id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
167,481 |
Low contrast and large intra-class distance of roll mark under inhomogeneous imaging environment bring different degrees of interference to the roll mark detection on strip steel surface. In order to verify the effectiveness of SCFPN in roll mark detection and the generalization ability confronted with multiple roll mark detection tasks, based on CSU_STEEL dataset, we select conventional and feature pyramid-based methods to conduct qualitative evaluation experiments on roll mark detection, which is shown in Figure 8. In all of our experiments based on CSU_STEEL, the original image of the hot-rolled steel strip surface is directly used for roll mark defect detection without cutting. In Figure 8, the top is the original image, and (a), (b), (c), (d), and (e) are the five kinds of high-frequency roll marks that existed in the original image, severally, and the image details are shown in the square slices below.
| 1 | 2other
| 0Study
|
25,009 |
Our time–frequency analysis results demonstrated that the IOG displayed stronger gamma-band activation in response to eyes than to mosaics. Compared with the clear effect of eyes, an effect of eye direction was not evident in gamma-band activity in the IOG. The present findings are consistent with those of previous intracranial EEG studies reporting that the IOG was active in response to eyes, irrespective of gaze direction14. The present findings are also in line with those of previous neuroimaging1718, intracranial EEG19, and stimulation20 studies indicating that the IOG is involved in the processing of facial features. The results also fit with a neuroscientific model suggesting that the IOG is involved in the initial stage of processing facial features and then forwards the information to other regions, such as the STS15.
| 4 | 0biomedical
| 0Study
|
188,730 |
To investigate the breastfeeding and weaning practices of Yingpan Man and his diet during early childhood, 21 serial sections of dentinal collagen from his first molar (M1) were sampled and extracted following “Method 2” mentioned in Beaumont et al.96 with the modification of demineralizing the teeth at room temperature. The age of each serial dentine section was assigned according to the age upon which different parts of the tooth initiates and complete formation32. Specifically, the M1 generally initiates formation just prior to birth and the entire tooth completed formation at ~ 10 years old32. Thus, serial sections of the dentinal collagen from the M1 of Yingpan Man covers most of his lifetime from birth to ~ 10 years old.
| 4 | 0biomedical
| 0Study
|
16,595 |
Our discussions about differences in managing hypertension in young adults compared to older adults also yielded recurring themes of barriers that have been historically present across age groups [15–18, 21]. However, visit adherence (i.e., clinic visit no-shows) was an important theme, not just for diagnosis and control of hypertension, but also as a safety issue when prescribing blood pressure medication to young adults. It may be beneficial to extend hypertension guidelines to address visit adherence and not just medication adherence. Surprisingly, some providers were concerned that medication initiation promoted young adults to resume or increase unhealthy lifestyle behaviors, which resulted in delays of prescribing medication in their practice. This highlights the need for team-based care to support ongoing lifestyle modification counseling, even between visits, to support a combined approach to hypertension control .
| 4 | 0biomedical
| 0Study
|
219,131 |
To identify the functional role of SOCS3 in GBM, three GBM cell lines (A172, U-87MG, and U-373MG) were treated with siRNA against the SOCS3 gene. Knockdown of SOCS3 was verified by qPCR analysis and western blotting. Compared to the control siRNA-injected cells, siSOCS3-injected cells showed reduced expression at the transcriptional level (Figure 5A) and translational level (Figure 5B). Since several studies have suggested that SOCS3 is related to cell proliferation (Baus and Pfitzner, 2006; Hackett et al., 2016), PCNA was examined after knockdown of SOCS3 as a cell proliferation marker. Inhibition of SOCS3 expression in three different GBM cell lines showed reduced levels of the PCNA protein (Figure 5C). Additionally, reduced expression of SOCS3 directly reduced cell proliferation (Figures 5D,E). These data suggest that SOCS3 in GBM cell lines is important for cell proliferation.
| 4 | 0biomedical
| 0Study
|
35,819 |
Descriptive statistics (mean ± standard deviation) and internal consistency estimates (Cronbach’s α) for the 8 factor Adult Eating Behaviour Questionnaire (AEBQ) in the present Australian sample (N = 998; mean age = 24 ± 8; 84.8% female) and in the original validation sample of British adults (N = 954; mean age = 44 ± 13; 57.3% female)
| 2 | 0biomedical
| 0Study
|
30,922 |
One of the main components of CIMT is repetitive tasks/shaping practice. Studies in neurorehabilitation have shown a linear relationship between number of repetitions and recovery of motor function [11–14]. One of the studies in particular indicated that when tasks were practiced about 300 times per day for 2 weeks, the participants had significant improvement in motor function and that the 300 repetitions were possible within just one hour . This finding may have implication for practice, since it seems to suggest that it is not the number of hours spent practicing task but rather the number of repetitions of the task that is important for motor recovery. Thus, knowing the exact number of repetitions our patients need for recovery of motor function can be an important rehabilitation milestone. However, these studies lack external validity as they are either a case report or a noncontrolled trial. Therefore, the aim of this study is to rigorously compare CIMT protocols using number of repetitions of shaping practice with the one using number of hours of shaping practice using a randomized controlled trial (RCT) design.
| 4 | 0biomedical
| 0Study
|
184,126 |
The relationship between local and metacommunity stability as influenced by dispersal. The baseline dispersal rate d and the body size scaling coefficient z determine the species-specific dispersal rate \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\delta _i = d M_i^z$$\end{document}δi=dMiz, where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$M_i$$\end{document}Mi is the mass of species i. All species have the same dispersal rate d when z = 0. When z is positive, larger bodied species have faster dispersal rates, whereas when z is negative, it is smaller bodied species that have faster dispersal rates. Other parameters vary across all simulations as indicated by Table 1. Error bars denote ± 2 S.E.M., and are too small to see.
| 4 | 0biomedical
| 0Study
|
163,189 |
In summary, this report documented the detection and isolation of novel ALV-J in chicken flocks with the disease of hepatomegaly and splenomegaly, highlighting the closely relationship between ALV-J infection and chicken hepatomegaly and splenomegaly, and the significance of the ALV-J eradication program.
| 3 | 0biomedical
| 0Study
|
314,936 |
Dietary addition of different levels of Fe (50 to 150 mg/kg) caused no significant difference in the growth performance, immune organ indices, hematocrit, or Fe content in liver and kidney of yellow-feathered broiler chickens. During the finishing phase (43 to 63 d), an appropriate amount of dietary Fe (90 mg/kg) improved indices of meat quality of breast muscle in these chickens. Overall, the results obtained here demonstrate that yellow-feathered broilers fed conventional diets based on corn and soy meal (Fe 50 mg/kg) require no additional Fe during starter (1 to 21 d) and grower (22 to 42 d) phases, while 90 mg/kg in the finisher phase improved meat quality, and from the QP models of the key meat quality variables pH and drip loss of breast muscle, the optimal dietary Fe level was 89 to 108 mg/kg, and daily Fe fed allowance was 11 to 13mg in the finisher phase (43 to 63 d).
| 4 | 0biomedical
| 0Study
|
141,070 |
In recent years, as the research on ncRNAs continues to heat up, the function and mechanism of lncRNAs have gradually attracted significant attention from researchers. LncRNAs are types of noncoding RNAs with a length of more than 200 nucleotides (26, 47). Similar to mRNA, most lncRNAs are the products of RNA polymerase II transcription that have a polyA tail and a promoter structure. At the same time, there are significant differences between lncRNA and mRNA because lncRNAs mainly exist in the nucleus, and they also have lower expression levels compared to mRNAs (48–50). Besides, lncRNAs are relatively low conserved, and their expression has temporal and spatial specificity (51–53). Traditionally, it is believed that lncRNAs do not have protein-encoding abilities, but recent studies have identified that a small number of lncRNAs can indeed encode small molecule peptides, thereby regulating biological processes.
| 4 | 0biomedical
| 0Study
|
149,490 |
This trial forms the second in a series of studies to optimize the PLAYshop for dissemination – that is, to develop the most effective and resource-efficient option . Through this process, findings from the current study are used to inform improvements to both the intervention and to research processes, including addressing limitations where possible. For example, resolving insufficient representation of fathers in childhood health and physical activity research has been flagged as a research priority [35, 67]. Future research should incorporate father-specific recruitment strategies and methods to improve their response rates. Similarly, targeting those parents less engaged in physical activity will ensure a more representative evaluation sample. There are also opportunities to improve data collection methods (e.g., validating the surveys would improve the rigor of results) and to increase parent’s exposure to messaging and activity ideas with additional follow-up support strategies (e.g., a smartphone app).
| 4 | 0biomedical
| 0Study
|
382,050 |
Even though our recommendations suggest to devalue the number of publication criterion, publishing one’s findings is essential to science. The criteria used to evaluate manuscripts within the peer-review process are a crucial factor that shape the scientific conduct. We will draw on Kuhn’s (1970, 1996) insights into the theory of science to scrutinize the review criteria. Kuhn describes that science evolves through a progression of different phases. Early stage science, termed protoscience, develops into paradigmatic science2. Protoscience (still) lacks broad theories and thus, often relies on explorative as opposed to theory-driven research. It therefore explores ideas in a relatively random fashion and uses idiosyncratic methods. We argue that psychology is in the process of developing from protoscience into paradigmatic science. For this transition, the field has to adopt and consent to a paradigm. A research paradigm defines relevant theories, (measurement) instruments, values and metaphysical assumptions, which are kept relatively constant. To succeed, each research community needs to commit to a paradigm, to meaningfully communicate with each other and to explain as many findings as possible in a way that can be shared, taught, and utilized. Explorative research has to cease when the scientific community consents on a paradigm.
| 4 | 0biomedical
| 0Study
|
361,031 |
The recorded EMG data showed three muscular activity bursts corresponding to three repetitions of each task in one trial. This phenomenon was mainly observed from the seven EMG channels for the tested arm performing the tasks. A data segment of 3-s EMG activity was selected for each muscular activity burst, and thus three data segments were produced for each task. The EMG signals in the form of seven channels in each data segment were further divided into a series of non-overlapping analysis windows with a window length of 100 ms. We chose such a windowing approach to produce a sufficient number of data samples, while these windows were not overlapped to maintain the diversity of resultant data samples. Finally, 90 analysis windows/samples were obtained for each tested arm performing each task. These analysis windows were also considered as basic data samples in the following feature extraction and pattern classification analyses.
| 4 | 0biomedical
| 0Study
|
243,664 |
Our transcriptomic analysis detected many PSGs and clusters of paralogous genes in Urophysa species. Among them, genes related to stress and stimulus resistance, transmembrane transport, calcium ion transport, cellular ion homeostasis, calcium signaling regulation and water retention were detected, which allow better adaptation to the karst environment. Several phenotypic characteristics, such as obvious cuticular wax, numerous epidermal hairs, long and stout rhizomes and unusual flowers, may also contribute to habitat adaptation. Our results showed that Urophysa species may have evolved successful strategies for karst environment adaptation.
| 4 | 0biomedical
| 0Study
|
232,751 |
The human immunodeficiency viruses (HIV) are an ssRNA-RT, belonging to the lentivirus genus; part of the family of Retroviridae. Over time, they induce acquired immunodeficiency syndrome (AIDS). They are transmitted as single-stranded, positive sense, enveloped RNA viruses. After cell targeting, viral RNA genome is reverse transcribed into double-stranded DNA by a virally reverse transcriptase. Two types of HIV have been identified; HIV-1 and HIV-2. HIV-1 is the first discovered and the most virulent and infective in comparison with HIV-2 and is the cause of the majority of HIV in the world .
| 4 | 0biomedical
| 1Other
|
72,790 |
Self-face has high relational salience (Brédart et al., 2006) to the individual and may possess high subjective reward value (Devue et al., 2009). However, the visual processing strategies employed in recognizing the highly salient and familiar self-face is relatively unknown.
| 3 | 0biomedical
| 0Study
|
359,225 |
To gain insight into the mechanism of the growth inhibitory potential of compound 3a against the RPMI 8226 and A549 cells, we analyzed its influence on the distribution of cell-cycle phases in both cell line cultures after 24 and 48 h. As can be seen in Figure 4 and Figure 5, the exposure of the RPMI 8226 (Figure 4A–D) and A549 (Figure 5A–D) cells to compound 3a did not result in arrest and did not increase the number of cells in G0/G1, S, or G2 phases of the cell cycle. In contrast, it induced a concentration- and time-dependent increase in the cellular content in the sub-G1 phase (Figure 4B,D and Figure 5B,D, Tables S2 and S3), which corresponds to apoptotic cells with fractional DNA content. Thus, the results indicate that compound 3a can induce apoptosis in cancer cells, but not via the cell cycle arrest.
| 4 | 0biomedical
| 0Study
|
323,190 |
2 × 104 cells were seeded in 96-well plate containing one-hundred microliter media (without serum) and incubated overnight in optimum conditions. Then old media was discarded and new media containing 100 and 200 μg/mL of venom were added and incubated for 24 h at 37 °C. Cells morphology was analyzed and some pictures were captured using inverted microscope (Nikon, Japan).
| 4 | 0biomedical
| 0Study
|
174,245 |
The current systematic review and meta-analyses included three case–control and five cohort studies involving 26,063 patients and 848,081 participants. The studies focused on cholecystectomy and GC risk. The findings revealed that cholecystectomy was associated with 11% increased risk of GC, with low heterogeneity among studies. This association was also significantly observed in cohort studies and studies with a low risk of bias. In subgroup analysis by anatomic subsite of GC, this effect was more pronounced in non-cardia GC compared with cardia GC. However, no evidence of the relationship between the duration of the follow-up period after cholecystectomy and GC risk was found.
| 4 | 0biomedical
| 2Review
|
197,258 |
In most cases, both TCN and SNAIL outperform Seq2Seq in all error metrics for wpred = {1, 2, 3}. For wpred = 4, SNAIL outperforms Seq2Seq in three error metrics and TCN for all error metrics and Seq2Seq outperforms TCN in all four error metrics. The prediction accuracy measured via TCN and SNAIL in all four metrics are degraded as wpred increases from 3 to 4. Interestingly, as opposed to such degradation, there is virtually no degradation in the prediction accuracy computed using Seq2Seq as wpred increases from 3 to 4. Fig 16 illustrates the original %ILI and the multi-weeks ahead predictions made by SNAIL and Seq2Seq for 2018—2019 season (test). Among the nine states, we select four states for visualization {AZ, DE, NY, SD}. As shown in Table 4, the prediction accuracy becomes degraded as the longer prediction horizon is taken. Nonetheless, the prediction results yield moderately accurate predictions capturing different %ILI dynamics in each state (e.g., SNAIL predicts %ILI ranges from around 1.5 to 5 in AZ, NY and from 1.5 to 3 in AZ, SD) and also capturing the useful properties such as peaks and slopes in most cases.
| 4 | 0biomedical
| 0Study
|
253,332 |
In many cases, the researchers who have studied measurement error, have ignored the presence of non-response and randomized response particularly when using randomized response. In this study, we have proposed a class of estimators for the population mean of a sensitive variable in the presence of measurement error and non-response simultaneously, under simple random sampling. The efficiency of the suggested class of estimators as compared to the existing estimators is shown using simulated and real data sets.
| 4 | 0biomedical
| 0Study
|
41,020 |
mPAP, mean pulmonary artery pressure; PCWP, pulmonary capillary wedge pressure; TPG, transpulmonary pressure gradient; PVR, pulmonary vascular resistance; PVC, pulmonary vascular compliance; CO, cardiac output; VO2max, maximum oxygen uptake; Ca-vO2, arteriovenous oxygen content difference; VE/VCO2, minute ventilation/carbon dioxide production; VO2 at AT, oxygen consumption at anaerobic threshold.
| 3 | 0biomedical
| 1Other
|
372,690 |
To estimate the survival probabilities of ccRCC patients at 1, 3, 5, and 7 years, we established a nomogram prognostic prediction model based on all independent prognostic predictors recognized by the univariate and multivariate Cox regression analyses including RS (HR = 3.082, 95%CI = 1.913–4.966, P < 0.001), T stage (HR = 2.278, 95%CI = 1.447–3.588, P < 0.001), M stage (HR = 2.876, 95%CI = 1.788–4.625, P < 0.001) and age (HR = 1.729, 95%CI = 1.138–2.626, P = 0.010, Table 3 and Figure 2C). The C-index of this model was 0.777, with a 95%CI ranging from 0.731 to 0.823. The overlapping of the calibration curve between the predictive values from the nomogram model and the actual observations demonstrated the accuracy of this model (Figure 2D). Next, we compared the performance of the nomogram model with the traditional model that only contained the clinical parameters (T stage, M stage and age) in the prognostic prediction. The results showed that the nomogram model was superior in predicting OS at 3, 5, and 7 years, whilst the traditional model had a larger area under the curve (AUC) for 1 year survival prediction (Figure 2E). These results suggested that the nomogram model was more powerful than the traditional model in predicting the long-term survival of ccRCC patients.
| 4 | 0biomedical
| 0Study
|
34,610 |
A total of 114 peripheral blood samples were collected from healthy white adults and from infants/children between 0.1 and 66 months. Adult blood donors, mostly white (81%) males, ranged from 18 to 50 years in age. Peripheral blood mononuclear cells (PBMCs) were obtained from leukocyte reduction filters (Sepacell RZ-2000, Asahi Kasei Medical Co., Chiyoda-ku, Tokyo, Japan) at the Institute of Transfusion Medicine and Immunohematology and at the blood bank at the University Clinic of Magdeburg. Human cord blood (CB) samples were obtained from umbilical cord veins immediately after placental delivery at the Women’s Clinic of the University Hospital of Magdeburg.
| 4 | 0biomedical
| 0Study
|
275,338 |
→When quantifying peripheral metabolites to evaluate in cerebro bioavailability, unbound fractions in addition to total or bound levels need to be described. Thereby, one should take heed in optimizing their study design to account for modulators influencing freely circulating compound concentrations such as meal intake and type of collection tube (preferably collect fasting blood samples in EDTA-coated plasma tubes) (Badawy 2010). Alternatively, interference of albumin binding should be checked statistically by introducing [serum/plasma albumin] as a model covariate (van den Ameele et al., 2018; De Picker et al., 2019).
| 4 | 0biomedical
| 0Study
|
342,462 |
The normalizing factors sij compensate for differences in sequencing depth between samples and for eventual gene-related technical biases such as gene length. We used the default procedure where these factors are considered as fixed within each sample, sij = sj and then only accounts for differences in sequencing depth between samples. These so-called size factors were estimated by the median-of-ratios method:
| 4 | 0biomedical
| 0Study
|
314,272 |
In MPNs, many cytokines are upregulated, creating a sustained inflammatory microenvironment that correlates with more severe marrow fibrosis and systemic symptoms, impacting prognosis and survival , but also acting as markers to predict and monitor treatment responses . Soluble interleukin-2 receptor (sIL-2R), interleukin-8 (IL-8) and immunoglobulin-free light chains (FLCs) are reported to be the most important predictors of outcome in patients with PMF with the activated JAK-STAT pathway .
| 5 | 0biomedical
| 0Study
|
397,438 |
GS system has also been applied to regulate the expression of potent cytokines such as IL-12 with the aim to control its activity while keeping their therapeutic potential. In an elegant study, Wang et al. developed a strategy to achieve hepatic-specific expression of IL-12 that also responded to the control of MFP. The authors developed an AdV harboring the sequences for GAL4 binding into a hepatic-specific promoter driving the expression of IL-12 (6). Direct administration of these AdVs enabled controlled hIL-12 expression in the liver for more than 48 weeks when MFP was administered every 24 h. In addition, this system achieved complete tumor regression in an aggressive model of liver metastases in vivo. Whereas, using a specific-liver promoter seems to be useful for preventing immunogenicity, the IL-12 production in the liver was associated with a moderate inflammatory reaction opens the possibility that higher doses of AdV-MFP could induce-IL-12-related severe inflammation.
| 4 | 0biomedical
| 0Study
|
367,234 |
Finally, we consider the case when \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathcal {X}}=\Pi ^{-1}_a$$\end{document}X=Πa-1 for some notation a with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$|a|_{{\mathcal {O}}}>1$$\end{document}|a|O>1. The construction is virtually the same as in the dual case. We start with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$R={{\,\mathrm{Id}\,}}_1$$\end{document}R=Id1 by defining \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f(x, 0):=1$$\end{document}f(x,0):=1 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma (x, 0):=a$$\end{document}γ(x,0):=a for every x. Next, we take R,[recall that we pick witnesses \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$(x_e, y_e)$$\end{document}(xe,ye) to be of the form \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$(2i, 2i+1)$$\end{document}(2i,2i+1)] by suitably defining f and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}γ: in particular\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \gamma (\langle x, y\rangle ,1)= {\left\{ \begin{array}{ll} a, &{}\text {if } x=y \vee (\exists i)[\{x,y\}=\{2i, 2i+1\}],\\ 2, &{}\text {otherwise,} \end{array}\right. } \end{aligned}$$\end{document}γ(⟨x,y⟩,1)=a,ifx=y∨(∃i)[{x,y}={2i,2i+1}],2,otherwise,where we have used the assumption that \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$|a|_{{\mathcal {O}}}>1$$\end{document}|a|O>1. The construction now mimics the one for the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\Sigma ^{-1}_a$$\end{document}Σa-1 case, essentially starting from stage 1. The idea is to make the first non-trivial approximation R to R to look very much like \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${{\,\mathrm{Id}\,}}$$\end{document}Id (as in the proof of Theorem 3.2), except for pairs of the form \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$(2i, 2i+1)$$\end{document}(2i,2i+1) for which we do not want to add an extra initial change which could spoil our possibility of playing the extraction/enumeration game exploited by the diagonalization strategies. This allows a requirement \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$P_e$$\end{document}Pe to be able, if it requires attention, to R-collapse pairs of numbers of the same parity that have been set as non-R-equivalent at stage 1 (when we have defined \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\gamma $$\end{document}γ to be 2 for these pairs). \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\square $$\end{document}□
| 1 | 2other
| 0Study
|
129,769 |
A cell-free degradation assay was conducted as described previously . To monitor the degradation of the recombinants, i.e., HIS–FSD1, HIS–TCP8, HIS–VOZ1, HIS–PHL3, HIS–RPL10, and GST–CK2α1, 250 ng of each purified recombinant protein were incubated in 20 µL of the plant protein extract (50 μg) at 22 °C for the indicated time periods. The abundances of the recombinant proteins were analyzed by immunoblotting with an anti-GST or anti-HIS antibody.
| 4 | 0biomedical
| 0Study
|
147,585 |
MLL3 is one of the key enzymes for the modifications and activity of enhancers. It is frequently mutated in many cancers. Previously, it was reported to be associated with p53 and regulates the expression of p53 target genes. Our results indicated that besides p53 signaling, MLL3 also regulates tumorigenesis through repressing cell migration. MLL3 regulates H3K4me1 and H3K27ac on TNS3 enhancer, which in turn affects TNS3 transcription. TNS3 has been shown as an important protein involved in integrin-mediated signaling and cell migration37. The gene expression and DNA methylation on CpG island of TNS3 have been associated with breast cancer and renal cell carcinoma38,39. We showed that TNS3 exogenous expression completely blocked the elevated cell migration caused by MLL3 knockdown, indicating the critical role of TNS3 in MLL3’s function in repressing cell migration. Though MLL3 or TNS3 knockdown did not elevate downstream gene dramatically, quite a few migration-related genes were upregulated. A mechanism published previously involving JNK/cJun pathway is probably also functioning here37.
| 4 | 0biomedical
| 0Study
|
310,216 |
In conclusion, the results of this experiment point to specific white matter tracts implicated in inhibitory control processing in ADHD children. These results may help direct us closer to a potential biomarker incorporating brain function, structure together with an important neurocognitive deficit. There is growing evidence that white matter changes can represent endophenotypic markers in psychiatric disorders. For example, white matter volumetric differences within the posterior portion of the right IFOF and grey matter within the right IFG have been found in adult ADHD cases and their first degree relatives, with a correlation between SSRT and degree of white matter disruption (59). Future avenues of study could include exploring the state of the inhibitory control network in other psychiatric conditions where poor inhibitory control is found such as in autism. Also, implementing pharmacologically informed seeds into a tractography study (e.g. using nodes where psychostimulants alter brain activation in ADHD patients), or using seeds informed by other cognitive deficits like altered reward processing (71), temporal processing (72), and working memory deficits (73), which together would enhance our understanding of the brain mechanisms of ADHD and drive future therapeutic targets.
| 4 | 0biomedical
| 0Study
|
63,176 |
We examined the associations between residential distance to A1 or A2 roads and continuous indicators of cardiac structure (all outcomes except LV hypertrophy) using multivariable linear regression adjusting for confounders. We examined the associations between residential distance to A1 or A2 roads and LV hypertrophy using multivariable logistic regression adjusting for confounders. We conducted a test for trend for categorical distance to roads.
| 4 | 0biomedical
| 0Study
|
287,984 |
Seventeen (17) participants were recruited from the Sapienza University of Rome (ten males and seven females, 31.1 ± 3.7 years old) with normal or corrected-to-normal vision. Due to artifacts and missing data caused by technical issues after signals processing twelve (12) participants were considered valid for the analysis. Informed consent was obtained from each participant after explanation of the study. The experiment was conducted following the principles outlined in the Declaration of Helsinki of 1975, as revised in 2000 and was approved by the Sapienza University of Rome Ethical Committee in Charge for the Department of Molecular Medicine (protocol number: 2507/2020, approved on 4 August 2020). To respect the privacy of participants, only aggregate results were reported.
| 3 | 0biomedical
| 0Study
|
88,437 |
The fact that the effect was kept along all the heating temperatures tested agrees with results previously published by Maté et al. with L. monocytogenes. Maté et al. hypothesized that the dramatic decrease of the thermal resistance of L. monocytogenes was caused by the use of the D-limonene in the form of a nanoemulsion, which has been shown to improve the solubility and distribution of oily antimicrobials in aqueous media . As a consequence, the antimicrobial can reach the cell more easily. Maté et al. also found that the same effect was shown in a food product, such as apple juice. This finding was also very relevant, since most of the effect found with the combination of heat plus antimicrobials in culture medium is lost when they are applied in food products . Even Maté et al. found that this dramatic effect could be almost completely lost depending on the composition of the food, showing that in carrot juice containing fat and fiber, the effect was lacking, but when these components were removed from the carrot juice, the effect was, again, dramatic.
| 4 | 0biomedical
| 0Study
|
257,631 |
Finally, most of our participants suggested CLBP self-management can be delivered using fewer resources. The participants described that patients do not need expensive equipment to self-manage their back pain. In particular, in this study, physiotherapist respondents speculated that patients could do different exercises without using exercise equipment to manage their pain.
| 2 | 0biomedical
| 0Study
|
306,196 |
Outcomes assessed at a single time point (mind-wandering, PVT, amount of strategy practice) were analysed using univariate factorial (strategy × drug) ANOVA or independent samples t-test (strategy compliance ratings; DEQ scores) with false discovery rate adjustment as appropriate. Continuous variables measured at the pre-drug, post-drug and post-strategy time points on Day 1 (state mindfulness, HRV and affect) were analysed using three-way repeated measures ANOVAs, with Time (T1, T2, T3) as the within-subjects factor. Day (Day 1, 8) was the within-subjects factor when assessing ‘long-term’ effects on SMS and PANAS (measured at T1) and DASS-21 and FFMQ. Where Mauchly’s test indicated significant departures from sphericity, dfs and p values were adjusted using Greenhouse–Geisser correction (reflected in non-integer dfs accompanying some F statistics). Note, no a priori predictions were made for drug and/or strategy effects on affect (PANAS), HRV or any of the longer-term effects (including amount of practice). Results from these analyses should therefore be considered exploratory.
| 4 | 0biomedical
| 0Study
|
271,887 |
Sleep outcomes include: 1) sleep disturbances (difficulty initiating or maintaining sleep, reduced sleep efficiency, altered sleep architecture); 2) sleepiness (difficulty remaining awake); 3) sleep patterns; 4) sleep fragmentation (sleep cycle unable to reach stage 4 non-rapid eye movement [NREM] and rapid eye movement [REM] due to waking up throughout sleep); and 5) self-reported sleep quality (tiredness upon waking, daytime tiredness, feelings of being rested and restored). Common self-reported measures of sleep include the Pittsburgh Sleep Quality Index (PSQI) , and Insomnia Severity Index (ISI) ; objective measures include wrist actigraphy .
| 4 | 0biomedical
| 2Review
|
358,547 |
Exosomes derived from malignant mesothelioma possess oncogenic cargo and are reported to be involved in angiogenesis of cancer cells by enhancing the blood vessel regeneration, movement of VECs and fibroblasts . A report by Cui H et al. (2015) has described the role of exosomes derived from lung adenocarcinoma to mediate angiogenesis by modulating the expression of Ephrin α3 via miR-210-dependent fashion . The authors of this study demonstrated that overexpression of TIMP-1 in tumor cells enhanced the accumulation of exo-miR-210 in a “CD63/PI3K/AKT/HIF-1-dependent signaling” and aid in the tube formation ability in HUVECs, which consequently augmented neovascularization in “A549L-derived tumor xenografts” . Exosomes are composed of angiogenic factors for efficient vascular endothelial migration, proliferation, and formation of basement membranes, which promotes the synthesis of neovascularization networks towards tumor cells during nutrient and oxygen deprivation. For instance, MSC-derived exosomes enhance angiogenesis towards tumor cells by promoting the activation of ERK1/2 and p38-MAP Kinase signaling . Prior reports have demonstrated the extensive activity of HIF-1α during hypoxia to release high exo-miR-210 from metastatic cancer cells for angiogenesis .
| 5 | 0biomedical
| 0Study
|
193,325 |
Accumulating data show a need for preclinical models to test preventive and/or treatment strategies. Several preclinical studies might serve as steppingstones for future clinical research. For example, a cannabinoid type-2 (CB2) receptor inverse agonist (SMM-189), used to treat blast-induced mTBI, significantly reduced neuronal injury, neurophysiological abnormalities, and functional deficits (136). Other studies specifically target glutamate receptors for LIB injury treatment. A study focusing on comorbid blast-induced mTBI used BCI-838 (MSGS0210), a Group II metabotropic glutamate receptor (mGluR2/3) antagonist (BCI-838), which reduced PTSD-like behavior, anxiety, fearful behavior, and long-term recognition memory impairment (104). Memantine remains among treatment options, exhibiting a potential to mitigate neuropathological and behavioral outcomes in mTBI and lessen PTSD-like behavior (137–140). As no FDA-approved treatments for TBI exist, this article provides a preview of opportunities for therapeutic research using preclinical modeling platforms.
| 4 | 0biomedical
| 2Review
|
212,054 |
Table S4 and Table S5 show the TSP concentrations of all the process samples measured in the workplace. The highest GM concentrations of the samples were for Cr plating (6.15(GSD, 3.35) mg/m3). As a result of ANOVA test, GM concentrations of every process were statistically significant, showing that the process samples have different exposure aspects during product creation. Differences in GM concentrations and daily variation were statistically significant among the anodizing and electroplating, post-treatment, pre-treatment, and other processes. For the pre-treatment process, the average TSP concentration of degreasing was similar to that of etching and neutralization; however, the range was much higher than that of etching and neutralization. Anodizing and electroplating have similar soft and hard anodizing aspects, whereas Cr electroplating has a much higher concentration than all the processes. During the post-treatment process, the average TSP concentration of sealing has the highest average, whereas coloring and polishing have a wide concentration range. In the “other” processes, the TSP average concentration was generally lower. However, the drying and packaging and Cr cleaning processes have sufficient concentrations (Fig. 2).Figure 2Bar plots of the TSP concentration air in all the processes. The TSP concentrations are arithmetic means. Values are median (line within box), mean (dotted line within box), 5th and 95th percentiles (bottom and top of box, respectively), minimum (lower bars on whisker), maximum (upper bars on whisker). DG Degreasing, EN Etching & Neutralization, S1 Soft Anodizing_1, S2 Soft Anodizing_2, H1 Hard Anodizing_1, H2 Hard Anodizing_2, CP Chromium plating, C1 Coloring_1, C2 Coloring_2, SL Sealing, PL Polishing, NP Non polishing, DP Drying & Packaging, CC Chromium cleaning, B1 Blank (Plating & Anodizing), B2 Blank (Drying & Packaging).
| 4 | 0biomedical
| 0Study
|
53,160 |
The primers for Sanger sequencing are shown in Table 3. Sequencing was performed by fluorescent dideoxy-nucleotide termination on the ABI Prism 3730xl DNA Sequencer (Applied Biosystems, USA) at Map Biotech (Shanghai, China). The sequence data were analyzed with Bioedit V7.0.9.0.Table 3Primers sequences for Sanger sequencing.GeneCodePrimersCYP2C19*2rs4244285AAAGCAGGTATAAGTCTAGGAAATGATAAAGTCCCGAGGGTTGTTCYP2C19*3rs4986893CAATCATTTAGCTTCACCCTGTTGGGATATTCATTTCCTGTGCYP2C19*17rs12248560GCCCTTAGCACCAAATTCTCTCACCTTTACCATTTAACCCCCPON1rs662GGATTGTATCGGCAGGACACTTGCCATCGGGTGAABCB1rs1045642GGCAAAGAAATAAAGCGACTGGGTAAAGGTAACAACTAACCCAAAC
| 4 | 0biomedical
| 0Study
|
162,553 |
Radiation induces side effects such as dysbiosis and disrupted mucosal homeostasis. Ferreira et al. conducted a cohort study to elucidate the association between gut microbiota and radiation enteropathy caused by pelvic radiotherapy. They found that bacterial diversity was significantly associated with acute radiation enteropathy rather than late enteropathy. A higher, but dynamically decreasing abundance of SFCAs was observed in early enteropathy cohorts. This was accompanied with an increasing abundance of their producers including Clostridium IV, Roseburia, and Phascolarctobacterium, along with a decreasing cytokine level (e.g., IL7, IL‐12, IL‐15, and IL‐16) which regulated microbiota homeostasis.[ 167 ] The effect of FMT on protecting recipients from radiation‐associated toxicity is a direct proof for the role of microbiota in radiation syndromes. A recent pilot study by Ding et al. established the safety and efficacy of FMT in treating chronic radiation enteritis (CRE). FMT showed satisfactory improvements that was marked by alleviation of diarrhea, rectal hemorrhage, abdominal/rectal pain, and fecal incontinence in three of the five persistent CRE patients. However, the effect was not long lasting. Diversity of gut microbiota was increased in three cases after FMT and the Karnofsky Performance Status was enhanced in all the responders.[ 168 ] Gerassy‐Vainberg et al. found that pelvic radiotherapy transformed the naive gut microbiota to a more pro‐inflammatory profile which contributed to radiation proctitis in mice. The microbiota from postradiation mice induced TNF‐α and IL‐1β secretion in intestinal epithelial cells in vitro compared with naïve microbiota.[ 169 ] Another side effect of radiotherapy, intestinal fibrosis, can also be ameliorated by FMT. This is attributed to the HDAC inhibitive activity of SCFAs.[ 109 , 110 ] Probiotics Bacillus licheniformis has been exploited as a candidate of bacteriotherapy to relieve radiotherapy‐induced gastrointestinal symptoms in pediatric patients. B. licheniformis preparation inhibited endotoxin, C‐reactive protein along with TNF‐α, IL‐1b, and IL‐6 in serum to alleviate the gastrointestinal inflammatory lesion.[ 170 ]
| 5 | 0biomedical
| 2Review
|
15,494 |
More new HIV infections occur in stable discordant couples in sub-Saharan Africa than in any other group [12–14]. Coburn and colleagues designed a mathematical model to assess HIV transmission rates in discordant couples in 14 African countries and found that transmission can be as low as 1.9 per 100 person-years to as high as 19.0 per 100 person-years with the difference depending on the proportion of the population in stable relationships . Studies that assessed risk for transmission among discordant couples found that in Uganda, factors such as lack of male circumcision, cohabitation, and low CD4 counts were associated with being seroconcordant HIV positive rather than serodiscordant . In Kenya, additional factors included HSV2 infection in both partners . The risk for women principally comes from the sexual behaviour of their sexual partner.
| 4 | 0biomedical
| 0Study
|
129,525 |
For treatment initiations, the least‐specialized mechanisms (<10% KP, n = 9) made up 32.7% (7928) of the total KP treatment target in FY2018, whereas the most‐specialized mechanisms (50%+ KP, n = 10) made up 54.1% (13,110). 45.1% (10,938) of the total KP treatment targets went to eight mechanisms which only had treatment targets for KPs. In FY2019, the least‐specialized mechanisms (<10% KP, n = 55) made up 59.8% (27,287) of the total KP treatment target, whereas the most‐specialized mechanisms (50%+ KP, n = 6) comprised 10.6% (5276). Purely KP treatment partners comprised only two mechanisms and 2.4% of total targets.
| 2 | 0biomedical
| 0Study
|
303,861 |
Spleen tissues were collected from the small mammals, preserved in RNAlater solution (Sigma–Aldrich), and stored at −20 °C. Genomic DNA was extracted from the spleen tissues using the Genomic DNA mini kit (tissue) (Geneaid, Taiwan); we followed the manufacturer’s instructions for all procedures. R. typhi genomic DNA was obtained from the Lao-Oxford-Mahosot Hospital-Wellcome Trust Research Unit (LOMWRU) and used as a positive control. All samples were tested for rickettsia using nested PCR assays. PCR amplification of 382 bp of gltA was carried out using primers previously described by Kuo et al. (2015): RpCS.877p and RpCS.1258n for the 1st round of PCR, followed by the amplification of 338 bp of gltA using RpCS.896 and RpCS.1233n primers in the 2nd round of PCR . The PCR conditions used were as follows: PCR was performed in 20 μL of sample, consisting of 0.4 µM of each gltA forward and reverse primer, 200 µM of each deoxy nucleotide triphosphate, 1.25 U of GoTaq® DNA polymerase (Promega Corp., Madison, WI, USA), 1× PCR buffer, and 1 µL of DNA template. All samples were tested in two replicates. DNA fragments were pre-denatured at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 45 °C for 30 s, extension at 72 °C for 55 s, and post extension at 72 °C for 10 min on an MJ mini thermal cycler, Biorad. Gel electrophoresis was performed with a 1.5% agarose gel stained with 2.5% RedSafe™ (iNtRON Biotechnology, Inc., Seongnam-si, Korea), which was used for DNA product separation and visualized under UV fluorescence.
| 4 | 0biomedical
| 0Study
|
281,615 |
In addition, analysis of the gene coding region showed some variants with deletions. Based on the deduced rRNA secondary structure (Figure 4), these variants appear to be pseudogenes. Similar degraded 5S rDNA sequences have been described for many eukaryotic organisms, especially fishes (Rebordinos et al., 2013; Barman et al., 2016), crustaceans (Perina et al., 2011), and plants (Sergeeva et al., 2017; Volkov et al., 2017). Other molecular pathways than those leading to “concerted evolution” likely contribute to shaping the landscape of plant 5S rDNA (Nei and Rooney, 2005).
| 4 | 0biomedical
| 0Study
|
150,000 |
At the conclusion of the test session, participants rate the level of aversiveness of the tone and take the state anhedonia surveys (FCPS and DARS) and state anxiety survey (STAI) again. We expect only participants from the yoked group to show increased state anhedonia and anxiety scores.
| 3 | 0biomedical
| 0Study
|
213,807 |
The annual Global Report on Food Crises 2020 by the Food Security Information Network (FSIN) indicates that the world is facing an unprecedented food crisis1. As a source of low-cost and high-quality animal protein, poultry production not only meets the basic nutritional needs of humans, but also is an important contributor to the economies and cultures, and thus the demand for poultry egg and meat is increasing2. Egg safety is absolutely pivotal to the success of today’s poultry industry, however, egg contamination with pathogenic bacteria is considered one of the leading causes of economic loss in the poultry industry worldwide and represents a threat to public health3,4. Furthermore, faced with current environmental pressures and animal welfare requirements, the modern poultry industry, which relies on the extensive use of artificial incubation, is more dependent on strict biosecurity of the egg5.
| 4 | 0biomedical
| 2Review
|
257,008 |
Effect of shRNA-based lentiviral knockdown of IGF1 and WNT4 in skin reconstitution models. (A) Examples of H&E stained sections. Scale bar: 250 μm. (B,C) Quantitation of epidermal thickness. (B) Individual lentiviral-targeted NHDF: female 22-year-old breast skin (F22Br), female 36-year-old breast skin (F36Br), female 44-year-old breast skin (F44Br), and 60-year-old breast skin (F60Br). (C) Pooled data from the four individual lines in (B). One-way ANOVA, Dunnett’s multiple comparisons test compared with shControl. Error bars represent SD of data points. ***p < 0.001. Data collection as in Figure 5, except that n = 1 DED for each lentiviral-targeted cell line and n = 2 for control (no NHDF) DEDs.
| 4 | 0biomedical
| 0Study
|
297,162 |
The attribute of gray-level distribution is determined for an image area based on its pixels, whereas its properties are quantified and exploited through space relations fundamental to the gray-level distribution . When using this type of analysis, if the picture is a derivative f(x,y) of space parameters x and y, (x = 0, 1, …, N − 1 and y = 0, 1, …, M − 1), then f(x,y) has distinct values i = 0, 1, …, G − 1, where G is the whole number of the image strength degree . The strength degree histogram is a metric that exhibits the number of image pixels using the intensity as defined in Equations (1) and (2): (1)hi=∑x=0N−1∑x=0M−1δfx,y,i where δ(j,i) is the Kronecker delta function: (2)δj,i=1 , j=i0, j≠i
| 4 | 0biomedical
| 0Study
|
285,196 |
Time-of-flight mass spectrometry was used to perform the untargeted metabolomics by injection electrospray. Metabolites of plasma samples from the participants were identified at General Metabolics’ labs according to previous methodology . No restriction (e.g., eating, drinking or smoking) was applied before collecting blood samples from the participants. In a fixed time-frame (8-11 AM), venous blood was collected in sterile 10-ml EDTA BD Vacutainer® tubes and the collected samples were frozen and stored before metabolite identification. Mass-to-charge ratio (ion m/z) was used to identify metabolites. Specifically, the relative ion intensities in counts of interested metabolites (seven types of phosphatidylserines) from 174 participants were selected for downstream analysis.
| 4 | 0biomedical
| 0Study
|
314,930 |
The data for the pH of breast muscle firstly increased and then decreased with the increase of the level of dietary Fe. Conversely, the data for drip loss decreased first and then increased. The data change for pH and drip loss of breast muscle accorded with the QP models, therefore, they were selected out for further analysis by QP regressions related to the dietary Fe level (Figure 1 and Figure 2, Table 6). According to the optimal dietary Fe response from regression models in Table 6 and the average daily feed allowance of 120 g, the daily Fe fed allowance of Chinese Yellow broilers were 12.96 or 10.68 mg during 43 to 63 days.
| 4 | 0biomedical
| 0Study
|
363,303 |
We then consider a multijunction cell working under negative illumination conditions and combine the cell with solar heating by adding a top solar absorber (Fig. 2d). The solar absorber and the cell exhibit the angle-selective characteristics discussed earlier. Similar to the setup in Fig. 1d, the cell is heated by the top heating layer when the cell is performing negative illumination. The maximum efficiency of this system reaches 88.71%. This efficiency also significantly exceeds the previously established 86.8% multicolor limit for solar energy harvesting. Compared to the previously discussed single-junction cell working under negative illumination conditions and solar heating with an efficiency of 86.99%, the multijunction cell configuration further improves the efficiency.
| 4 | 0biomedical
| 0Study
|
276,881 |
In this study, data on 2759 patients with the diagnosis of acute hip fractures who were surgically treated at the 3rd Hospital of Hebei Medical University between June 2016 and June 2019, were retrospectively collected. All patients who adhered to the following criteria were included: age ≥ 65 years and experiencing both D-dimer test and DUS preoperatively. D-dimer level is susceptible to various factors from trauma, age, malignancy, acute hemodynamically instable events, and the previous history of VTE or the current anti-coagulation medications [7, 24, 28]. For ruling out their strong impact of these driving factors, we pre-defined the more stringent criteria. Patients were excluded if they had suffered a VTE within the three months before the index hip fracture, high-energy accident, long-term injured-limb immobility or the significant delay to admission, concomitant suspicion of PE, ongoing anticoagulant treatment, multiple fractures, acute episode (acute infection, acute heart failure, etc.), malignancy, incomplete data. The demographic data (age and sex) were collected from the clinical medical records. The D-dimer test results and DUS results were extracted from the laboratory department and the imaging department, respectively. If there were multiple preoperative examinations for one patient, we only selected the initial result to analyze. The flow diagram for the patient selection is shown in Fig. 1.Fig. 1Flow diagram of the study. Of 3972 aged patients with hip fracture admitted to hospital. 1213 patients who did not meet the inclusion criteria were excluded. Of the 2759 left. Of those patients, 2479 did not had DVT and 280 did
| 4 | 0biomedical
| 0Study
|
133,580 |
Testing glass fibre-reinforced polymer (GFRP) in pulsed mode, with forced air-cooling and with control of specimen surface temperature, it was shown that ultrasonic fatigue testing could be an appropriate technique for gathering valid fatigue data of FRPC . Ultrasonic tests were performed with a static load superimposed to the resonance vibration to realise load ratio R = 0.1. Figure 16 shows the results of ultrasonic and servo-hydraulic fatigue tests of quasi-unidirectional GFRP (90% of the fibres aligned in the main direction while 10% of them are woven transversally for stabilisation) with a fibre volume fraction of 60%. Fatigue strengths measured with both techniques agree well, which indicates the suitability and reliability of the developed ultrasonic testing method.
| 4 | 0biomedical
| 0Study
|
258,554 |
The subjects were competitive amateur male swimmers (n = 20) with no experience in any exercise and training program in normobaric or hypobaric hypoxia (Table 1). They were equally assigned to the normoxic training group (NTG; n = 10) or hypoxic training group (HTG; n = 10) according to endurance exercise performance and body composition. We explained the experiments and possible side effects to all amateur male swimmers prior to the start of the study and obtained signed consent for participation. The present study was approved by the Institutional Review Board of Konkuk University (7001355-201510-HR-090) in Korea and was conducted in accordance with the provisions of the Declaration of Helsinki.
| 4 | 0biomedical
| 0Study
|
288,718 |
The development of EAE is dependent on the timing of platelet depletion , and not only prophylactic but also therapeutic treatment with low-dose ASA demonstrated a reduction in EAE symptoms. In addition, it is widely accepted that autoreactive T cells generated in the periphery migrate across the BBB, inducing disseminated inflammatory lesions within the brain parenchyma, leading to demyelination. Therefore, a prophylactic treatment might influence this early lymphocytic activation in contrast to a therapeutic application. Subsequently, prophylactic ASA treatment may thereby reduce immune cell infiltration into the CNS, explaining the more pronounced amelioration of the EAE clinical course compared to therapeutic application.
| 4 | 0biomedical
| 0Study
|
392,081 |
Patients generally rated their therapist extremely well. Aside from four items, the highest possible rating was given for all other items in the survey. Ratings of 5 or 6 were given for the four items: “My therapist is an expert in my treatment,” “My therapist knows how to treat my health problem,” “My therapist shares the same values as me,” and “My therapist offers advice beyond the immediate health problem”.
| 1 | 2other
| 1Other
|
46,336 |
The synthetic tumor samples had consistently had 0 false positives at 25% tumor titers. In the 15% sample, there was 1 false positive detected, and in the 5% sample there were 0 false positives detected of the 110 total variants. These findings result in an algorithmic PPV of 1.00, 0.99, and 1.00, respectively. Subsequent to PPV analysis, samples were analyzed for algorithmic sensitivity. In the 25% synthetic tumor titers, there was consistently 1 false negative variant left out by the pipeline. In the 15% sample, there was 1 false negative variant missed by the pipeline, and in the 5% sample, 6 false negatives were missed of the 110 variants. These findings result in an algorithmic sensitivity of 0.99, 0.99, and 0.93, respectively.
| 4 | 0biomedical
| 0Study
|
20,049 |
The assessment of QoL using the Acro-QoL indicated that individuals who were employed had higher scores for the overall domain, psychological domain, and personal relationship domain in the bivariate analysis. This result was maintained in the multivariate regression analysis after adjustment for sex and age. Being part of the workforce is a factor that is historically associated with a better QoL [20–23]. Some studies have shown a strong relationship between a poor QoL/health and unemployment [24–26]. The study by Giatti et al. indicated that unemployment was associated with increased morbidity and mortality and the adoption of behaviors that could negatively affect health.
| 4 | 0biomedical
| 0Study
|
244,523 |
Risk stratification in AS with either echocardiographic LV GLS, the clinical risk score or other approaches would need to be guided by local expertise and availability of resources. LV GLS, as a marker of replacement fibrosis, has incremental prognostic value over conventional prognostic markers such as LVEF, AS severity and E/e′. These observations may impact future management of AS. Potentially, asymptomatic patients with moderate to severe AS and preserved LVEF can be further risk-stratified using echocardiographic LV GLS. Patients at intermediate risk may benefit from further risk stratification with CMR (for replacement and diffuse myocardial fibrosis), computed tomography aortic valve calcium score and/or exercise stress testing. Whether these patients identified to be at high-risk would benefit from early AVR would need to be guided by future trials.
| 4 | 0biomedical
| 0Study
|
162,178 |
Conceptually, exoskeleton training could also be used in combination with electrical stimulation to increase physical activity and place gravitational load on the lower limbs. A number of bionic exoskeletons are now FDA approved for assisting walking after SCI, including EksoTM, RewalkTM, and Indego® systems, as well as the implanted neuroprostheses, Parastep® 1, which uses functional neuromuscular stimulation (FNS) to generate a majority of the muscular torque required to move and stabilize the lower extremities. These exoskeletal ambulation devices can significantly improve cardiovascular and psychological health . However, unfortunately, there is no evidence to suggest that use of these devices can protect against or reverse SCI-induced bone loss. As part of a multicenter study evaluating the effectiveness of the Parastep® 1, Needham-Shropshire et al. assessed bone mineral density in the proximal femur. Sixteen people, at least six months post SCI, completed 32 sessions (three sessions per week over 11 weeks) of Parastep® 1 ambulation training and an additional eight weeks of FNS training There were no changes in bone mineral density in the proximal femur. Similarly, Thoumie et al. reported no beneficial effects of training, with the RGO-II hybrid orthosis, on bone. The lack of effects seen with exoskeleton training could stem from limitations in the duration of walking, which is significantly constrained by fatigue. Indeed, more recently, Karelis et al. reported a tendency for an increase (14.5%) in the bone mineral density of the tibia with use of the battery-powered, motor driven Ekso robotic exoskeleton system, at least three times per week for up to 60 min of free overground walking. Powered exoskeletons that enable increased time spent walking may impact bone. Delayed onset of rehabilitative training might also limit the effectiveness of exoskeleton training. In the Parastep evaluation, training was not initiated until at least six months post injury. Based on the findings of the present study in mice, however, the lower gravitational loads placed on the leg bones when using orthotic devices may be the most critical limitation for osteogenic efficacy. The orthotic components of ambulatory systems are designed to protect the insensate joints and osteoporotic bones of users from possible damage with loads applied during walking . Moreover, ground-reaction forces increase as walking speed increases . Slower walking in orthotic devices would place less compressive force on the bone, and potentially limit the effects of training on osteogenesis. According to Frost’s mechanostat theory , there is an optimal range of mechanical loading essential for osteogenesis. The range of mechanical loading that is required to reduce or reverse bone loss after SCI needs to be determined .
| 4 | 0biomedical
| 0Study
|
87,461 |
Thirteen expression-changed unigene sequences including five CytochromesP450 (P450) genes, five glutathione S-transferase (GST) genes, two AChE genes, and one reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were confirmed by qRT-PCR. Specific primers were designed using Primer premier 5.0, and then reverse transcription PCR was conducted. After electrophoresis of the PCR products, the DNA band was extracted by Agarose Gel Extraction kit (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China), and then subcloned into vector (pEASY-T1 Simple Cloning Kit, Beijing TransGen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s protocol. A 3730 DNA Analyzer was used to determine the nucleotide sequences. The confirmed sequences were deposited in the GenBank database with the accession numbers KY997061-KY997073, and MG407793-MG407796.
| 4 | 0biomedical
| 0Study
|
389,404 |
Interestingly, common activation also included the OPA (see blue spot in the close-up of Fig. 6a), which in turn overlaps with multiple atlas-based maps, including IP0, V3B, V3CD, V4, and visual fields map LO1. Note that pIPS/V3A and OPA are partially overlapped in correspondence of V7 and V3B (see next paragraph).
| 4 | 0biomedical
| 0Study
|
351,245 |
Therefore, the higher methacrylation degree and concentration of photoinitiator used in the synthesis led to an improved mechanical behavior of GelMA. This fact is related to the formation of a more close-packed GelMA network as a consequence of the crosslinking reaction between more methacryloyl groups and initiation centers, as the calculated values of cross-linking density υ indicated (Figure 12). All these results are in good agreement with other studies conducted on hydrogels and GelMA hydrogels .
| 4 | 0biomedical
| 0Study
|
247,628 |
To identify mutation patterns that reflect the P. aeruginosa fitness increase in the WBN and the fitness decay in the SBN cell lines, we performed a more in-depth mutation analysis. The rate of intragenic as well as intergenic nucleotide substitutions did not differ between WBN and SBN cell lines of P. aeruginosa or S. enterica. However, the intragenic mutation rate was ~25% higher in P. aeruginosa as compared to S. enterica (p < 0.001, Mann–Whitney test) (Fig. 4). Among the genes that harbored intragenic nucleotide substitutions, we did not identify an enrichment of any Clusters of Orthologous Groups (COG) functional category in the WBN or SBN cell lines, in both P. aeruginosa and S. enterica. Taken together, despite the overall higher single nucleotide polymorphism (SNP) rates in P. aeruginosa, no differences in nucleotide substitution rates between WBN and SBN cell lines in either of the species were detected, indicating that there was no clear selection pattern for SNPs in the various bottlenecking conditions of our MA experiment.Fig. 4The rates of nucleotide substitutions and indels according to location in coding and intergenic regions.The individual values, the mean values, and the standard deviations for each class of mutations and each experimental group are shown. All the mutation rates are normalized to the number of generations in the corresponding experimental group. The rates of nucleotide substitutions and indels in the coding regions are normalized to the total length of coding regions in the corresponding species. The rates of nucleotide substitutions and indels in the intergenic regions are normalized to the total length of intergenic regions in the corresponding species. The differences between growth parameters were calculated using the Mann–Whitney test. * corresponds to p < 0.05, ** corresponds to p < 0.01, and *** corresponds to p < 0.001.
| 4 | 0biomedical
| 0Study
|
133,587 |
Phase transformation and associated fatigue damage were studied in the shape memory alloy Nitinol . In situ synchrotron experiments successfully demonstrated the occurrence of the forward and reverse transformation between the material’s austenitic and martensitic phases in a super elastic state at ultrasonic frequencies.
| 4 | 0biomedical
| 0Study
|
347,440 |
SHEE cells transfected by siRNA were collected through centrifugation and RIPA lysis buffer was added (50 nM Tris-base, 1%NP-40, 0.25%SOD, 150 mM NaCl, 1 mM EDTA, 0.1%SDS, 1 mM Na3VO4, 1 mM NaF, 1 mM PMSF, and 10 μl protease inhibitor). Then cell protein lysates (50 μg) were electrophoresed through 10% SDS-PAGE gel according to the protein concentration measured by a protein assay kit (Beyotime Institute of Biotechnology), and the protein bands were transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk for 1 h at room temperature. After being washed with TBS, the PVDF membranes were incubated with primary antibody against p53 (1 : 1000) at 4°C overnight. The next day, the membranes were incubated with HRP-IgG secondary antibody (1 : 10000) for 2 h at room temperature and were scanned by Odyssey Clx (Licor, US).
| 4 | 0biomedical
| 0Study
|
66,719 |
In particular the reflectivity of electronic states is maximal when their energy matches with the upper edge of the potential step (see ref. 23 and Supplementary Method 1). It is however minimum at the bottom of the step. Therefore, the potential step height is a built-in energy-scale that should be found in the experimental gate-dependence of the transverse voltage.
| 4 | 0biomedical
| 0Study
|
224,461 |
Hf-QC was synthesized through a solvothermal reaction between HfCl4 and H2QC in a mixture of N,N-dimethylformamide (DMF), acetic acid, and water at 80 °C (Figure 2a). Transmission electron microscopy (TEM) imaging of Hf-QC revealed a hexagonal nanoplate morphology with a diameter of ∼150 nm while atomic force microscopy (AFM) showed a plate thickness of ∼64 nm (Figure 2b,d). Dynamic light scattering (DLS) measurements of Hf-QC gave a number-averaged size of 167.1 ± 2.9 nm (Figure 3c). Powder X-ray diffraction (PXRD) studies (Figure 3b) showed that Hf-QC adopted the same hcp topology as previously reported Zr12-QPDC (QPDC = para-quaterphenyldicarboxylate).43 High resolution TEM (HRTEM) imaging and fast Fourier transform (FFT) pattern of Hf-QC revealed a lattice point distance of 2.3 nm and displayed a 6-fold symmetry (Figure 2c, Figure S15), which matched well with the modeled structure for Zr12-QPDC. 1H nuclear magnetic resonance (NMR) analysis of digested Hf-QC showed an acetate (OAc) modulator to QC linker ratio of 0.11:1, corresponding to approximately 0.5 missing linkers per SBU (Figure S11). Thermogravimetric analysis (TGA) of Hf-QC showed a weight loss of 39.4% in the 300–800 °C region, matching the expected value of 37.9% for the Hf-QC with a 0.5 linker defect per SBU (Figure S14). On the basis of these results, Hf-QC was formulated as Hf12(μ3-O)8(μ3–OH)8(μ2–OH)6(QC)8.5(OAc).
| 5 | 0biomedical
| 0Study
|
28,970 |
where ΔTWSi is the change in glacier and snow mass for the ith month compared to the previous month (in this case, ΔTWSi = Ai−Mi is calculated as the difference of GRACE-interpreted TWS anomalies for the ith month and the previous month), and Ai and Mi represent the accumulation and melt of glacier and snow. Ai is calculated using snowfalli and conversion coefficient β, while β is related to temperature (Tmax refers to the maximum temperature). Higher temperatures result in low β, and less snowfall converting to glacier and snow cover. α is a coefficient used to reduce the impact of temperature on glacier accumulation, here we assume α = 0.4, with d being the melt factor and Tmlt the melt base temperature.
| 4 | 0biomedical
| 0Study
|
86,679 |
Biological samples underwent centrifugation (30 sec at 14,000 rpm) to remove large aggregates and then separated using a 10 kDa spin filter (2 min at 12,000 rpm) to remove all large proteins and other particles. In particular, this would remove all SNO-degrading enzymes and all Cu binding proteins. There is no significant concentration of free Cu(II) in the blood serum we use for detection and hence no Cu-mediated degradation of SNOs is likely.
| 4 | 0biomedical
| 0Study
|
346,344 |
Gene ontology (GO) enrichment analysis52 was used to identify the molecular function, biological process, and cellular component of genes (https://www.geneontology.org). Gene set enrichment analysis (GSEA) is an enrichment method used to define the molecular function of different phenotypes53,54. A permutation test was used to define whether the bottom- or top-ranked genes were enriched in pre-ordered gene sets. The above enrichment methods were performed by R ClusterProfiler packages, the webgestalt tool (https://www.webgestalt.org/option.php), and GSEA software.
| 4 | 0biomedical
| 0Study
|
357,232 |
To further substantiate the function of bmp2a and bmp5 in PAA development, we generated one genetic mutant line for each gene using CRISPR/CAS9 technology. The mutant allele of bmp2a or bmp5 carries a DNA deletion near the gRNA targeting sequence in the first exon, resulting in a premature stop codon and presumably a truncated protein lacking the prodomain and C-terminal mature peptide (Fig. S12A,B). In situ hybridization results revealed that about 50% of bmp2a−/− and bmp5−/− mutants, which were confirmed by genotyping, showed defective development of the hepatic bud or neural crest cells (Fig. S12C,D). However, there was no compensational increase in the expression of bmp2a or bmp5 in relevant mutants (Fig. S12E,F), suggesting that the incomplete penetrance is not due to compensatory functions between these two genes.
| 4 | 0biomedical
| 0Study
|
139,759 |
Relative concentration (compound concentration/total concentration) for PAH assemblages, using median values to characterize each random forest (RF) group (right axis). Petrogenic/pyrogenic origins of each RF group were characterized using parent and associated alkylated compounds (gold and purple, respectively). High and low molecular weight PAHs are defined in Table 1. All RF groups are predominantly pyrogenic; however, RF3 showed signs of weathering due to higher perylene concentration
| 3 | 0biomedical
| 0Study
|
346,541 |
In contrast, we clearly observed fluorescence from the micro-rings. As seen in the spectra, the large ring emits EtBr fluorescence (detected at position 3), while the small ring emits YOYO-1 fluorescence (detected at position 2). This means that the large ring consists of λ-DNA, while the small ring consists of φx DNA. In this way we succeeded in separating two kinds of DNA and patterning them into micro-rings by means of plasmonic optical tweezers.
| 4 | 0biomedical
| 0Study
|
331,953 |
• The presented cut-offs used were based on three previous publications. Unfortunately only one was displayed in the method section whilst others were displayed in the footnote of table 2. We have added the footnotes to the methods (line 116 page 4): For sTfR we used 2.7 mg/l and 3.6 mg/l and for the sTfR-index: 1.8 and 2.2, 2.8 respectively, as no international cut-offs have been defined, these represented the most resent consensus (21-23).
| 3 | 0biomedical
| 0Study
|
170,006 |
Cellular NADPH/NADP + ratio assay was performed according to the manufacturer’s instructions (Abbkine, Wuhan, China). Cells treated with 8 mM VC were collected after trypsinization. Next, the intracellular NADP+ and NADPH were extracted, placed on ice and added with 80 μl working solution quickly. Then, the solution was mixed gently and the light absorbance was measured at 565 nm using a Multiskan FC apparatus. After incubation for 30 min at room temperature, the light absorbance values were measured again and the NADPH/NADP + ratio was calculated as the instructions described.
| 4 | 0biomedical
| 0Study
|
246,000 |
However, because 3D CNN and spatiotemporal patterns in video are too complex, the training of the end-to-end is usually time consuming. Simonyan and Zisserman (2014) proposed a two-stream approach, which breaks down the representation learning of video into two separate parts, a spatial CNN for spatial feature learning and a temporal CNN for temporal clues . Wang et al. (2016) presented a framework for action recognition in videos and proposed a temporal segment network-based ConvNet, which operates on a sequence of short snippets sparsely sampled from the entire video instead of working on single frame, to tackle the inability of the traditional two-stream ConvNets in modeling long-range temporal structure . Carreira et al. (2017) introduced a new two-stream inflated 3D ConvNet, I3D, in which filters and pooling kernels are expanded into 3D to learn spatiotemporal features from video . However, it is hard for ConvNet to tackle complicated actions happening over a long time due to failing to consider the order of frames . Therefore, recently, RNN (Recurrent Neural Network) is used in many researches to account for the temporal dynamics in videos. Wu et al. (2015) presented that LSTMs (Long Short Term Memory) and CNNs are highly complementary and fused them to jointly model spatiotemporal clues for video classification . Donahue et al. (2017) proposed a Long-term Recurrent Convolutional Networks for video recognition problems, in which a CNN processes the variable-length visual input and its outputs are then fed into an LSTM to produce a variable-length prediction finally .
| 5 | 0biomedical
| 2Review
|
379,665 |
When the structural steel sample is subjected to tensile stress and the magnetostriction coefficient is positive, a magnetic field can be applied in the direction parallel to the tensile stress of the structural steel sample, leading to the behavior shown in Figure 2. Due to the positive magnetostriction coefficient values of the samples , the magnetic flux of the structural sample is employed in this paper to study the stress detection by analyzing the mechanism of the changes in tensile stress and magnetic properties of tensile structural steel specimens under the principles shown in Figure 2.
| 1 | 2other
| 0Study
|
38,658 |
Table 2 shows the mineral contents of the formulated complementary foods from the blends of sorghum, Irish potato, and groundnut flour samples. Calcium ranged from 101.33 to 121.33 g/100 g in unsprouted sorghum–Irish potato–groundnut flour samples and ranged from 91.00 to 103.00 g/100 g/100 g in the sprouted sorghum–Irish potato–groundnut flour samples. Potassium ranged from 535.00 to 766.67 g/100 g in the sprouted sorghum–Irish potato–groundnut flour samples and ranged from 106.00 to 956.00 g/100 g in the unsprouted sorghum–Irish potato–groundnut flour samples; sodium ranged from (25.00 to 108.00 g/100 g) in the sprouted sorghum–Irish potato–groundnut flour samples and ranged from (67.33 to 106.00 g/100 g) in the unsprouted sorghum–Irish potato–groundnut flour samples; and iron ranged from 6.60 to 7.60 g/100 g in sprouted sorghum–Irish potato–groundnut flour samples and ranged from 8.70 to 8.73 g/100 g in the nonsprouted sorghum–Irish potato–groundnut flour samples. Copper ranged from 0.80 to 1.29 g/100 g in the sprouted sorghum–Irish potato–groundnut flour samples and ranged from 0.60 to 0.70 g/100 g in the unsprouted sorghum–Irish potato–groundnut flour samples. Sprouted samples are significantly lower compared to the unsprouted samples this could be as a result of soaking during processing. Potassium is an essential nutrient needed for maintenance of total body fluid volume, acid and electrolyte balance, and normal cell function (Young, 2001). Effect of increased potassium intake result into blood lipids and other possible adverse effect (WHO, 2012), Calcium is an essential nutrient in the mineralization of bones and teeth and for regulating intracellular event in body tissues. It plays a role in muscle contraction and nerve function (Deborah, 2007). Inadequate calcium combined with adequate energy and protein intake may result in low calcium content of bone, which has implications for bone health later in life (Deborah, 2007). Iron is essential for the function of mammalian cells and development of the central nervous system, Iron is required for the production of red blood cells, transportation of oxygen from the lungs through the arteries to all cells throughout the body (Beard & Dawson, 1997). Iron deficiency in infants causes anemia, which occurs when stored iron is exhausted in the body and its metabolic demands are not met (WHO, 2016). They function in the synthesis of hemoglobin and myoglobin; Copper has an antioxidant role that protects cell‐free radical injury (Voskaki et al., 2010). It also contributes to the formation of ceruloplasmin. Deficiency of copper in infants leads to anemia, neutropenia, impartment of growth, abnormalities in glucose, and cholesterol metabolism (Shazia et al., 2012). Sodium is the principal cation in extracellular fluid in the body and is an essential nutrient necessary for the maintenance of plasma volume, acid‐base balance, transmission of nerve impulses, and normal cell function. Increased sodium consumption is associated with hypernatremia (Verbalis et al., 2010). Calcium, copper, iron, potassium, and sodium decreased with sprouting, the higher the substitution of Irish potato flour samples, the higher the mineral content in the complementary food samples.
| 4 | 0biomedical
| 0Study
|
78,949 |
Because reports on the diagnostic value of urodynamic BOO for LUTS in men are few, a combination of these data to reach a reasonable conclusion is necessary. The objective of the present study was to conduct a systematic review and meta-analysis of published literature investigating the diagnostic value of urodynamic BOO in the selection of patients for transurethral surgery of the prostate and to provide a higher LE for guiding practical use of UDS in BPH patients.
| 4 | 0biomedical
| 2Review
|
383,655 |
A risk assessment was conducted using the estimated intakes based on the highest mean values of an individual element determined in beef and pork cuts, which were then compared with the toxicological limits. Aluminum, Cr, Ni, and Pb gave low contributions to the tolerable toxicological levels. However, the mean Cd values in beef and pork kidneys exceeded the toxicological limits. For P95 consumers, these toxicological limits were exceeded many times over. P95 consumers of beef mixed meat could also be at risk due to higher values of estimated As intake compared to the health-based guidance values. A similar risk was found for P95 consumers of beef and pork kidneys given the higher EDI values for Se compared to the ATSDR toxicological limit. The contribution of the highest mean of Cu, Fe, and Zn was estimated according to the provisional maximum tolerable daily intake values, and in conclusion, beef and pork cuts can be considered safe for consumption.
| 4 | 0biomedical
| 0Study
|
198,371 |
The in situ protein expression levels of ERa, ERb, and PGR in paraffin-embedded OV and UTEA tissue sections were detected by immunohistochemistry using rabbit polyclonal antibodies against ESR1 (1:200, 21244-1-AP, Proteintech), ESR2 (1:50, 14007-1-AP, Proteintech), and PGR (1:50, 25871-1-AP, Proteintech). Five fields were randomly observed at high power under the microscope. ERa, ERb, and PGR staining intensity of the tumor cells (0, no tumor cells stained yellow; 1, light yellow stain; 2, medium depth yellow stain; and 3, dark yellow stain) and the percentage of stained cells (0, no positive tumor cells; 1, <25% positive cells, 2, 25%–50% positive cells, and 3, > 50% positive cells) were recorded, and the sum of the two group scores ranged from 0 to 6 (17). Samples with staining scores of 0–3 were designated as ERa/ERb/PGR low expression, whereas those with staining scores >3 were designated as ERa/ERb/PGR high expression.
| 4 | 0biomedical
| 0Study
|
7,369 |
Both scenarios were simulated using the model characterized by decreasing proliferation rates (M1.V1) and these results are displayed below. Similar results were obtained using the model which also involves density-based control of growth (M2.V1), as both models behave similarly in post-natal life.
| 2 | 0biomedical
| 0Study
|
1,815 |
MiR-217, a tumor suppressor, can inhibit MALAT-1 through the Ago2-mediated pathway, and thus inhibit EMT by suppressing EZH2-mediated H3K27me3, upregulating E-cadherin and downregulating N-cadherin and vimentin in cigarette smoke extract (CSE)-induced malignant transformation of HBE cells . Similarly, the recruitment of miR-9 by 17β-Estradiol also causes decreased stability of MALAT-1 in osteosarcoma cell MG-63, and inhibits migration and invasion .
| 4 | 0biomedical
| 0Study
|
17,398 |
The tissue histology is shown in Fig. 2. The histology was performed on 4 specimens. In one case the MTA could not be retrieved. Some reabsorption was observed with all the specimens but in one case no material was found in the subcutaneous tissues. In all animals, in the subcutaneous tissue, there was necrotizing granulomatous reaction (granulomatous foreign body reaction). As in a typical foreign-body reaction, there is a chronic cell infiltrate with histiocytes and multinucleated giant cells around the material implanted that appeared eosinophilic. In addition lymphocytes were present as well as plasma cells and granulocytes. There were other features, which included cystic areas containing necrotic material surrounded by histiocytes, giant cells and leucocytes (Animal 2 in Fig. 2). At the bottom of the sample (in proximity of the deep margin) there were numerous ovoid cavities varying in size within the implanted eosinophilic material. These cavities are remnants of processing and were surrounded by an inflammatory infiltrate of macrophages and lymphocytes resulting in the typical “Swiss cheese” appearance (Animal 4 in Fig. 2). Finally there was a moderate angiogenesis and mild fibrosis (Animal 2 and 3 in Fig. 2).
| 4 | 0biomedical
| 0Study
|
75,594 |
Because the kynurenine pathway includes potent modulators of neuronal function, such as quinolinic acid as an agonist and kynurenic acid as an antagonist [40, 41], at NMDA-sensitive glutamate receptors, the relationship may provide a potential explanation of some of the neurological symptoms of HAT. However, in this study only somnolence was associated with increased kynurenine pathway activation, and because this association was confounded with the increased activation in the late stage of disease, a larger scale clinical study is required to establish the significance of this relationship.
| 4 | 0biomedical
| 0Study
|
98,716 |
We aimed to reveal which receptor is responsible for mediating Ang2-induced apoptosis in astrocyte. To determine whether Tie-2 receptor, well-known receptor for Ang2, is related with Ang2-induced astrocyte apoptosis, western blot analysis (Figure 5a) and real-time PCR (Figure 5b) for Tie-2 and Tie-1 were performed on lysates obtained from human retinal microvascular endothelial cells (HRMECs) and astrocyte. As shown in previous studies,16, 21 astrocyte did not express Tie-2 or Tie-1 while HRMECs expressed Tie-2 and Tie-1. Compared to HRMECs with Tie-2 expression, astrocyte did not express Tie-2 in FACS analysis (data now shown). Next, to determine whether integrin may serve as receptors for Ang2 in astrocyte apoptosis under high glucose, we incubated astrocyte under high glucose for 30 min with Ang2 and H-Gly-Arg-Gly-Asp-Ser-OH (GRGDS) peptides. GRGDS (0.5 mg/ml) attenuated Ang2-induced β-catenin phosphorylation (Figure 5c). This result showed that integrin signaling was involved in Ang2-induced β-catenin phosphorylation.
| 4 | 0biomedical
| 0Study
|
87,594 |
The model complex was constructed from its original geometry, where the aryl groups were replaced with methyl substituents, symmetrizing the structure to the C3v group. Initial CASSCF(3,5) calculations for the model system using the ORCA code indicate the following orbital sequence (obtained with the AILFT theory, see ab initio calculations section): dxy and dx2–y2 at a reference energy (i.e. 0.0 cm–1), dz2 at 31 000 cm–1 and (dxy, dxz) at 32 500 cm–1 (which is equivalent to the orbital diagram of Fig. 1; see also Fig. 8). Although this orbital diagram appears to be reasonable, the limitations of this reduced active space are evident in the swapping of the ground state wavefunction due to the inclusion of dynamical correlation (NEVPT2) and the prediction of a quartet state as the ground level. The addition of the σ and 2π orbitals of the N3– ligand in a CASSCF(9,8) leads to the correct spin state ordering and a NEVPT2 correction that preserves the ground state for the model structure. The lower energy orbitals in the CASSCF(9,8) calculations are still (dxy, dx2–y2), with a doubly degenerate ground state that corresponds predominantly (81% weight in both wavefunctions) to the and configurations. The next excited state is 7300 cm–1 higher in energy (10 100 cm–1 in NEVPT2) and is not relevant for discussing the SMM properties of 2. Thus, magnetic anisotropy in this system emerges from the quantum mixing of the degenerate ground state by the spin–orbit coupling (SOC), given that the dx2–y2 and dxy orbitals are connected by the z component of the angular momentum operator.2b,11b,31 In this way, two strongly anisotropic Kramers' doublets are formed from the first two S = 1/2 states, separated by 470 cm–1 (676 K). The ground doublet of the model system presents a markedly uniaxial g tensor with gz = 5.15, gx = gy = 0.15. This strong anisotropy is significantly reduced in the full system due to the deviations from trigonal symmetry that breaks the degeneracy between dx2–y2 and dxy orbitals, partially quenching the SOC mixing. In the full complex, the calculated ground state is split to an energy difference of 2103 cm–1 (CASSCF(9,8) calculation including only doublets). This splitting leads to a marked decrease of the g tensor anisotropy of the ground doublet to values of gx = 1.940, gy = 1.942 and gz = 2.674, yielding a gav of 2.185, in satisfactory agreement with the values obtained for magnetization and EPR measurements. Equivalent CASSCF + RASSI calculations performed with MOLCAS code provide similar values with a first excited Kramers doublet at 1932 cm–1 (2800 K) and gx = 1.927, gy = 1.933 and gz = 2.790 values (i.e. gav = 2.217; as mentioned above the calculated gav values is systematically slightly larger than the experimental one, around 2.1, which explains the difference between experimental and calculated magnetic susceptibility exemplified in Fig. 5). This CASSCF + RASSI approach was also used to estimate the possible relaxation mechanisms considering the two lowest Kramers doublets (Fig. 9 inset). As expected due to their large energy separation, thermally activated mechanisms of relaxation, e.g. Orbach, cannot be relevant at low temperatures. Thus, the magnetic dynamics in 2 should only involve the ground Kramers' doublet, allowing possible quantum tunnelling (QTM), direct and Raman mechanisms.
| 5 | 0biomedical
| 0Study
|
221,523 |
Two-way ANOVA in the PFC for caspase 3: no stress effect [F (1.37) = 0.1237; p = 0.7271], no treatment effect [F (3.37) = 0.9085; p = 0.4463] and no effect of interaction [F (3.37) = 2.056; p = 0.1228]; Bid: no stress effect [F (1.37) = 0.1810; p = 0.6730], no treatment effect [F (3.37) = 0.7458; p = 0.7458] and no interaction [F (3.37) = 2.192; p = 0.1054]; Bax: no stress effect [F (1.37) = 0.1801; p = 0.6737], effect of treatment [F (3.37) = 2.431; p = 0.0805] and no interaction [F (3.37) = 0.4180; p = 0.7411] for Bcl-2 no stress effect [F (1.35) = 0.1318; p = 0.2588], no treatment effect [F (3.35) = 2.322; p = 0.0920] and effect of interaction [F (3.35) = 4.427; p = 0.0097].
| 4 | 0biomedical
| 0Study
|
53,355 |
For all of the above analyses, sensitivity analyses were carried out and yielded consistent results. For the long-term follow-up (≥2 years), all the trials were excluded one by one and a new analysis was carried out each time, to find out whether there was any significant change in the results. However, no significant difference was observed and consistent results were obtained.
| 2 | 0biomedical
| 0Study
|
99,812 |
To overcome these limitations, efforts have been made to develop microfluidic-based miniaturized flow cytometers which permit analysis of small numbers of cells (100–1000) (Lindström and Andersson-Svahn, 2010). For example, Su and colleagues developed a microscope-based label-free microfluidic cytometer. It is capable of acquiring two dimensional light scatter patterns from the smallest mature blood cells (platelets), cord blood hematopoietic stem/progenitor cells (CD34 + cells), and myeloid precursor cells (Su et al., 2011). Srivastava et al. (2009) developed an integrated microfluidic device which retro-fitted to commercial. The major advantage of this microfluidic device is its ability to perform cell culture, stimulation and sample preparation in combination with conventional fluorescence imaging and microfluidic flow cytometry to monitor immune response in macrophages. These microfluidic devices not only drastically reduced the amount of sample and reagent required, but also provided a means to perform two orthogonal modes of measurements-imaging and cytometry, in one experiment.
| 4 | 0biomedical
| 0Study
|
322,762 |
In Dupuytren disease, fibrosis usually begins in the palm of the hand and extends to the fingers (the most common involved finger is the ring finger, followed by the little finger, thumb, middle finger and index finger, respectively) . Dupuytren is not usually painful; however, it gradually restricts the movements of fingers in a curved manner by forming firm bands on the palms and fingers [4, 5].
| 3 | 0biomedical
| 1Other
|
12,968 |
Important though these immediate responses are, they are no substitute for an effective political response, nationally and internationally. Many governments seem to have forgotten how, within living memory, their own citizens were fleeing oppression. For example, Hungarians, whose government has been among the most hostile to refugees, with its Prime Minister describing them as a threat to Europe’s Christian identity, were themselves welcomed in large numbers when they fled the Soviet invasion of their country in 1956. This view contrasts starkly with that of Pope Francis who memorably said “when the stranger in our midst appeals to us, we must not repeat the sins and the errors of the past” .
| 1 | 2other
| 1Other
|
42,561 |
In the study, a farm-level precision farmland management problem for pre-season seed type selection and irrigation water management is introduced. A mixed integer linear program is proposed with discussion on extensions and varieties of the basic model on different implementation conditions. Farmland in California serves as a case study to test the model's flexibility and economical optimality. The model gives qualitative descriptions and quantitative analysis for the management scale (number and shape of decision units). Special irrigation patterns are considered and the results show that the farmer's annual net profit could be significantly increased by applying one or two dimensional precision management decisions based on the proposed model. This model also serves as a decision making and risk analysis tool for farmers facing seasonal irrigation water limits and extreme drought conditions.
| 1 | 2other
| 0Study
|
284,822 |
Another study regarding segmentation on lung CTs was performed by Meraj et al. (2021) with the goal of performing lung nodule detection. The authors used a publicly available dataset, the Lung Image Database Consortium, upon which filtering and noise removal were applied. The authors used adaptive thresholding and semantic segmentation for unhealthy lung nodule detection, with feature extraction performed via principal component extraction. Such an approach showed results of 99.23% accuracy when the logit boost classifier was applied.
| 4 | 0biomedical
| 0Study
|
294,541 |
We have introduced a framework for describing three general classes of systems and shown how it can be used to address a number of philosophical questions. We began with the class of temporally evolving systems, of which classical dynamical systems are a special case, and then moved on to the class of spatially extended systems and the class of amorphous systems. As noted, the framework can accommodate systems as diverse as the solar system, quantum–mechanical systems, special and general relativistic systems, and the earth’s climate system.
| 1 | 2other
| 1Other
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.