id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
226,081 |
Connecting secure, federated clouds with open tool registries, packaging and workflow execution standards will enable analysis workflows to operate on data across national borders. Open repositories and support for good development practice will drive data reproducibility and provenance, which are of high importance in both research and clinical practices. The ELIXIR Implementation Study Deploying Reproducible Containers and Workflows Across Cloud Environments (https://elixir-europe.org/about-us/implementation-studies/containers-workflow-cloud), addresses the need for a stable infrastructure for unifying software container solutions within ELIXIR. This infrastructure will provide an access point for end-users to find, generate, store, monitor and even benchmark software container solutions. Such studies drive collaboration: the technical experts in ELIXIR’s Compute and Tools Platforms will work with developers and researchers in the Galaxy, Metabolomics and Proteomics Communities. In both of these examples, the scale of adoption and participation, as well as the ambition for generating reusable infrastructure across diverse communities is only possible because of the groundwork done over the 5 years.
| 2 | 0biomedical
| 0Study
|
19,996 |
Additionally, we used several recommendations that are quite well known and accepted:Use a very large font type;Use an easy to read font family;Use mixed case;Leave plenty of space;Present few calls to action;Design error messages to be clear;Make it easy to correct input errors;Avoid the use of scroll;Use high contrast between elements of the user interface.
| 1 | 2other
| 1Other
|
62,313 |
Paraffin tissue sections after antigen retrieval or cell cultures on coverslips were incubated with anti-TH antibody (1:500, Millipore #AB318) to determine the number of dopaminergic cells. Briefly, samples were incubated with primary antibody at 4 °C overnight in blocking TBS buffer containing 2% normal serum and 5% BSA. Samples were exposed to secondary antibody conjugated to HRP (Dako) for 1 hr at room temperature, and then HRP’s chromogenic substrate DAB (Dako) added. Color development was monitored and photographed under light microscope. Stained coronal sections and primary cells on coverslips were dehydrated, cleared by xylene, and mounted with Richard-Allan Scientific™ Mounting Medium (ThermoFisher). Four consecutive sections taken from three individual mice in each treatment group were used to quantify the average total number of dopaminergic neurons in SNpc region. Optical intensity after DAB staining of tyrosine hydroxylase in striatum was measured by ImageJ software (http://rsbweb.nih.gov/ij/plugins/track/track.html). Dopaminergic neurons on the coverslips were counted under blinded conditions by two independent observers. Each cell culture treatment was carried out in triplicate with a minimum of three experiments.
| 4 | 0biomedical
| 0Study
|
349,217 |
The morphology of the myocardium was normal in the sham-operated group. However, a few collagen fibers were present around myocardial blood vessels, but no prominent collagen fibers existed in the interstitium. The model group showed hypertrophy and swelling of myocardial cells, hypertrophy, and hyperplasia of adjacent fibrous tissues, significant deposition of collagen fibers around myocardial blood vessels and interstitium, and significantly increased collagen volume fraction compared with the sham-operated group (P < 0.01). Compared with the model group, those mentioned above myocardial pathological changes were aggravated in the 3-MA group, and the volume fraction of myocardial collagen increased (P < 0.01). Besides, the above myocardial pathological changes were reduced, and the volume fraction of myocardial collagen was decreased in the rapamycin and QSYQ groups (P < 0.05 or P < 0.01). Moreover, the high dose of QSYQ has a tendency to further reduce the myocardial collagen volume fraction (Figure 2).
| 4 | 0biomedical
| 0Study
|
76,206 |
Through its Zigbee radio receiver, the base station receives a continuous stream of raw frequency measurements from each installed sensor. The received streams are forwarded by the base station MCU to a USB-connected personal computer for further processing.
| 1 | 2other
| 1Other
|
13,084 |
A GWAS using a mixed linear model with age as a covariate was applied on the previously identified traits (Line AE, line AI, angle 3, angle 7, ratio F-d/BC and L4 + L7). This resulted in the identification of a group of 13 SNPs on CFA15 (BICF2S23761321, BICF2G630435380, BICF2S22961368, BICF2G630437186, BICF2G630437178, BICF2G630437135, BICF2G630437112, BICF2G630437075, BICF2G630437073, BICF2S23311892, BICF2G630437043, BICF2G630437038, BICF2G630437002) associated to ratio F-d/BC under a FDR of 0.05 (all P = 0.03754) and two SNPs on CFA26 (BICF2P174010, BICF2P152116), which were significantly associated to L4 + L7 under a FDR of 0.05 (both P = 0.03754) (Fig. 4 and Table 2).Fig. 4Manhattan plots (top) and QQ plots (bottom) of significant loci obtained by a mixed linear model in traits: ratio F-d/BC (left) and L4 + L7 (right). Two loci on CFA15 and CFA26 were significantly associated to ratio F-d/BC and L4 + L7 respectivelyTable 2Loci significantly associated to ratio F-d/BC and L4 + L7 in the mixed linear modelChrSNPPositionRaw P valueFDR corrected P value15BICF2S2376132128,798,6713.81E-070.03754515BICF2G63043538029,147,0435.87E-070.03754515BICF2S2296136826,586,2231.11E-060.03754515BICF2G63043718626,599,0591.11E-060.03754515BICF2G63043717826,605,6371.11E-060.03754515BICF2G63043713526,619,8451.11E-060.03754515BICF2G63043711226,623,1781.11E-060.03754515BICF2G63043707526,645,3021.11E-060.03754515BICF2G63043707326,645,9691.11E-060.03754515BICF2S2331189226,690,3821.11E-060.03754515BICF2G63043704326,734,7631.11E-060.03754515BICF2G63043703826,738,2481.11E-060.03754515BICF2G63043700226,797,3431.11E-060.03754526BICF2P17401032,735,1285.99E-070.03754526BICF2P15211632,738,2385.99E-070.037545
| 4 | 0biomedical
| 0Study
|
317,205 |
The second highest priority question related to minimum exercise parameters. There is limited evidence of the mode, frequency, intensity, or duration of physical activity required for primary prevention or for post-diagnosis outcomes although considerable progress has been made. Three comprehensive reviews of the epidemiological research 2,3,33 suggested that a dose-response relationship was evident for a few cancer sites, but that it is not yet possible to precisely specify the physical activity variables associated with risk reduction. Similarly, an international consensus statement based on an evidence review of cancer survivorship outcomes 6 was able to include exercise prescription guidance for some outcomes (physical function, fatigue, quality of life, mental health). For other outcomes, the authors highlighted the need for continued research to enable greater precision with exercise recommendations. Identifying optimal exercise prescription variable was proposed as a research priority in Courneya et al.'s discussion of the evidence for physical activity and survivorship in 2015 26. The results of the current study indicate that this question remains one of the most important.
| 4 | 0biomedical
| 2Review
|
26,625 |
Recordings were included in the analysis based on signal quality, xHR(t) stability, duration of the tests and differences in the maximum workload assigned during first (EST1) and second (EST2) assessment. Signal quality was assessed calculating the signal to noise ratio (SNR) on a beat-to-beat basis for each ECG lead, and the 25th percentile of the SNR averaged across leads, SNR25p, was compared to a threshold value (-3 dB) to include or exclude the recording. The instability of the HR profile was quantified as the standard deviation of the first derivative of xHR(t) (expressed in ms), i.e. σ(ΔxRR) = std([xHR(ti)- xHR(ti-1)]-1), and HR profiles were considered too unstable if σ(ΔxRR)>15 ms. HR profile instability, σ(ΔxRR), is high for xHR(t) that show large stepwise changes because of extremely noisy recordings, severe artefacts or a high burden of premature beats, and small when xHR(t) varies smoothly according to physiological processes. Participants who reached their pre-set maximum HR level and terminated earlier were included only if the duration of the tests was longer than T>6 minutes. The absolute difference in the maximum workload between EST1 and EST2, |ΔWL|, should not exceed 10 W. However, further subgroup analyses were also performed for different |ΔWL|.
| 4 | 0biomedical
| 0Study
|
189,283 |
Equation (34) can be re-expressed in the Heisenberg picture (with the time dependence in the operator A rather than the state ρ) as:(35)A˙(t)=i[H(t),A(t)]+∑kLk∗(t)A(t), with the defining relation (36)Tr[ρ(t)A]=Tr[ρA(t)]. The time-dependence of the system Hamiltonian H(t) accounts for the cyclic changes of external conditions caused by the motion of the macroscopic tool. This induces a time-dependence in each of the dissipators Lk(t) that describe the influence of the k-th bath on the working substance. Each bath is assumed to be a large quantum system characterized by inverse temperature βk and chemical potential μk. If the working substance can exchange with the bath (quasi)particles that satisfy a conservation law, the particle number operator N (with [H(t),N]=0) becomes relevant. In such situations, the dissipator Lk(t) drives the system into the equilibrium state (37)ρkeq(t)=Z(t)−1e−βk[H(t)−μkN]withLk(t)ρkeq(t)=0 (i.e., the Gibbs state corresponding to that bath).
| 4 | 0biomedical
| 0Study
|
239,702 |
Dezocine inhibits breast cancer cell viability, colony formation and DNA synthesis. (A) The molecular structure of dezocine. (B) MDA-MB-231, BT549, MDA-MB-468, and MCF7 cells were treated with the indicated concentrations of dezocine for 48 h, and cell viability assays were performed. (C) Representative images of colony formation assays performed with dezocine-treated MDA-MB-231 and BT549 cells, with (D) quantification. (E) DNA synthesis was measured in dezocine-treated MDA-MB-231 and BT549 cells using EdU incorporation assays, with (F) quantification. Percentages of EdU-positive cells out of total cells are shown. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. negative control.
| 4 | 0biomedical
| 0Study
|
82,372 |
Following receipt into the laboratory, each bulk soil sample was held in a freezer at -20°C prior to portioning off into aliquots (with this entire process completed within two hours of receipt of the soils into the laboratory). Note that in this work, the effect of freezing on soil structure was not examined—this would be interesting to explore in future work. Each soil was passed through a 2 mm sieve, to remove any extraneous material not present prior to the detonations (mostly consisting of dried plant matter from the detonation site, likely due to the negative pressure phase from during detonation). As each soil was initially passed through a 2 mm sieve prior to the detonations, this process was not thought to have an effect on subsequent size fraction analyses. The bulk soil samples were then weighed, to determine the percentage soil recovery, before 3 approximately 40 g samples of each soil were portioned off using the cone and quarter method for later size fraction analysis.
| 4 | 0biomedical
| 0Study
|
152,966 |
Multiple DC subsets have been identified in the liver, although their relative abundance differs from that in peripheral blood and secondary lymphoid tissue (17–21). cDC1, cDC2 and pDCs and their functional relevance in the steady-state and liver disease have been reviewed (21). Improved understanding of liver DC heterogeneity and function in mice and humans is required to further elucidate their roles and for design of DC-directed therapeutic intervention in liver injury, transplantation and other liver disorders. Recently, single cell RNA sequencing (seq) analysis has been used to quantify liver DC subsets (cDC1, cDC2 and pDC) and to define signatures of DC-T cell interactions in draining lymph nodes under healthy conditions and in liver disease (22). Mouse liver DC heterogeneity has also been described using cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) (23). The phenotype and function of liver interstitial DCs is influenced by the hepatic microenvironment that promotes their inherent tolerogenicity in the healthy steady-state (24–26). Thus, via their production of macrophage colony-stimulating factor and other soluble and cell-cell contact factors, liver stromal cells induce regulatory cDCs that secrete high levels of IL-10 and nitric oxide (NO), but little IL-12 and inhibit T cell proliferative responses/induce activated T cell apoptosis (24, 27, 28). Exposure to gut-derived pathogen-associated microbial products e.g. bacterial lipopolysaccharide (LPS) inhibits liver cDC or pDC maturation by stimulating IL-6- signal transducer and activator of transcription 3 (STAT3) activity that upregulates expression of interleukin-1 receptor-associated kinase M (IRAK-M), an inhibitor of Toll-like receptor (TLR) signaling (29). This phenomenon, referred to as endotoxin tolerance (30), extends to several TLRs (cross-tolerance), as well as to TLRs and ischemic injury. By contrast, exposure to LPS stimulates secretion of IL-10 and IL-27 by liver cDCs that can then expand regulatory T cells (Tregs) (31, 32).
| 5 | 0biomedical
| 2Review
|
375,225 |
The most frequently reported reasons for not seeking healthcare after exposure to violence were feeling danger on themselves (41.4%), and fear for their children (22.7%), and the violence stopped afterward (12.7%). Fear from the husband and from scandal were mentioned by 8.8% and 8.3% respectively. The reason for not seeking healthcare was not having money constituted only 4.8%.
| 2 | 0biomedical
| 0Study
|
58,100 |
Our study provided evidence that the repeated c-Li3.75(+δ)Si formation/decomposition over cycles, which is typically featured as a major degradation factor in the anode, indeed has an ability to inherently empower the anodes, improving CE and minimizing cumulative irreversible Li consumption. The insights can open up new possibilities for Si-rich anodes with new designs. For example, re-defining the anode/cathode capacity ratio with optimal pre-lithiation dose in the anodes, it might be possible for the anodes to undergo repetitive c-Li3.75(+δ)Si formation/decomposition even in a full cell and consequently in situ deplete the irreversibility in the anode. Importantly, the insight can be applied to not only next-generation Li-ion batteries, but also Li–sulfur and Li-metal batteries with solid/liquid electrolytes.
| 4 | 0biomedical
| 0Study
|
351,393 |
1. This is a highly detailed genomic analysis of recombinational interactions among PVL-encoding prophages in Western Australia (WA), including data indicating that recently imported S. aureus strains with PVL-encoding prophages contributed to the remarkable recent increase in PVL prevalence in WA.
| 5 | 0biomedical
| 0Study
|
13,832 |
In agreement with the definition of adrenal incidentaloma (adrenal mass detected unexpectedly by imaging procedures performed for reasons unrelated to adrenal diseases) patients with severe or resistant hypertension, or paroxysmal hypertension, or hypokaliemia, or clinical signs of hypercortisolism (facial plethora, striae rubrae, easy bruising, proximal muscle weakness) were excluded. Patients with known extra-adrenal malignancies were also excluded from the study. From the overall series of adrenal incidentalomas, only the patients with a presumed cortical adenoma were selected for the study.
| 3 | 0biomedical
| 0Study
|
204,810 |
The ISSE framework was developed using a participatory qualitative research design structured as a four-phase process (Figure 1). The study was conducted according to the ethical principles stated in the Declaration of Helsinki (2013). The ethical approval was obtained by the McGill Institutional Review Board (IRB Study Number A09-E61-16B). Written informed consent was obtained for all study participants before data collection.
| 3 | 0biomedical
| 0Study
|
324,895 |
The increasing replacement of antibiotic-susceptible bacteria (ASB) with antibiotic-resistant bacteria (ARB) is one of the most concern of microbiologists and over the last two decades, antibiotic resistance has increased markedly in Gram-negative bacteria and has determined an improvement of mortality and of healthcare costs .
| 2 | 0biomedical
| 1Other
|
343,350 |
A Beauveria bassiana strain (BB59, hereafter BA) isolated from rhizospheric soil of an apple orchard located in Valle d’Aosta by the company CCS Aosta, (Aosta, Italy), which genomic sequence of ITS region of the ribosome has been deposited in the GenBank database and can be accessed to ID KT932307. The strain is not registered for use as plant protection product.
| 2 | 0biomedical
| 1Other
|
333,754 |
Reviewer #1: The manuscript by Sheweita et al. boldly proclaims to have found the molecular mechanisms of infertility caused by erectile dysfunction drugs. However, I am strongly concerned that they have based this statement purely on the results of poorly performed Western blots as there is no substantial evidence in this manuscript to support the title.
| 1 | 0biomedical
| 1Other
|
88,044 |
The surface morphologies of Fe3O4/biochar supported R. capsulatus were determined by SEM. The amount of PSB cells on Fe3O4/biochar were measured by qPCR assays. Genomic DNA was subsequently extracted using bacterial DNA kit (Omega), following the manufacturer’s instruction. The copy numbers of pufM gene were quantified by real-time qPCR analysis (C1000TM Thermal Cycler equipped with CFX96TM Real-Time system) using primer pufM.557F/750R (Feng et al., 2014). The qPCR standard curve was generated as described by Feng et al. (2011). The 25 μL reaction mixture contained 12.5 μL of SYBR Premix Ex Taq TM, 0.5 μM of each primer, 0.5 μL of BSA at 20 mg/mL initial concentration, and 1.0 μL template containing approximately 2–9 ng DNA. Same procedure was carried out for a blank of using water as the template. The amplicons were confirmed by agarose gel electrophoresis of qPCR amplicons of the pufM gene and the melting curve analysis always resulted in a single peak. Real-time PCR was performed in triplicate, and the high amplification efficiencies of 97.4–104% were obtained with high consistency R2 values of 0.976–0.997.
| 4 | 0biomedical
| 0Study
|
254,884 |
The amount of biofilm was measured by the phenol sulphuric acid method , focusing on the amount of polysaccharide. SSHM was treated by ultrasonic vibration for one minute in small test tubes, then biofilm suspensions were prepared. A total of 0.05 mL 80% (w/w) phenol was added, and 0.5 mL concentrated sulphuric acid was added subsequently on the liquid surface. After 10 min, samples were homogenized and put in 25 °C water for 20 min; absorbance at 490 nm was measured.
| 4 | 0biomedical
| 0Study
|
267,437 |
Besides common outdoor pollutants, such as vehicle fuel burning products, urban pollution, and indoor ventilation system particulate matter, this systematic review also included a wide variety of polluting factors and characteristic aspects of the region, such as charcoal pollution, gold and copper mine pollutants, fertilizer industry pollutants, and grain storage facilities’ effect on exposed workers, petrochemical pollution, as well as sugarcane burning products. The diversity of factors adds rich regional data to the review, but also great heterogeneity in the analysis.
| 4 | 0biomedical
| 2Review
|
376,188 |
Turland noted that in the Excel table he had been sent there were 789 names containing the particles mentioned in the two proposals, this could be verified in IPNI. Of these, 662 names (84%) were written with a single word and 127 (16%) were written with hyphenated particles, in both cases irrespective of the spelling in the original work. If Prop. L were to be accepted, 662 records would have to be changed, while if Prop. K were accepted, only 127 records would be changed. Parra had verified that of the 131 plant names and four fungal names dedicated to Le Testu, 121 were published with a space between the two elements of the epithet and 14 with joined elements where there was no space or hyphen. No epithets were published with a hyphen. Parra had also commented that Prop. K was in accordance with Rec. 60C.5(c), which was what McNeill had been alluding to. Turland thought, after calculating the effect of Prop. L in IPNI, it would be much worse than Prop. K in terms of nomenclatural stability.
| 1 | 2other
| 1Other
|
260,830 |
Estimation of TR can provide insight into the epidemic dynamics of transmission clusters (Oster et al., 2018). Therefore, we calculated the TR of the clusters with sequence number ≥10. The median TR of eight large clusters (01AE1 to 01AE4, 07BC18 to 07BC20, and B23) was 52.4/100 person-years (IQR 49.0-55.1 years), which was 4.8 times higher than that of the general TR level of Shenyang [10.9/100 person-years (Zhang et al., 2018)] and ten times higher than national estimates in 2018 [4.9/100 person-years (NCAIDS et al., 2018)]. Among the eight large clusters, a TDR cluster (07BC20) had the highest TR of 59.6 per 100 person-years ( Table 3 ).
| 4 | 0biomedical
| 0Study
|
79,350 |
The metabolic enhancement in peritoneal tissue-resident macrophages occurs independently of NOX2, but can be initiated with activation of protein kinase C. a Peritoneal tissue-resident macrophage (pTRMØ) uptake of pHrodo zymosan (50 μg/ml) from Ncf1 −/− and WT mice. Data show 3 separate wells per group and was not significantly different by Student’s t-test. b OCR changes in WT and Ncf1 −/− pTRMØ after addition of zymosan or phorbol–myristate–acetate (PMA, 1 μM) at the indicated arrow. The far-right line graph shows an expanded view of Ncf1 −/− data from the middle plot. Data from the WT show n = 3 separate wells per group from one experiment, whereas the Ncf1 −/− shows n = 5 per group from two separate experiments. Both are representative of at least three independent experiments. c The relative total oxygen consumption after addition of atpenin A5 or vehicle control in Ncf1 −/− pTRMØ. Data (n = 5 separate wells per group) represent two independent experiments and were analysed by Student’s t-test. d Graph showing change in OCR after addition of atpenin A5 or vehicle control. Post treatment (Post) is applied 90 min after zymosan addition, pre-treatment occurs before, in the absence of zymosan (Pre). Data (n = 10–12 separate wells per group) were pooled from two independent experiments and were analysed by two-way ANOVA (interaction p < 0.0001) with Sidak’s post-tests. e Quantification of the total oxygen consumption after addition of PMA in the presence of the indicated inhibitors (rotenone = 200 nM). Data (n = 3–6 separate wells per group) represent two independent experiments and were analysed by one-way ANOVA (p < 0.0001) with Tukey’s post-tests. f Graph showing change in OCR after addition of the indicated drugs. Post treatment (Post) is applied 40 min after PMA addition, pre-treatment occurs before, in the absence of PMA (Pre). Data (n = 5–6 separate wells per group) represent two independent experiments. Data were analysed by two-way ANOVA (interaction p < 0.0001) with indicated Sidak’s post-tests. g The protein kinase C inhibitor sotrastaurin (5 μM) or control were added to pTRMØ 30 min before addition of respiratory burst stimulants PMA or zymosan, data are quantified as relative total oxygen consumed post burst stimulants. Data (n = 5 separate wells per group) represent two independent experiments, analysed by two-way ANOVA (interaction p = 0.6854, sotrastaurin p < 0.0001) with indicated Sidak’s post-tests. All error bars denote mean ± SEM
| 4 | 0biomedical
| 0Study
|
300,277 |
Silent information regulator 2 proteins (sirtuins) are highly conserved NAD+-dependent protein deacetylases that participate in multiple pathophysiological processes15. SIRT3 is the most widely studied sirtuin family member, which is mainly located in mitochondria and is extensively involved in the regulation of energy metabolism, oxidative stress, inflammation, apoptosis and autophagy16,17. Increasing evidence has established that SIRT3 is involved in the regulation of mitochondrial fission and fusion. SIRT3 could suppress mitochondrial fission by inhibiting the expression of Fis1 and promoting the expression and activation of OPA118–20. Moreover, SIRT3 was proven to inhibit mitochondrial fission induced by oxidative stress in NP cells21. However, whether SIRT3 regulates the compression-induced imbalance of mitochondrial fission and fusion in NP cells remains unclear.
| 4 | 0biomedical
| 0Study
|
87,248 |
Counting tests for 10 μm polystyrene beads using the three measurement methods demonstrated the counting performance of the NaviCell (Figure 3b). The bead concentration was measured as 1.6 × 106 cells/mL using the hemocytometer, after which the samples with different concentrations were prepared by serial dilutions. As the measured R2 values of the trend lines for the three methods were 0.995 or more, it was first confirmed that all three measuring instruments were suitable counting instruments. The standard deviation (SD) values measured using the NaviCell were the smallest among the three measurement instruments. For example, when the bead concentration was 1.60 × 106 cells/mL, the SD values of concentration were 1.19 × 105 cells/mL, 1.01 × 105 cells/mL and 0.48 × 105 cells/mL measured by the hemocytometer, the commercial cell counter and the NaviCell, respectively. Since no optical lenses were installed in the proposed cell analyzer, it is possible to obtain a wider range of FOV than conventional cell counters based on microscopy. Based on the bead counting results, it is more likely that the wide FOV can contribute to the enhanced SD between the measurement results. The NaviCell has a detection range of 104–106 cells/mL (see Supporting Information (Figure S1)).
| 4 | 0biomedical
| 0Study
|
319,166 |
Interestingly, we recapitulated most of the regulatory features previously linked to expression noise in single‐cell experiments (Boettiger & Levine, 2009; Perry et al, 2010; Ravarani et al, 2016; Faure et al, 2017; Morgan & Marioni, 2018; preprint: Schmiedel et al, 2017), despite the fact that the composition of variation sources is very different between bulk and single‐cell experiments. A number of studies have proposed that robustness to stochastic noise and robustness to environmental and genetic variation are highly correlated (Ciliberti et al, 2007; Lehner, 2008; Kaneko, 2011). In line with this hypothesis, expression variation in bulk is predictive of single‐cell noise in yeast (Dong et al, 2011) and gene expression variation across individuals in human tissue samples correlates with promoter strength and multiple epigenetic features (Alemu et al, 2014). Indeed, genes that have evolved mechanisms to buffer stochastic variation in the levels of their expression may also be insensitive to non‐stochastic changes, including genetic and environmental variation, as the same mechanisms would constrain them both (Lehner, 2008).
| 4 | 0biomedical
| 0Study
|
255,616 |
Figure 4—figure supplement 2.Molecular dynamics (MD) simulations of GIPR in complex with GLP-1 and glucagon.(A) Left, comparison of peptide binding between simulation snapshots of GLP-1–GIPR and the cryo-EM structure of GIP–GIPR–Gs complex. ECD and G protein are omitted for clarity. Right top, extracellular view of the interaction between peptide and TMD. Right bottom, the buried surface area between GLP-1 and GIPR. (B) Left, comparison of peptide binding between simulation snapshots of glucagon–GIPR and the cryo-EM structure of GIP–GIPR–Gs complex. ECD and G protein are omitted for clarity. Right top, extracellular view of the interaction between peptide and TMD. Right bottom, the buried surface area between glucagon and GIPR. Interface areas were calculated using freeSASA (Zhang et al., 2020).
| 4 | 0biomedical
| 0Study
|
384,440 |
There are multiple key-generation, or generated-secret (GS), and key-binding, or chosen-secret (CS), methods to reconstruct secret keys from noisy PUF outputs, where the key is generated from the PUF outputs or bound to them, respectively. Code-offset fuzzy extractors are examples of key-generation methods and the fuzzy commitment scheme is a key-binding method. Code constructions based on Wyner-Ziv (WZ) coding are illustrated in to asymptotically achieve the information-theoretic limits for the GS and CS models. These constructions might have high complexity, which is undesired for, e.g., IoT applications. In addition, since a key should be stored in a secure database for both models, it is more practical to allow a trusted entity to choose the secret key bound to a PUF output. Thus, in this paper, we aim at further improving reliability, privacy, secrecy, and hardware cost performance of a transform-coding algorithm, explained next, that is applied to PUF outputs in combination with the fuzzy commitment scheme.
| 4 | 2other
| 0Study
|
287,247 |
Overall structure of Tmm7211. (A) Two monomers of Tmm7211 arranged as a dimer in an asymmetric unit. The monomers are colored in magenta and orange, respectively. (B) The overall structure of Tmm7211 monomer. Tmm7211 contains an NADPH binding domain (colored in orange) and a FAD binding domain (colored in magenta) connected through two hinge regions (colored in cyan). The NADP+ molecule and the FAD molecule are shown as sticks colored in green and yellow, respectively. (C) Gel filtration analysis of Tmm7211. Inset, semilog plot of the molecular mass of all standards used vs. their Kav values (black squares). The red arrow indicates the position of the Kav value of Tmm7211 (0.48) interpolated in the regression line. Tmm7211 monomer has a calculated molecular mass of 52 kDa. The apparent molecular mass of Tmm7211 is 95 kDa, indicating that Tmm7211 is a dimer in solution.
| 4 | 0biomedical
| 0Study
|
43,778 |
Methodological workflow of the directed rank product analysis (DiRank). This new method aims to identify genes with similar expression profile to a theoretical or observed profile of another gene. Gene expression values and profiles (geps) (shown in blue) and custom profile (cp) (shown in red), consisting of relative rank values, serve as input (yellow boxes). In rectangular matrices, gene expression values are reported in rows, while columns represent the transcriptome datasets. A custom profile can either be a user-defined profile or an existing gene expression profile. The directed rank product analysis aims to identify genes with a similar expression profile to the custom profile and to assign associated p-values. The custom profile is subtracted from each of the gene expression profiles and each difference (gep - cp) is transformed by 1 -| gep - cp|. Transformed gene expression values and corresponding profiles are shown in green in the grey box. These transformed gene expression values are then used as input data for a rank product analysis. As an example, the transformed gene expression values surrounded by an orange frame are ranked on top by the rank product analysis as the original gene expression profile was the most similar (before transformation) to the custom profile
| 4 | 0biomedical
| 0Study
|
311,508 |
Hence, in vivo observations were consistent with simulation predictions that filopodia speed up the collective decision-making process. Likewise, tip cells were slower to emerge from the DA and lead ISV branches (figure 2f), in keeping with the time ordering of events predicted in the simulations, whereby (i) Vegfr is initially activated in many cells in response to Vegf before (ii) slower commitment to tip identity and behaviour defined by filopodia-regulated Dll4-Notch lateral inhibition. Hence, filopodia may influence the speed of tip cell selection to ensure blood vessel branching occurs within the precise time constraints of the developing tissue.
| 4 | 0biomedical
| 0Study
|
385,582 |
These findings have suggest an important role of environmental selection processes that lead to biogeographic distribution patterns of soil bacterial communities. Biogeographic patterns may result from stochastic factors, environmental filtering, and dispersal (Hanson et al., 2012). A well-studied biogeographic distribution pattern of macro- as well as microorganisms has been referred to as the distance-decay relationship, which assumes that with increasing geographic distance communities become more dissimilar (Hanson et al., 2012). Distance-decay relationships have been found for bacterial communities at a regional scale, for instance across France (Chemidlin Prévost-Bouré et al., 2014), in the state of New York (Barnett et al., 2019) and in Northern China (Feng et al., 2019). However, it is unclear whether the distance-decay relationship is also important for the biogeographic distribution of soil bacterial communities across the complex alpine landscape of Switzerland, which encompasses a relatively small but highly structured area of 41,285 km2.
| 4 | 0biomedical
| 0Study
|
70,472 |
We initiated this study using 2-naphthol, which has a pKa value of 9.63 and shows a red-shifted emission maximum with pH change from acidic to basic (357 to 409 nm).18 The spectral red-shift under basic conditions can be attribute to an enhanced ICT process due to the stronger electron donating ability of the deprotonated form (O–) than the OH (σ+ = –2.3 for O–vs. –0.92 for OH) (Scheme 1).19 We anticipated that the pKa value of 2-naphthol derivatives could be optimized to the mitochondrial pH by employing an electron withdrawing group and extended π-conjugated system. These translations would stabilize the conjugated base (O–), giving a lower pKa value than that of 2-naphthol, along with emission ratiometric character. Therefore, we firstly prepared compound 1 containing a benzothiazolyl electron withdrawing group (Scheme 1). Benzochromene-2-one derivative (2) was also synthesized as a linear π-conjugating system with the expectation of more effective ICT than 1.14b The synthetic route for these compounds is described in the ESI.†
| 4 | 0biomedical
| 0Study
|
119,415 |
Orthologous clustering demonstrated that the ant-infecting fungi sequenced in this study share general processes with other ascomycetes. These processes include transcription, translation, protein transport and signal transduction. However, a significant number of signal peptide-containing genes were not shared. These secreted proteins comprised a significant number of small secreted, potentially bioactive, proteins, and enterotoxins. These enterotoxins have largely been reported as bacterial toxins23–25, and have previously only been mentioned for a hand full of fungal species regarding their presence in the genome but without a discussed function18,22,31–34. The vast majority of the orthologous clusters that were specific for the five ant-manipulating species were also not shared across them. In fact, a significant part of the secretome appeared specific for each individual Ophiocordyceps species. Yet, the majority of the candidate manipulation genes, identified through RNA-Seq, were not unique to O. kimflemingiae nor to ant-infecting Ophiocordyceps species. They generally shared orthologs with at least one other ascomycete in this study. This suggests that the genes up-regulated during manipulated biting behavior in O. kimflemingiae, are largely not completely unique to that species. This could mean that these fungi do not use an exclusive set of novel genes to establish the respective complex behaviors observed. Instead, a variety of combinations of genes that are also found in other ascomycetes could be employed. The fungi sequenced in this study were collected on different continents where they induced different (levels of) manipulations (e.g. biting is present or absent) in different ant species. Their strategies at the genetic level could thus be very different as well. Alternatively, sampling during established biting behavior might not give us the correct pool of candidate manipulation genes. We found that a significant number of putatively secreted proteins are unique to the ant-manipulating fungi in this study. These proteins are however not significantly represented in the analyses regarding the candidate manipulation genes. It could be that we are missing out on many of the true candidates when we are sampling at the time when biting is already established. A better insight may be obtained by sampling during the time leading up to this event. This however demands that the suite of subtler behavioral changes leading up to the ultimate biting event is better quantified first.
| 5 | 0biomedical
| 0Study
|
147,565 |
For ChIP-Seq analysis, Fastqc was used for raw data quality control. Cutadapt was used to remove law quality bases and library adaptor contamination (cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -m 20). After quality control and data filtering, data were mapped to human reference genome hg19 using Bowtie2. Samtools was used to sort BAM file and filter duplicate reads. Only unique mapped reads were accepted for further analysis. MACS2 was used for ChIP-Seq peaks calling with p value cut-off 1e−10. Then HOMER annotatePeaks.pl was used to annotate ChIP-seq peaks compare to reference genome hg19.
| 4 | 0biomedical
| 0Study
|
317,652 |
HLI was associated with an increase in TUNEL+ apoptotic cell (Fig. 3A,C) and endothelial cell counts (Fig. 3B,D) in the gastrocnemius muscle, which was significantly higher in KO mice by 154% and 446% respectively, compared to WT mice (Fig. 3A,C). In addition, the severity of fibrosis following HLI was amplified in KO mice compared to WT mice (Fig. 3E,F).Figure 3Deficiency of endogenous ghrelin promotes apoptosis and fibrosis after hind limb ischemia. (A) Representative images of TUNEL-positive myocytes and (B) endothelial cells in the ischemic gastrocnemius muscle, 14 days post-HLI (C) Quantification of TUNEL-positive myocytes and (D) endothelial cells represented per mm2 (n = 4–5). Scale bars = 50 μm (Inset scale bar = 25 µm). (E) Representative histological images of Masson’s trichrome staining in the ischemic gastrocnemius muscle of WT and KO mice 14 days post-HLI. (F) Quantification of gastrocnemius muscle fibrosis (n = 5–6). Scale bars = 200 μm. Data are presented as mean ± S.E.M. Statistical comparisons were made by using a two-tailed unpaired Mann–Whitney U test (C,D,F). *Significantly different from WT counterpart (***P < 0.001).
| 4 | 0biomedical
| 0Study
|
156,830 |
Paraffin-embedded human NP tissue slices (4 μm thick) were dewaxed in the conventional manner and subsequently subjected to antigen retrieval under both high temperature and high pressure with a citric acid-salt solution. After successive incubation with avidin and d-biotin, the endogenous peroxidase activity of the slices was inactivated with the addition of H2O2 for 15 min. Following blocking with 10% goat serum, the slices were probed at 4°C overnight using diluted rabbit monoclonal antibody against Ang-2 (ab8452, 1 : 200, Abcam, Cambridge, UK) and then probed at ambient temperature for 10 min with the biotin-labeled goat anti-rabbit IgG secondary antibody (ab6721, 1 : 1,000, Abcam). Subsequently, after incubation with streptomycin avidin-peroxidase solution, the slices were stained with freshly prepared diaminobenzidine (DAB) (ZSGB-BIO, Beijing, China), followed by hematoxylin counter-staining. Finally, after gradient alcohol dehydration, xylene clearing, and neutral balsam sealing, the slices were submitted to microscopical observation.
| 5 | 0biomedical
| 0Study
|
345,714 |
The 2018 trial compared the effects of Mb7-GFP by premix soil application to those by topsoil application. The results had only preliminary relevance in addressing the most efficient mode of application for the 2019 trial, because of the few replicates got at the end of the trial (many potted plants did not survive before larval release). Neonates were observed moving toward the rootstocks and penetrating the soil within 5–10 min after their release in both assayed modes of fungal application.
| 3 | 0biomedical
| 0Study
|
188,055 |
The skin homogenates were prepared using a lysis buffer (Tissue Extraction Reagent I, Thermo Fisher Scientific, Waltham, MA, USA) and centrifuged (10,000× g, 20 min) for supernatant collection. The levels of the following cytokines in the cultured supernatants from BV2 cells were assessed using commercial ELISA kits following the manufacturer’s instructions: TNF-α, IFN-γ, IL-17, and IL-22 in the skin samples; CORT in the serum samples; IL-1β, IL-6, and TNF-α in the PFC samples; IL-6, MIP-3α, IP-10, and ICAM-1 in the cultured supernatants from the HaCaT cells; TNF-α and IL-1β. The human IL-6, IP-10/CXCL10, and ICAM-1, and mouse TNF-α, IL-1β, IL-6, IFN-γ, IL-17, and IL-22 ELISA kits were obtained from LABISKOMA (Seoul, Korea). The mouse CORT ELISA kit was obtained from Arigo (Hsinchu, Taiwan, China). The human MIP-3α/CCL20 ELISA kit was purchased from R&D Systems (Minneapolis, MN, USA). The optical density at 450–550 nm was determined using a microplate reader (Tecan, Männedorf, Switzerland).
| 4 | 0biomedical
| 0Study
|
169,167 |
We established a novel xenograft model of human bone and demonstrated the osteogenic effects of AKDS001 on human cells and human bone in vivo (Figure 9). The mode of new bone formation by AKDS001 MS was minimodeling in which the volume of grafted bone is preserved (Figure 9). The combined use of an EP4 agonist and autogenous bone (biologically enhanced autograft) may be a novel option for bone grafting surgery. However, we should be careful in interpreting the results because the results because male xenografts were implanted in male rats in the present study. It remains to be seen whether females can benefit from the positive effects of AKDS001 MS by using female xenografts implanted in female rats in clinically relevant animal models.
| 4 | 0biomedical
| 0Study
|
201,942 |
Mice were anesthetized with CO2, rapidly decapitated, and the head split along the cranial midline. Septal tissue was removed to expose olfactory turbinates. Vapor-phase odors were delivered by a pressurized nitrogen line connected to a sealed 100 ml glass bottle and directly injected into a continuous stream of humidified carbogen flowing over the tissue. Odorants were prepared by diluting pure stock into deionized water and final working concentration calculated as a molar value (v/v). Responses to odors were recorded with a standard glass micropipette tip-filled with agarose and backfilled with PBS using a Multiclamp 700A amplifier controlled by Multiclamp 700A and Clampex 9.2 software (Molecular Devices). EOG was measured as the maximal peak amplitude from the pre-pulse baseline using Clampfit 9.2 software (Molecular Devices).
| 4 | 0biomedical
| 0Study
|
389,203 |
Techniques for automated QC have been previously proposed, such as motion artefact detection in brain magnetic resonance imaging (20), image quality evaluation in fetal (21) and cardiac (22) ultrasound, and detection of missing slices (23), off-axis planning (24), or segmentation errors (25) in CMR. So far, these techniques have been aimed at a single source of error and lack a generalized QC of the output based on clinical criteria. Robinson et al. (25) proposed a method to obtain segmentation quality scores for SAX segmentations from previous ratings in a large cohort of CMR segmentations. Obtaining quality scores from segmentations using this method, or other techniques that include uncertainty into segmentation networks, can complement our framework to further improve the quality of automated CMR analysis.
| 4 | 0biomedical
| 0Study
|
30,125 |
In 2014, the World Health Organization reported that the number of visually impaired individuals was estimated to be approximately 285 million worldwide . Many of them use white canes to detect obstacles ahead of them, but the detection ranges are short. Guide dogs are also used for navigation, but they need long training periods and large budgets. Therefore, it is necessary to build assistive systems to help the visually impaired.
| 1 | 0biomedical
| 1Other
|
364,267 |
To the C-terminal end (N-terminal end) of the linkers fuse the N-terminus (or C-terminus) of a target viral or bacterial surface antigenic protein (or antigenic protein part), in such a way that the antigenic surface (the epitope) points into solvent space. Of course, a prior condition is that the atomic structure of the antigenic protein is known.
| 4 | 0biomedical
| 1Other
|
186,079 |
1H NMR and 13C NMR measurements were performed on a Varian Infinity 400 MHz spectrometer fitted with a 9.4 T magnetic field (URJC, Móstoles, Spain). Chemical shifts (δ) are shown in ppm and they were externally referenced to tetramethylsilane. Mass measurements were performed on an ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-HESI-MS/MS) using VIP heated electrospray ionization interface (Bruker UHPLC/MSMS EVOQ™ ELITE) with a triple-quadrupole detector (URJC, Móstoles, Spain).
| 4 | 0biomedical
| 0Study
|
104,386 |
The pairwise Pearson correlation coefficient between mRNA and miRNA expression was calculated based on 17,300 mRNAs and 612 miRNAs, yielding a correlation coefficient data matrix with 17,300 mRNAs in row and 612 miRNAs in columns. A Pearson correlation coefficient less than −0.5 was used as a cutoff to obtain the most probable biologically relevant miRNA-mRNA regulations. Data preprocessing and Pearson correlation coefficient calculation were performed in the R (https://www.r-project.org/) environment with its “base” function and “stat” packages. χ2 test was used to determine the correlation of miR-200c and clinical features.
| 4 | 0biomedical
| 0Study
|
72,932 |
Surprisingly, the induced itinerancy also increases the NC ordering temperature even without OO in CoV2O4. As shown in Fig. 1, T NC significantly increases in CoV2O4 (75 K) compared to MnV2O4 (57 K). Although it exhibits the higher NC ordering temperature, CoV2O4 also exhibits glassy behavior9,19. While the reduced SIA and induced isotropies foster frustration23, the enhanced exchange interaction relieves the frustration and enhances the ordering temperatures. In the series of Mn1−xCoxV2O4, the spin-wave gap (~2 meV) remains relatively unchanged with Co-doping (x)24 despite the enhanced magnetic ordering temperatures proportional to J A−V. Since the spin-wave gap is proportional to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\sqrt{{D}_{{\rm{V}}}\times {J}_{{\rm{A}}-{\rm{V}}}}$$\end{document}DV×JA−V, the increase in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$|{J}_{{\rm{A}}-{\rm{V}}}|$$\end{document}|JA−V| is compensated by the reduction in the anisotropy D v in CoV2O4. By enhancing both competing effects (itinerancy-driven isotropies with reduced SIA and strengthened exchange), Co doping can foster various novel states in CoV2O4.
| 5 | 0biomedical
| 0Study
|
122,243 |
Euseius nicholsi (Ehara et Lee) (= Amblyseius [Amblyseius] nicholsi) (Acari: Phytoseiidae) is an important indigenous predator of several species of pest mites and insects in China, and has been successfully employed for reducing populations of T. urticae on various crops, such as strawberry and kidney bean (Chen et al. 1994, 1996; Zheng and Jin 2008; Hu et al. 2007). Its control efficiency on pest mites, however, is somewhat limited because the predatory mite prefers to prey on the egg and larval stages of the mites (Chen et al. 1994; Hu et al. 2007).
| 2 | 2other
| 1Other
|
216,498 |
The livestock breeding environment monitoring system is designed based on a variety of existing mature technologies, such as database technology, remote communication technology, sensor technology, and computer technology. Therefore, from an overall perspective, the entire system has the characteristics of complexity and comprehensiveness. The whole system consists of three parts, namely, environmental monitoring communication networking equipment, data collection system, and remote reading system. The data collection system has functional modules such as visual report definition, audit relationship definition, report approval and release, data reporting, data preprocessing, data review, and comprehensive query statistics. The specific framework is shown in Figure 1.
| 2 | 2other
| 1Other
|
98,798 |
For the aerial plant tissues, WT Arabidopsis seeds were sown in vitro on MS medium (until 22 days) or in artificial soil (Jiffy-7, 44 mm Ø). The Arabidopsis plants grown in artificial soil were watered regularly and fertilizer was added once after 25 days. Whole plantlets were collected at 6, 15, and 22 days after sowing. Rosette leaves from at least five plants were harvested and pooled after 31 days. After 39 and 54 days, rosette leaves, cauline leaves, stems and flowers from at least five plants were sampled and pooled. For the root samples, WT Arabidopsis seeds were sown in expanded clay granules (Ø < 4 mm). The plants were watered regularly and fertilizer was added once per week. Root samples from at least 20 plants were collected and pooled after 34, 46, and 59 days. All samples were immediately frozen in liquid nitrogen and stored at -80°C prior to RNA extraction. Two biological replicates were performed and analyzed, each with two technical replicates.
| 4 | 0biomedical
| 0Study
|
234,477 |
While it is possible to observe cross-linking events through the mechanical tests, FTIR analysis is not sensitive enough to detect their occurrence. The signals of the -CH2- and -CH3 groups are not modified, as highlighted in Figure 8: at 2916 and 2848 cm−1 for the asymmetric and symmetric stretching vibrations of the -CH2- group, respectively. The bands at 1474 and 730 cm−1 correspond to the crystalline phase and the bands at 1464 and 720 cm−1 correspond to the amorphous phase . The intensity and location of these specific crystallinity bands do not vary with respect to dose, therefore, the impact of γ-irradiation on the crystallinity of the EVA/EVOH/EVA film is not large enough to be detected by FTIR.
| 4 | 0biomedical
| 0Study
|
373,751 |
The best hits of Hodges et al. showed higher affinity and demonstrated a robust biphasic deactivation of the ERK pathway. Low micromolar (10–30 μM) treatment with compounds (42, 64) increased RAS-GTP levels linearly, while pERK levels showed increase at up to 1 μM compound concentration and decrease at higher compound concentration. However, it has not been assessed whether the compounds have an effect on cell viability .
| 4 | 0biomedical
| 0Study
|
360,257 |
The pilot test was conducted beside the Al-Jubail Desalination Plant, in the Arabian Gulf. The seawater of Al-Jubail has higher Total Dissolved Solids (TDS) and water temperature than the seawater in other areas. Thus, a high risk of membrane fouling is assumed. The membrane cleaning (Clean in place; CIP) interval based on differential pressure increase was 1.5 months as a past record for a spiral RO membrane .
| 2 | 2other
| 0Study
|
189,420 |
Rheumatic fever is a prevalent disease, mainly in low- and middle-income countries but also in specific populations in developed countries. Data on the prevalence of rheumatic fever are probably underreported due to (a) the cost of screening, (b) difficulties in acute rheumatic disease diagnosis and (c) data on surgery or mortality representing rheumatic fever incidence from 2 decades ago. Chronic valvular heart disease is the most feared consequence of rheumatic fever, leading to a decreased quality of life, hospitalizations, and surgical procedures, primarily in young adults (1–5).
| 4 | 0biomedical
| 2Review
|
13,272 |
Mastitis is an inflammatory response of the udder to infection (usually bacteria) with detrimental consequences to animal well-being and milk quantity and quality [1–3]. It has been estimated that the cost of mastitis in the US dairy industry is ca. $2 billion annually or 11% of total U.S. milk sales, with an average of ca. $179/cow [4, 5].
| 4 | 0biomedical
| 0Study
|
361,468 |
To give a comprehensive understanding of aesthetic appreciation in computational neuroaesthetics, one challenge is to measure the dynamic information flow between precise brain regions during aesthetic appreciation. Aesthetic appreciation is influenced by multi-factors, including sensory attributes of visual objects such as complexity and symmetry, the way features of visual objects are represented in our perceptual system, context and embodiment of visual objects in our cognitive system, external context, internal state, top–down expectation, etc. [69, 112–116]. These factors alter connectivity between brain regions in the three neural systems during different processing stages of aesthetic appreciation.
| 4 | 0biomedical
| 0Study
|
240,706 |
Adhesion inhibitors are a promising, but yet underexplored option to prevent or eliminate S. aureus colonization. The microscopy-based screening presented here is a powerful method to identify and test new S. aureus adhesion inhibitors. Our adhesion assay works with unlabeled bacteria and eukaryotic cells, which offers the possibility to use unmodified wild type bacterial strains and to capture any influences of the test compounds on the morphology of the eukaryotic cells in the initial screening campaign. Hence, it allows the rapid exclusion of compounds that exert their effect mainly through toxic effects on the eukaryotic cells. Importantly, this approach can be applied to other settings where the adhesion of pathogens to epithelial cells or eukaryotic cells in general is of interest.
| 4 | 0biomedical
| 0Study
|
216,431 |
A widely used anti-diabetic drug metformin improves insulin sensitivity and glucose homeostasis, and at the same time reduces endothelial dysfunction and thereby cardiovascular risks in diabetic patients . Metformin is well known to activate AMPK in different tissues in humans and rodents . The effects of metformin on endothelial function are largely mediated through AMPK and PPARδ with a subsequent alleviation of ER stress and oxidative stress as well as increased eNOS activity and NO production, highlighting the central role of PPARδ downstream of AMPK activation to combat against diabetes- and obesity-related vasculopathy, inflammation and hypertension . Likewise, exercise is known to activate AMPK and is found to ameliorate ER stress and endothelial dysfunction in diabetes through PPARδ . These findings imply a close linkage between ER stress and vascular dysfunction in diabetes modulated by AMPK and PPARδ.
| 4 | 0biomedical
| 0Study
|
88,704 |
Bacterial community composition at family level classification for each of the different treatments over the 6 week incubation period that the roller-bottle experiments were run. SW, seawater; SW+N, seawater with nutrients; SW+D, seawater with dispersant; WAF, water-accomodated fraction; CEWAF, chemically enhanced WAF; CEWAF+N, chemically enhanced WAF with nutrients.
| 3 | 0biomedical
| 0Study
|
136,643 |
Several GvHD prophylaxis regimens with comparable clinical efficacy are commonly used. These regimens are often based on local experience and take preexisting co-morbidity, which frequently occurs in IEI patients, into consideration. Therefore, we recommend to use GvHD prophylaxis with a calcineurin inhibitor plus a second agent (MTX or MMF) in accordance with institutional guidelines for unmanipulated grafts. In case unmanipulated PBSC are used from MUD, higher rates of cGVHD can be expected and prolonged GvHD prophylaxis may be considered. In mismatched family (MMFD) and MMUD, graft manipulation (either ex vivo or in vivo) should be strongly considered depending on the degree of mismatch, to limit the risk for GvHD, using the TCR α/β depletion or PT-Cy approach, respectively (vide infra).
| 4 | 0biomedical
| 1Other
|
28,938 |
Obvious warming in the Tienshan Mountains was detected at a rate of 0.3 °C/10a. Spatially, temperatures rose fastest in Middle and East Tienshan Mountains, at a rate of 0.45 °C/10a, while only slightly increasing in West Tienshan Mountains (Fig. 1b,d). Seasonally, temperatures increased more quickly in winter and spring than in summer (Fig. 1f).
| 1 | 2other
| 0Study
|
40,838 |
This empirical rule was developed by Baldacci in northern Italy . The rule is called 3-10 because it assumes that primary infections are likely to happen when the following conditions occur simultaneously: air temperature is equal or higher than 10 °C, vine shoots are at least 10 cm long, and at least 10 mm of continuous rain has fallen during the previous 24–48 h.
| 1 | 2other
| 1Other
|
213,618 |
When the parameters of drug distribution, such as the apparent volume of distribution with respect to bioavailability (V/F), where the administration was oral, were compared, the value for coumarins was 0.802 mg·(μg/mL)−1, which was less than the value obtained with sphaeralcic acid mg·(μg/mL)−1. Thus, for the total apparent clearance regarding bioavailability (CL/F) after oral administration of the drug, the value for sphaeralcic acid was two times higher than what was calculated for coumarins. Sphaeralcic acid reaches a Cmax of 10.45 μg/mL at 4.00 min, and the coumarins have a Cmax of 3.77 μg/mL at 3.23 min. The latter was measured by the AUC of plasma concentrations (AUC0, ∞ and AUC0, 240), reflecting the total amount of the drug reaching the systemic circulation, the and Main Residence Time (MRT) was very similar for both sphaeralcic (40.17 min) acid and the coumarin mix (41.40 min).
| 4 | 0biomedical
| 0Study
|
152,222 |
Having appreciated the positive impact of improving dialysis adequacy on many clinical and biochemical data of patients [6, 48], one would expect welcome effects on the quality of life. In the present research, the quality of life variables were compared among the three groups. These variables were also compared before and after improving dialysis adequacy in group C. All the subscales of the physical domain, except role limitations due to physical function impairment, were found to be significantly low in group C. These low scores were parallel to results reported in similar studies [49, 50]. Work status was significantly higher in group C (p = 0.003 but post hoc analysis didn’t show significance between groups). When Work status was correlated to Kt/v (controlled to PTH, hemoglobin), it didn’t show any significance (r = − 0.168, p = 0.068). We were not astonished by this non- significant correlation as this subscale was already higher (better) in group C (lowest Kt/v) than the other 2 groups and improving Kt/v wouldn’t render a significant change in this group.
| 4 | 0biomedical
| 0Study
|
90,308 |
It was not possible to deduce the relative contribution of ScpA adhesion to pathogenesis in a human system, albeit that ScpA conferred adhesion to human and murine cells. The discrepancy in rates of ScpA-mediated cleavage of human and murine complement factors (Fig 3, S8A and S8B Fig) and the smaller reduction in murine C3 (Fig 6A) compared with human C3 (Fig 4A) deposited on the GAS-M1 surface raised the possibility that, in human disease, the impact of complement cleavage may be of greater importance than adhesion. Our study highlights the multi-functional mechanisms by which ScpA is able to promote bacterial invasion, through a combination of factors including adhesion and active inactivation of the innate immune response.
| 4 | 0biomedical
| 0Study
|
252,311 |
Within the GAW clade, some tropical/subtropical (rarely temperate) woody liana/tree species, formerly belonging to Millettieae s.l., clustered with the temperate herbaceous Glycyrrhiza-Glycyrrhizopsis clade (Compton et al. 2019; Duan et al. 2020, 2021; also see Fig. 2). Recently, Compton et al. (2019) and Duan et al. (2021) assigned the above-mentioned liana/tree group into two non-sister clades: genus Adinobotrys and tribe Wisterieae (14 genera), corroborated by our cpCDSs trees (Fig. 2). Herein, we propose a monogeneric tribe Adinobotryeae based on Adinobotrys, and resurrect the tribe Glycyrrhizeae corresponding to the Glycyrrhiza-Glycyrrhizopsis clade (see Taxonomic Treatment) for the following reasons:
| 5 | 0biomedical
| 0Study
|
306,049 |
The prevalence of antimicrobial resistant bacteria could be an indicator of the antimicrobial treatment of fish. This study proves such a statement, as we detected the most resistance to tetracyclines after oxytetracycline was used for the treatment of the fish.
| 2 | 0biomedical
| 0Study
|
215,236 |
Given advances in healthcare, more children are surviving illness and disability than in years past . These children represent considerable diversity racially, ethnically, and in the heterogeneity of their health-related needs . Promising research suggests that while chronic illness represents a challenge, it does not prevent children from living fulfilling lives. For example, Blackwell et al. examined data from three cohort studies and determined life satisfaction was comparable between those with and without chronic illness. The authors concluded that: “chronic illnesses…do not preclude children from leading happy and satisfying lives” [1(p6)].
| 3 | 0biomedical
| 2Review
|
231,649 |
Aside from the intrinsic limitations associated with the use of short-forms (these tests are not suitable for diagnostic or specific classification purposes; Van Ool et al., 2018), the main constraint of the present study is the small sample size. This limitation is due to the fact that we included only the most vulnerable preterm children (the very preterms) which limits the generalizability of the results to a broader population of preterm children. Further research may seek to replicate and extend these findings in larger samples of preterm children, including moderate to late preterms.
| 4 | 0biomedical
| 0Study
|
123,032 |
Inflammatory mediators are often highly expressed in a tumor microenvironment. It is now very known that chronic inflammation participates enormously in tumorigenesis. Tumor-derived molecules are responsible for the activation of inflammatory cells like macrophages and fibroblasts. Macrophages in the tumor microenvironment come from the differentiation tumor-resident macrophages and from monocytes recruited from blood vessels. The differentiated macrophages are then polarized in tumor-associated macrophages. There are two known phenotypes for TAMs, which are M1 macrophages (pro-inflammatory macrophages) and M2 macrophages (anti-inflammatory macrophages) . As for cancer-associated fibroblasts, they are obtained from normal fibroblasts already present in the tissue. The CAFs acquire specific characteristics similar to myofibroblasts. Both TAMs and CAFs are the most present cells in the tumor microenvironment. Various studies have highlighted how both cells play a crucial role in tumor ignition, progression, evasion, and resistance to chemotherapy .
| 4 | 0biomedical
| 0Study
|
80,414 |
In this study, the survey year (period) is beginning to have a significant effect on the chances of a physician’s geographical movement. The survey year is affected by historical and environmental contexts, and also affects each physician equally. Given this result, future human resource policies aimed at the geographic induction of physicians may not need to differentiate according to the registration year (cohort) of physicians. Regarding the effects of age on the movement of physicians, there is a greater tendency for younger physicians to relocate. Why is the effect of period on the geographical movement of physicians increasing? Based on the data that we used, it is impossible to directly ascertain the reasons for the geographic movement of physicians. However, we can present some possible explanations. For example, the aging of physicians explains their movement, as shown by the APC model, and the aging of the population has effects from the demand side. Japan’s population has been gradually aging, with 27% of the population over age 65 in 2017. Population aging seems to appear as the effect of period in the APC model by increasing the demand for healthcare services. Furthermore, developments in transportation networks and similar lifestyle preferences, such as work and living locations, may have influenced the geographical movement of physicians. These potential factors are all related to social environment. In other words, those factors are expressed as the effect of period in the APC model.
| 4 | 0biomedical
| 0Study
|
38,306 |
A recent study identified a weak atrad51 allele, atrad51-2 , with a T-DNA insertion in the 3′-untranslated region (UTR) that results in reduced AtRAD51 protein levels. This mutant had mild chromosome fragmentation and partial synapsis, as well as some bivalent formation with homologs and non-homologs . In contrast, the atrad51-1 null mutant had severe chromosome fragmentation and formed multivalents during meiotic prophase I . These findings suggest that reducing AtRAD51 level might be a strategy for investigating its meiotic function. Alternatively, analysis of double heterozygous mutants in genes encoding components of a complex can reveal phenotypic defects, even though the corresponding single heterozygotes are phenotypically normal . We hypothesized that double/triple heterozygotes of atrad51, atrad51c and atxrcc3 might reduce, but not abolish, their interactions in a complex and reveal informative meiotic phenotypes
| 4 | 0biomedical
| 0Study
|
221,395 |
Cultured cells were fixed in 4% formaldehyde in PBS for 20 min at room temperature and, after being washed with PBS, were permeabilized with 0.1% Triton X-100 for 15 min. Cells were washed with PBS, blocked with 3% BSA in PBS for 1 h and incubated with primary antibodies in PBS for ~1–3 h at room temperature. After being washed with PBS, the cells were incubated with secondary antibodies for 1 h at room temperature. The cells were then counterstained with 10 μM 4,6-diamidino-2-phenylindole (DAPI) and mounted with Vectashield (VECTOR). Cryosections and paraffin-embedded Section (5-µm thick) of the brain and liver were fixed in 10% buffered formaldehyde and used for H&E staining, TUNEL assays, Nissl staining and immunofluorescence analyses.
| 4 | 0biomedical
| 0Study
|
311,424 |
TAP7f inhibits the epithetial-mesenchymal transition. (A) B16-F10 cells were incubated for 18 and 24 h in the presence or absence of 10 μM of TAP7f. Total cell lysates were processed for western blot analysis as described in MATERIALS AND METHODS. Results from one representative experiment are shown. Data quantification was performed by densitometric analysis. (B) Cells were treated for 18 h with TAP7f, followed by immunostaining for E-cadherin (green) and counterstaining with Höechst 33258 (blue). Magnification 400×. Scale bar: 50 µm (left panel). Fluorescence intensity was analysed by Image J software (right panel). Statistical analyses were performed by one-way ANOVA followed by Dunnett´s post-hoc tests (A) or Student’s t-test (B). **p < 0.01, ***p < 0.001 significantly different from non-stimulated cells, n = 3.
| 4 | 0biomedical
| 0Study
|
41,834 |
Although the sedimentary architecture, landform morphology and associated evidence together demonstrate that the sediments at almost all the Skertchly Line sites are of deltaic and related origin, there is, however, one exception. The sequence at Shouldham has been interpreted as a subaerial fan of similar origin to the other features .
| 1 | 2other
| 1Other
|
64,438 |
A list of details abstracted from the 21 included studies is provided in Table 1. All studies were published in English. Nine were prospective cohort studies, and 12 were case-control studies. Eleven studies were conducted in the United States, eight in Europe, one in Canada, and one in Taiwan. The sample sizes of the included studies ranged from 654 to 2,300,000, with a total of 3,167,020 participants, and the number of breast cancer cases varied from 31 to 58,000, with a total of 102,054. Of those studies, 11 provided results for BBs, 13 for CCBs, 13 for ACEi/ARBs, and 11 for diuretics. Drug use assessments were not consistent between studies; most used questionnaires and prescription database reviews. Case ascertainment was based on cancer registries or medical records in all studies. The adjusted covariates in individual studies differed, and most risk estimates were adjusted for age, body mass index, alcohol intake, and hormone replacement therapy use. Quality scores according to the Newcastle-Ottawa Quality Assessment Scale varied from 5 to 9 points, with a median of 7.14, indicating high quality of the studies included in the meta-analysis.
| 4 | 0biomedical
| 0Study
|
163,661 |
To facilitate long-term adherence to the whey protein supplement, findings from this study indicate that individuals with type 2 diabetes require individual feedback on the positive effects of the supplement on health-related outcomes. Specifically, they reported that biofeedback (i.e., effect of the intervention on blood glucose levels) obtained throughout the trial period increased adherence to the supplement and had a positive effect on their eating behaviour in general. In particular, participants reported making better dietary choices, although it is important to highlight that this wasn’t reflected in the outcomes of the 24 h recall data where there were no differences observed in macronutrient consumption from baseline to post-intervention. Although, it is possible that while composition of diet remains the same, the intervention may have positively affected portion size and this could be explored further. In addition, the supplement was reported to have led to other lifestyle changes, including increases in physical activity levels, increase in water intake, and prompting healthier food choices. This could be due to an increase in wellbeing impacting positively on other areas of participants lives. For example, consistent with these findings, a study conducted by Regeer and colleagues , found that a walking intervention aimed to increase self-management behaviour of adults with type 2 diabetes, also found an increase in patient activation and engagement with the intervention to positively influence wellbeing and health behaviours (i.e., exercise and dietary behaviour).
| 4 | 0biomedical
| 0Study
|
178,340 |
In this regard, various approaches have been introduced to overcome the TP issue by either using feed spacers,20−23 flashed feed,9 or heating the feed solution locally near the membrane surface, known as localized heating.24 So far, the latter is the most sustainable approach, as it can be applied without affecting the feed flow hydrodynamics. Nonetheless, all the abovementioned approaches remain dependent on external heating sources. Alternatively, recent technologies have offered other routes for repressing the TP limitation by using self-heating MD membranes coated with photothermal materials.16,25 Generally, applying photothermal coatings on MD membrane surfaces can induce significant localized heating; a larger temperature gradient across the coated membrane is obtained.26 In a typical photothermal MD (PMD) process, the membrane is coated with a photothermal material that can effectively absorb solar irradiation and convert it into thermal energy. Hence, the feedwater can be heated up directly at the evaporation site, that is, the membrane–feed interface, garnering PMD systems a great potential to overcome the TP effect.27,28 Furthermore, using PMD membranes has demonstrated an enhancement in the vapor flux in addition to a recognizable decrease in the specific energy consumption (SEC) compared to conventional MD.29,30
| 4 | 0biomedical
| 0Study
|
87,759 |
We used the numbers of hermit crabs caught in each trap as an index of local densities, and we compared the results of various islands in the hope of determining whether Dongsha had generally lower densities and thus lower intraspecies competition. The local densities of C. rugosus within a site were highly variable among traps (Fig 15). The highest density (i.e., 58 individuals in a trap) was recorded on Dongsha. A nonparametric comparison did not reveal significant differences in the local densities of the six study sites (P = 0.65 with empty traps omitted or 0.22 when all traps were included, Kruskal–Waillis tests).
| 2 | 2other
| 0Study
|
334,659 |
The cryopreserved semen was thawed at 35 °C for 30 s. The samples were analyzed for progressive motility, vigor, and sperm morphology as previously described. Sperm membrane and acrosome integrity was assessed by flow cytometry (BD FACSCanto II, Franklin Lakes, NJ, USA) using the technique of associating propidium iodide (PI; Sigma, 28,707-5, Saint Louis, MO, USA) and fluorescein isothiocyanate-Pisum sativum agglutinin (FITC-PSA; Sigma, L-0770, Saint Louis, MO, USA). Mitochondrial potential was assessed in a flow cytometer using a 5,5’,6,6’-Tetrachloro-1,1’3,3’-tetraethylbenzimidazolocarbocyanine iodide probe (JC-1; Sigma, T-4069, Saint Louis, MO, USA) (Celeghini et al., 2010).
| 4 | 0biomedical
| 0Study
|
223,571 |
Metabolomic studies, the identification of plant genes that are crucial for the microbial composition, as well as a better understanding of the microorganisms’ physiology and multitrophic interactions should be pursued in the near future, as they are key factors to elucidate the recruiting mechanisms and interactions between bacteria and host plants. Such knowledge would have great repercussions on plant phenotyping and breeding and would allow further development of plant protection strategies and forest management strategies . Due to its importance on plant phenotype, microbiome populations should be taken into account on plant selection. Moreover, propagation and plant breeding may lead to an interaction disruption between the plant and its microbiota . Thus, the selection of plant genotypes with an appetence to establish symbiotic relations with specific bacteria species and/or strains might be of high importance to maintain these beneficial interactions .
| 4 | 0biomedical
| 0Study
|
368,194 |
Finally, cell density was calculated as the fraction of living cells within the scaffold normalised with respect to the cardinality of the initial population. The same calculation was applied for the in-silico data, considering the sum of proliferating and quiescent cells as viable cells.
| 4 | 0biomedical
| 0Study
|
116,690 |
As for HDAC 5, HDAC 9 and HDAC 10, the identification of the three-dimensional structure was derived from SWISS Model. LigX tool from MOE 2008.10 utilized to elucidate the interaction between the ligand inhibitors and the enzyme, in order to determine the active
| 3 | 0biomedical
| 0Study
|
137,984 |
The overall survival in patients with an early and an advanced HCC was compared using Kaplan–Meier analyses. The optimum cut-off values for distinguishing between low and high serum concentrations were determined using the Youden index. High serum concentrations of dimethylamine (Figure 3a) and myo-inositol (MI) (Figure 3b) were positively correlated with a higher overall survival with Pearson correlation coefficients of 0.279 (p = 0.034) and 0.331 (p = 0.011), respectively (Table 4). No further parameters were positively correlated with a higher overall survival.
| 4 | 0biomedical
| 0Study
|
335,560 |
In this respectively study of 602 adult incident PD patients, we found that lower AGR levels were associated with comorbidities, impaired immunonutritional status, and prothrombotic status, including lower serum albumin, higher leukocytes, higher creatinine, higher urea nitrogen, higher platelet count, and higher RDW. Compared to patients with AGR > 1.26, the all-cause and CVD mortality risks were increased in patients with an AGR ≤ 1.25 even after adjusting for potential confounders. Therefore, AGR may be a useful parameter in identifying patients at risk of mortality.
| 4 | 0biomedical
| 0Study
|
144,623 |
Globally, liver cancer is the sixth most prevalent malignant tumor, however, it is the second most common cause of tumor associated mortalities (1, 2). Due to its aggressive behavior and limited therapeutic options, hepatocellular carcinoma (HCC), a type of primary liver cancer, has a poor prognosis. Conversely, the nature of indolent non-Hodgkin’s lymphoma (NHL) is relatively mild, despite there being no effectively radical treatment during its long chronic process. Therapeutic resistance, multiple relapses, and biological characteristic transformations lead to poor clinical outcomes (3). Occurrence of double tumors, comprising HCC and NHL, is fairly rare, and treatment is based on individual experience rather than standard protocols. Immunotherapy has rapidly developed and become an efficient therapy for non-small cell lung cancer, malignant melanoma, and other diseases (4, 5). It is a promising option for treating drug-resistant HCC (6). Tislelizumab, a newly humanized IgG4 antibody against programmed cell death-1(PD-1), has been approved for the treatment of Hodgkin’s lymphoma (HL), and a large number of clinical studies, such as the Phase III clinical trial of sorafenib as a first-line treatment for HCC (NCT03412773), have been performed. We report a case of indolent B-cell lymphoma-complicated HCC, which was effectively controlled by tislelizumab as the first line treatment. Authors also reviewed current literature and discussed the possible interaction between HCC and B-cell lymphoma during the long course of treatment.
| 4 | 0biomedical
| 3Clinical case
|
244,313 |
Chongming Island (121°09′30″–121°54′00″ E, 31°27′00″–31°51′15″ N) is located on the estuary of the Yangtze River (Figure 1), situated between the East China Sea and the Yangtze River, China. It is one of the world’ s largest estuary alluvial islands, covering an area of 1267 km2 with 80 km long from east to west. Chongming Island is known as a biodiversity ‘hotspot’, which is the midpoint of the route of Asia–Australia bird migration and provides habitats for 2–3 million migratory winter birds . The State Council of China is determined to build Chongming Island as the world-class eco-island. However, surround by the urban agglomeration of the YRD, Chongming Island suffers high pressure from anthropogenic activities. By the end of 2019, the total population of Chongming Island was more than 820,000. The high population density has led to conflict between natural conservation and economic development. In addition, as an estuary alluvial island with low elevation (3.21–4.20 m), Chongming Island is affected by sea level rise caused by climate change. Recently, Chongming Island is faced with the main pressure of both climate change and highly anthropogenic influences.
| 1 | 2other
| 1Other
|
113,963 |
To assess whether histone methylation levels might contribute to the observed gene expression associations, we checked histone methylation data in the 1,726 and 1,369 genes previously selected as specific gene sets for fever and no fever individuals. We found that active transcription driven by methylation data from H3K27ac, H3K4me3 clearly distinguished between both thermal individuals (Figures 7C,D; Figures S1A,B in Supplementary Material). The histone methylation data distinguished upregulated and downregulated genes from specific groups of genes from each experimental group (Figures 4C,D and 5C,D). Specifically, we observed epigenetic features of transcriptomic gene sets triggered exclusively by individuals expressing behavioral fever that were associated with a specific methylation pattern (Figure 7C; Figure S1A in Supplementary Material). In fever group, also was observed an increase of the H3K4me3 a histone hallmark frequently linked with transcription initiation providing a “window of opportunity” for the enhancer activation. By contrast, individuals reared under a restricted thermoregulatory (no fever group, Figure 7D; Figure S1B in Supplementary Material) H3K4me3 modification was weakly detectable. In his thermal group, the enrichment of H3K27me3 also was slightly increased (Figure 7D; Figure S1B in Supplementary Material).
| 4 | 0biomedical
| 0Study
|
56,425 |
Physical forms possess a character only because we ourselves possess a body. If we were purely visual beings, we would always be denied an aesthetic judgment of the physical world. But as human beings with a body that teaches us the nature of gravity, contraction, strength, and so on, we gather the experience that enables us to identify with the conditions of other forms.
| 1 | 2other
| 1Other
|
383,795 |
The next step was to identify homologies between individual RBG domains. When searches are seeded with whole protein strongly homologous regions in some hits will cause false positive alignments of adjacent unrelated regions (Fidler et al., 2016). This is a particular problem in proteins with repeats (data not shown). Therefore, multiple sequence alignments (MSAs) were created for each RBG domain separately using 5 iterations of HHblits to search deeply for homologs across human, yeast, protist and plant proteomes. In these searches, all RBG domains produced strong hits to the orthologous region of VPS13 in model species across a wide range of eukaryotic evolution (probability of shared structure >98% in fly, worm, yeast, Capsaspora, Trichomonas, Trypanosoma, Chlamydomonas and Arabidopsis). One aspect of the method that was not based on biological observation is that the six elements of RBG domains were defined as βββββ-loop. This was chosen in preference to any other permutation (for example βββ-loop-ββ) to maximize the power of sequence analysis, because either including the whole loop that follows the helix, the site of greatest variability, or making a deletion reduces the sensitivity of MSAs (not shown). Indication that RBG domains may not be formed from the βββββ-loop biological unit are highlighted in the descriptions of search results below.
| 4 | 0biomedical
| 0Study
|
183,366 |
Total RNA from blood was extracted using TriReagent (Invitrogen Corporation, Carlsbad, CA, USA) based on the producer’s recommended protocol. RNA concentrations and quality were assessed using NanoDrop-1100. Sample purity was assessed based on the spectral data and purity ratios. For gene expression evaluation, total RNA samples were treated for complete digestion of DNA (deoxyribonucleic acid) with TURBO DNA-free™ Kit (Invitrogen) according to the manufacturer’s protocol. Total RNA (50 ng for miRNA expression and 1000 ng for gene expression/sample) was transcribed into cDNA (complementary DNA) using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) for miRNA expression analysis and a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) for gene expression evaluation. For miRNA amplification, we used a TaqMan Fast Advanced Master Mix (Applied Biosystems) and a SYBR Select Master Mix (Applied Biosystems, Carlsbad, CA, USA) for gene expression. qRT-PCR was performed with a ViiA™ 7 System (Applied Biosystems, Carlsbad, CA, USA) in a 5 µL (miRNA amplification) and a 10 µL (gene amplification) volume using a 384-well plate. All the samples were evaluated in duplicate.
| 4 | 0biomedical
| 0Study
|
143,119 |
Our data also suggest sensitivity of using core symptoms to justify testing for COVID-19 may be lower post-vaccination than in pre-vaccination times (here 48%, previously 73%.) . Although individuals with core symptoms were more likely to test positive than those without, the overall sensitivity and AUC suggests current UK testing policy is suboptimal for pandemic management particularly now that rapid testing capacity is much greater than when these criteria were established . Notably, current UK testing criteria are more limited than WHO guidelines and those of many other jurisdictions of similar GDP (including France, Germany, USA, and Australia).
| 4 | 0biomedical
| 0Study
|
360,612 |
Omentin and vaspin in the VAT were quantified using Western blotting. The tissues were processed to obtain the total protein extract using an extraction buffer [sodium dodecyl sulfate (SDS), 0.1% (p/v); Triton, 1% (v/v); Tris–HCl, pH 7.5, 50 mM; NaCl, 150 mM; EDTA, 15 mM; EGTA, 5 mM; NaF, 100 mM; and Na2P2O7, 10 mM] as well as protease inhibitors (Complete-Mini Roche® 1×). The concentration of protein was quantified using Lowry’s colorimetric method (1951). The crude protein extracts for each experiment were submitted to SDS–polyacrylamide gel electrophoresis (12%) and Tris-glycine buffer 1 × (Laemmli’s method) using a vertical electrophoresis tank (BioRad). The proteins were then transferred from the gel to the nitrocellulose membrane (0.45 μm, BioRad) in a submerged transfer procedure according to the manufacturer’s protocol. Membrane blockage was done with Tris-buffered saline with 0.1% Tween® 20 (TBST) 1 × containing 9% of milk powder for 4 h at room temperature. The membranes were then incubated, overnight at 4°C, with the primary antibody anti-omentin (1-1000, sc-104334, and Santa Cruz®) and anti-vaspin (1-1000, sc-79815, and Santa Cruz®) TBST 1 × containing 5% of milk powder. The membrane was incubated with a secondary anti-goat IgG-HRP antibody: (1-3000, sc-2020) in TBST 1×, immunodetection was performed using a chemiluminescence kit (ECL Prime, GE Healthcare®, Life Sciences). The blot image was acquired using the Chemidoc (BioRad®) equipment. Protein concentrations were normalized by using GAPDH diluted 1:10,000 (Abcam®) in VAT. All the membranes were normalized using an intra-membrane control.
| 4 | 0biomedical
| 0Study
|
254,670 |
Using the PRISMA extension for scoping reviews,20 we searched Ovid Medline, CINAHL, PsycINFO, and Scopus databases from 1946 to April 20, 2020. Search terms included synonyms for “stress,” “child,” “adolescents,” “discrimination,” and “psychometrics” (See Fig. 1 for the full search strategy). Search results were limited to articles published in English. In addition, reference lists of relevant systematic reviews were also reviewed for eligible studies.12,21–23 We supplemented the literature search by reviewing the PhenX toolkit,24 an online catalog of recommended measurement protocols, for relevant measures. Reviewed articles were not limited by study design. Eligible articles included those that focused on children or adolescents (≤18 years of age); focused on racial or ethnic minority populations as defined by the U.S. Census Bureau25 (for race: Black or African American, Asian, American Indian or Alaska Native, Native Hawaiian or Other Pacific Islander, or other race; for ethnicity: Hispanic or Latino); evaluated psychosocial stress that results from the participants' racial or ethnic identity including but not limited to racial discrimination/racism, acculturative stress, and bicultural stress; and reported psychometric properties for the measure being evaluated.
| 4 | 0biomedical
| 0Study
|
42,726 |
We studied 63 healthy adults (age ± std 47.0 ± 9.1 years, range 31–66 years; 40 males, 23 females). All subjects had no history of cerebrovascular disease, myocardial infarction, heart failure, neurological disorders, or mental illness and were not taking cardiovascular or psychotropic medications. Subjects were recruited from the Los Angeles area and did not weigh more than 125 kg or have any metallic or electronic implants; the latter two issues are MRI scanner contraindications. All subjects provided written informed consent, and the research protocol was approved by the Institutional Review Board of UCLA. No subjects were taking exogenous sex hormones (for example, oral contraceptive pills, hormone replacement therapy, or testosterone therapy).
| 4 | 0biomedical
| 0Study
|
306,491 |
Schematic diagram representing the effect of NAG-1 on the insulin signaling pathway. Overexpression of pro-NAG-1 increases expression levels of IRS1/PI3K/AKT, resulting in anti-diabetic activity. Green and red colors represent upregulation and downregulation, respectively, whereas the yellow color indicates no significantly different expression.
| 4 | 0biomedical
| 1Other
|
287,762 |
We next examined cumulative live birth rates (CLBR) for cycles in Hispanic and Asian women compared to WNH women for those with and without prior ART. For Hispanic women, race remained a predictor of a lower cumulative live birth rate compared to WNH even when controlling for age, parity, history of spontaneous abortions, cause of infertility, diminished ovarian reserve, Day 3 FSH, AMH, ICSI, and number of embryos transferred (OR 0.84, 95% CI: 0.77–0.92) (Table 4). A similar situation was observed for cycles from Asian women when controlling for the same confounders showing Hispanic ethnicity was associated with a lower cumulative live birth rate compared to cycles from WNH women (OR 0.79, 95% CI: 0.71–0.85, p < 0.001) (Table 4).
| 4 | 0biomedical
| 0Study
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.