecom has taken part in the supervision of these websites. As China Telecom is the sole owner in Shanghai Telecom, combined with what we have shown is true in all other provinces, it is assumed that China Telecom cannot evade blame.
进一步，我们认为，无论上海电信在这个是否违约，上海电信及相关网络监管部门的网络监管行为违反了中华人民共和国宪法。而上海电信对于原告故障保修的回答，“非回复性原因”，更是对于公民道权（权利）的极端漠视。鉴于目前没有成熟的宪法诉讼流程，我们特对于全国人民代表大会，进行如下违宪审查的呼吁，希望有人民代表能提起相关议案，为中国社会的进步做出自己的一份贡献。
Further, we feel, regardless of whether Shanghai Telecom in this has breached contract, Shanghai Telecom and the relevant internet supervision department's supervision of the internet constitutes violation of the constitution of the People's Republic of China. What's more, Shanghai Telecom's response to the complainant of attributing the malfunction to “irreversible reasons” is all the more an extreme disregard for civil rights. In view of a lack at present of a mature process for taking constitutional action, we strongly appeal to the National People's Congress in regards to this unconstitutional censorship, hoping that NPC delegates will raise a corresponding motion and make their own contribution to the improvement of Chinese society.
Recently, Du has been calling on readers to join him in a class action lawsuit, emphasizing the relatively simple procedure involved:
非常希望更过律师或能法律专业人士加入本讼二审的联合辩护团，但不限于法律专业人士。二审开庭日期请见本文最后一段。希望本讼能成为中国宪法诉讼中的一个重要案件和公开舞台。基于此种想法，我，原告杜冬劲，和本讼目前律师，李立，共同邀请各位专业朋友报名。拟再邀请主讼律师一名（需要参加二审开庭），联合辩护团成员数目最多五名（签名即可）。请发送电子邮件和本人联系。
无论是否法律专业人士，只要您是地球人，能够读懂本文，如果您愿意通过真名签名表示支持，请打印诉讼介绍一节，签上您的名字和日期，扫描后发送电子邮件给本人，也欢迎您发送照片和简介介绍您自己。所有图片本人将汇集后刻成光盘出版。同时欢迎博客和媒体朋友通过各种方式转载，报道。
本人电子邮件，yetaai at gmail dot comg 去掉最后的字母g。
What I most hope to see are lawyers or other legal professionals join in a group defense for this lawsuit's second hearing, but not limited to legal professionals. I hope this lawsuit can become a major case and open stage for constitutional action in China. With that in mind, I, the complainant, Du Dongjin, along with this case's representative, Li Li, hereby jointly invite friends from every profession to sign up. The intent is to retain one more leading lawyer (to take part in the second hearing), and a maximum total of five joint complainants (only a signature is needed). Please contact this blogger via e-mail.
Being a legal professional is not relevant, one need only be of this earth and able to understand the legal text. If you are indeed willing to sign in your real name and express your support, please print out the case summary, sign your name and the date, scan it in and e-mail it to me. You're also welcome to send a photo and brief introduction of yourself. All images will collected by myself and burnt onto a CD-ROM to be released. At the same time, all blogger and media friends are welcome to pass on and report this news on in any way they see fit.
My e-mail is ‘yetaai at gmail dot comg’ but drop the last g.
An anonymous comment left Dec. 3 on that post reads:
楼上的说的对，你是先驱者，至于现阶段能否真正废除网络管制，我不太乐观，但是随着民众渐渐地觉醒，这个政策早晚流产。
I agree, you are a pioneer. As for whether internet regulation can be scrapped at this time, I'm not too optimistic. But along with this people will gradually start to realize, and sooner or later these policies will be aborted.
It remains to be blogged whether Du has found the five co-complainants he seeks, but in the meantime supportive news of his cause continues to spread, as well as resonate with other blocked bloggers:
我在Blogspot坚持了几年没有换岗,可是这个哥们(告杜冬劲)比我更执着, 不敢坚持,还一纸把上海电信公司告上了法庭,法院判决结果不管怎么样,支持一下这个哥们:
I've stayed strong here on Blogspot for a few years and I won't be moving [blogs] now. And this dude (complainant Du Dongjin) is even more stubborn than me; I wouldn't have been able to stick it through, taking Shanghai Telecom to court. Never mind how the court decides to rule, and let's support this dude!
And even inspire:
事情的原委就是杜冬劲不满GFW及中国电信随意封锁网站。在上海对这些变态提起诉讼。
具体事情的原委及如何支持他欢迎移步杜冬劲的博客http://yetaai.blogspot.com/。
还有一点，希望大家广泛宣传此事件，让更多人知道和关注！
另外本人在信产部对中国联通封锁WAP网站的投诉已经成功，联通承诺将进行整改。
The story behind this is that Du Dongjin was unsatisfied with the GFW and Shanghai Telecom's arbitrary blocking of websites. And took these freaks to court in Shanghai.
For the full story and details on how to support him, please step on over to Du's blog: http://yetaai.blogspot.com
One more thing, I hope everyone passes this news widely around, let as many people know and follow this as possible!
Also, my own complaint to the Ministry of Information Industry against China Unicom for blocking WAP sites has been successful, and China Unicom has promised to make amends.
World regions
Countries
Languages
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:21.000Z
|
izj47y3hlovwr325wnceebvjf24n5yo7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:69613",
"uncompressed_offset": 125903021,
"url": "hitchwiki.org/en/Chad",
"warc_date": "2013-11-22T14:34:15.000Z",
"warc_filename": "<urn:uuid:36d7928b-0e9d-4e94-a31c-86f7873e31f2>",
"warc_url": "http://hitchwiki.org/en/Chad"
}
|
cccc_CC-MAIN-2013-20
|
Chad
From Hitchwiki
Jump to: navigation, search
This article is a stub. This means that the information available to us is obviously insufficient. In these places little information is available or the description is severely outdated. If you have been there, whether hitchhiking, for travel or as part of an organized tour − be sure to extend this article!
Chad
Information
Language: French, Arabic
Capital: N'Djamena
Population: 10,300,000
Currency: CFA Franc
Hitchability: (Bad) [Rate!]
Current rating: 2/5 (1 votes)
Your rating:
Cancel
More Info:
Chad is a country in the Sahel, south of Libya, east of Niger and Cameroon, north of the Central African Republic, and west of Sudan. It shares a short border with Nigeria.
Borders
If you came over land via Libya, Niger or Nigeria and you haven't been checked and did't get a stamp in your passport, register yourself in the next prefecture to avoid troubles. You need a travel permit for each prefecture you travel in and a visa before you enter the country.
Dangers
There are landmines in the Tibesti mountains in the north of Chad. There is a high crime rate with road blocks, robbery and kidnapping. If you want to go hitchhiking in Chad, check out additional safety measures. Be careful when you take photos, you need a permission to do this.
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.