text
stringlengths 208
322k
| id
stringlengths 47
47
| metadata
dict |
|---|---|---|
Modern Society Lacks Meaningful Rites of Passage
In anthropology, a rite of passage is a ritual, event, or experience that marks a major milestone or change in a person’s life [1]. It indicates the end of one chapter in life and the beginning of the next. Past and present, cultures around the world have held rite of passage ceremonies to support their boys during the transition from boyhood to manhood. These gatherings created a situation where elders could bestow the “knowledge of life” and “family values” on the younger generation. This helped keep their society well cared for. Typically, these events would occur between the ages of twelve to fifteen—old enough for a boy to understand that his life was changing, but before he had fully physically developed into a man.
Traditionally, a rite of passage consists of three parts: withdrawing or separating from the family, the journey itself, and the return to the community. The withdrawal stage is necessary to break the boy out of his regular routine and to separate him from his normal sources of support. This is the first step that he must make if he is ever going to gain independence and leave his childhood behind.
The journey itself is an opportunity for the boy to “get away” and gives him time to process the change that is occurring in his life. Oftentimes, this involves a literal journey, where the boy travels from one place to another. The physical journey reflects the emotional and spiritual journey that he is making and helps to make it clear to him the passage from one stage of life to the next.
The return phase of a rite of passage is the reincorporation back into society, no longer a child but now a man. It is a joyful and triumphant event. The three parts of a rite of passage are equally important—no one is any more important than the other. They are like the three legs to the stool that keeps it standing.
Examples of rites of passage include the Jewish Bar-Mitzvah, the Walkabout in Australian Aboriginal society, the Seijin Shiki ceremony in modern Japan, and the bullet ant ritual for boys from the Sateré-Mawé tribe in the Brazilian Amazon. Each rite of passage is uniquely designed to help young men make the leap from boyhood to manhood in a culturally meaningful way. Some coming-of-age ceremonies are intellectual in nature, like reading the Torah and giving a reflection, and others are physical challenges, like living alone in the wilderness for months at a time.
Although the different forms of rites of passage from around the world are unique in their own ways, the benefits are universal: they foster a sense of belonging to the community and clearly indicate to the young person their new status as an adult. For boys, they help solidify their masculine identity as part of the community, not as a lone wolf who needs to come up with his own ways to “prove himself” as a man.
To the detriment of our sons, society today does not offer a similar coming-of-age event. The closest thing that we have to a rite of passage in American culture is a “sweet sixteen,” which typically involves a DJ and a pool party. Notably, there is no withdrawal or journey in a sweet sixteen celebration, both of which are crucial elements to a truly meaningful rite of passage. The sweet sixteen does not attempt at the all-important undertaking of passing down family values or instilling a sense of responsibility in the boy. It is all party and no actual challenge. Ultimately, this is a huge disservice to him, because it does not fully prepare him for the real world. A sweet sixteen may be a fun party, but it is not a rite of passage.
A rite of passage is one of those ancient traditions that past societies saw value in but modern society is too blind to appreciate. To quote an unknown author, “It’s absolutely ludicrous that our society does not actively support adolescents over the threshold into adulthood. We just expect them to ‘grow up’ magically, on their own, without appropriate adult role models or powerful and meaningful rites of passage.”
By looking at how other cultures have addressed the transition from boyhood to manhood, we learn that we can either sit by and watch the next generation stumble upon their own mistakes, or we can do something about it.
Your son needs to hear that he is no longer a boy but rather that he is now a man.
Do you have a son or grandson about to turn thirteen? Are you looking to do something memorable for this birthday, to mark his entrance into manhood in a special way? Check out our new book Milestone to Manhood on Amazon here.
1. https://www.merriam-webster.com/dictionary/rite%20of%20passage
|
<urn:uuid:d6f717f0-2ca9-48a4-a1cf-1283d7e45070>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.22825300693511963,
"language": "en",
"language_score": 0.961898148059845,
"url": "https://www.milestonetomanhood.com/post/modern-society-lacks-meaningful-rites-of-passage"
}
|
Like a snail through the intestinal canal
The medical device currently used for intestinal research, the colonsope, causes patients great discomfort. At TU Delft, an alternative method has been developed, inspired by the way in which snails move. On September 18, researcher Dimitra Dodou received her PhD degree from TU Delft based on this research subject.
The intestines are an extremely difficult area to navigate through with a medical device. Yet, many people need to have intestinal examinations done to determine if, for example, they have intestinal cancer. The medical device currently used for this is the colonscope, a long, thin and flexible tube that causes patients great discomfort and pain. For this reason, researchers have been trying to develop alternative medical devices, such as, for example, a small robot that moves independently through the intestinal tract. There is a layer of slime, called mucus, on the inside of the large intestine (colon). The robots, as they move forward under their own power, ignore this layer of mucus and try, if possible, to suck or grab on to the intestinal wall, which results in the walls being stretched and the patient feeling pain and discomfort.
An intestinal robot should also have a similar layer to use. To achieve this, an adhesive layer is added to the mucus-like properties, which allows the device to be stuck to the layer of mucus. The ability to be attached to a surface covered with lubricant is a great technological challenge, because most adhesives normally only work on 'clean' surfaces. The researchers discovered a group of polymers, so-called muco-adhesives, that are suitable for this. Dodou used a pig's intestine to evaluate how this material worked. Her findings revealed that muco-adhesives in the form of films provided by far the highest degree of friction.
Additional experiments found that it is not only the size of the film surfaces, but also their shapes, which influence the degree of friction generated. It's remarkable that the degree of friction increases when the surface size decreases, as a result of holes being made in the structure of the film. It is therefore possible to influence the degree of friction by creating holes in the muco-adhesive or indeed by closing the holes.
Moreover, by selecting different shapes, which owing to their compact size can achieve high degrees of friction, the device can be made smaller. The researchers are currently building a prototype that will be tested in living pigs. We must however wait a while longer until a fully developed medical device is available.
Source: Delft University of Technology
Explore further
Smoking cessation through a healthcare system model is shown more effective than telephone 'quitlines' in the short term
Citation: Like a snail through the intestinal canal (2006, September 21) retrieved 30 September 2022 from https://medicalxpress.com/news/2006-09-snail-intestinal-canal.html
Feedback to editors
|
<urn:uuid:43f6e117-835e-4452-bacc-e99c49489e3b>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.0392838716506958,
"language": "en",
"language_score": 0.9469293355941772,
"url": "https://medicalxpress.com/news/2006-09-snail-intestinal-canal.html"
}
|
DMW logo
(t) +44 (0)1732 833085
How to use Excel COUNTIF and COUNTIFS Functions
COUNTIF counts the number of cells in a block that satisfy a criterion. COUNTIFS counts for multiple criteria.
Last updated on 2021-08-27 by David Wallis.
The COUNTIF Function
Excel’s COUNTIF function has two arguments, separated by a comma:
COUNTIF(from_which_cell_range_to_count, what_to_count_for)
Excel COUNTIFS function example
Consider this spreadsheet in which we want to count the number of orders of value over 1,500.
We could use this formula:
Or, if we use the range name nmValue for the cell range C2:C20:
What we couldn’t count with a COUNTIF is the number of Orders for February 2021 of value over 1,500, because this involves two criteria.
COUNTIFS accepts multiple criteria. Below, we’ll use it to count high-value Orders for February.
All versions of Excel possess the COUNTIF function. With Excel 2007, COUNTIFS was introduced.
Because COUNTIFS offers greater flexibility than COUNTIF, I always use COUNTIFS. So, in this article I concentrate on COUNTIFS.
The COUNTIFS Function
To count the number of orders ofvalue greater than 1,500 in the spreadsheet above, our COUNTIFS formula is this:
Which is the same as COUNTIF when applying one criterion.
COUNTIFS can count according to more than one criterion. COUNTIFS criteria beyond its first one are optional.
COUNTIFS(first_criterion_range, first_citerion_value, second_criterion_range, second_citerion_value, and so on …)
When you are applying more than one criteria, the dimesions of all criteria must be the same. That is:
These are examples of COUNTIFS counts:
I cover these in the sections below using two additional range names:
The Logic of COUNTIFS
If the COUNTIFS function in your formula has two or more criteria, then jointly they form a logical AND condition. Hence, when you asking to “Count the number of orders of value between 500 and 1,500”, your formula is this:
If you’re asking for a count of values, each of which is “less than 500 or greater than 1,500”, then you’ll need to take the sum of two COUNTIFS.
The summation of two COUNTIFS expressions satisfies a logical OR condition:
Setting Criteria Values
Unless it’s a number, the value you provide as a criterion must be in the form of text, as in examples above.
Hence, in COUNTIFS(nmValue,"<500") the criterion value <500 is enclosed in speech marks to render it as text. If you attempt to omit the speech marks, then the formula won’t work.
When your criterion value is a number, COUNTIFS accept it as a number or as text, whichever you choose. So, both COUNTIFS(nmValue,"500") and COUNTIFS(nmValue,500) work just fine.
In this example, we let the user set the upper and lower limits — in Cells F18 and F19:
Excel COUNTIFS function
The ampersand, &, concatenates the elements of each criteria value into a text string as required by the COUNTIFS’s criteria values.
Wild Cards in Criteria Values
There are two wildcards you may incorporate into criteria values:
? The question marks stands as any single character
* The asterick symbol stands for any seqence of characters.
Hence ?p?? is a string of four characters, the second of which is P or p — COUNTIFS criteria are not case sensitive.
W* is a string of any length beginning with W or w.
??B* is a string of any length, the third character of which is B or b.
The formula in the Cell 20, above, illustrates that a wildcard may be included in a concatenation producing a criterion value.
COUNTIFS and Date Criteria
I use the ISO 8601 yyyy-mm-dd format on my spreadsheets hoping to avoid the confusion over dates caused by applied formats:
Excel COUNTIFS formula with date criteria
Confusion commonly arises between spreadsheets with dates formated as dd/mm/yyyy and mm/dd/yyyy.
Bearing in mind that Excel stores dates as numbers, flipping the number format in the spreadsheet above to General is one way to check what Excel is making of the formula:
Excel COUNTIFS formula with numeric date criteria
Your Support for DMW TIPS
“Oh! So there’s more to doing calculations
in Excel than using that ∑ thingy?”
BN, 2002
|
<urn:uuid:e466cf6b-4ce7-4d58-a12d-b64b59a56744>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.026185274124145508,
"language": "en",
"language_score": 0.8777385354042053,
"url": "https://www.consultdmw.com/excel-countif-function.html"
}
|
The Sound A Clock Makes
The Sound A Clock Makes
Why don’t clocks tock-tick?
If you ask someone what sound a clock makes, their answer will be “tick-tock,” and never “tock-tick.” But every tick of the clock sounds the same – one doesn’t tick while the next one tocks – so why can’t a clock tock-tick?
The Sound A Clock Makes
Tick-Tock or Tock-Tick ?
First, we have to talk about ablaut reduplication. A reduplication is a word that is repeated, sometimes with a slight change, to alter the meaning or tone of the word. There are a few different types of reduplications:
Exact Reduplication
Rhyming Reduplication
Comparative Reduplication
The dog got bigger and bigger.
I’m feeling worse and worse the more I eat.
Shm Reduplication
Fancy shmancy
Taxes shmaxes
Contrastive-focused Reduplication
Do you like it or like-like it?
The tacos were HOT-hot.
Ablaut Reduplication
An ablaut is a variation of the vowel in a word to change it. Run and ran are ablauts, so are sing, sang, and song. Ablauts are always presented in a specific order. The word with an I comes first, followed by A or O.
This all sounds complicated, but this is a rule in English, and many other languages, that we all understand and follow without thinking about it. There’s no reason why you can’t zag-zig or cross-criss your arms, but it sounds wrong to us. So we wear flip-flops and go splish-splash in the tub. And if you find a rare case where three similar sounding words need an order, the I still comes first, followed by A, then O. Like when bells ding dang dong.
So next time you’re having a chit-chat with a friend and you notice the sing-song way an ablaut reduplication sounds, you’ll have a tip-top fact to share!
|
<urn:uuid:9d048712-9f73-405c-b2a6-149adaa4ea83>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.59375,
"fasttext_score": 0.16956430673599243,
"language": "en",
"language_score": 0.8951950073242188,
"url": "https://www.timesticking.com/the-sound-a-clock-makes/"
}
|
Pages Menu
Categories Menu
Posted by on Jan 4, 2018 in TellMeWhy |
What Is a Flying Buttress?
What Is a Flying Buttress?
What Is a Flying Buttress? The name “buttress” in architecture is given to a mass of masonry which stands out from the face of a wall, either to strengthen that wall or to resist the thrust from an arch or a roof. The flying buttress (arc-boutant, arch buttress) is a specific form of buttress composed of an arched structure that extends from the upper portion of a wall to a pier of great mass, in order to convey to the ground the lateral forces that push a wall outwards, which are forces that arise from vaulted ceilings of stone and from wind-loading on roofs.
The defining, functional characteristic of a flying buttress is that it is not in contact with the wall it supports, like a traditional buttress, and so transmits the lateral forces across the span of intervening space between the wall and the pier. To provide lateral support, flying-buttress systems are composed of two parts: (i) a massive pier, a vertical block of masonry situated away from the building wall, and (ii) an arch that bridges the span between the pier and the wall — either a segmental arch or a quadrant arch — the flyer of the flying buttress.
The flying buttress was a Gothic innovation and is a kind of half-arch or half-bridge of masonry spanning the space from the buttress proper to the neighboring wall. Buttressing began in the great buildings of the later Roman Empire but it was not until the Romanesque period that really large outside buttresses began to appear. As the naves of churches became roofed with ribbed vaults, a tremendous number of thrusts were concentrated into each bay and the flying buttress was evolved to counter them.
beauvais cathedral, france
Where the nave wall was of great height, as at Beauvais Cathedral, in France, two, or even three half-arches—one over the other—formed the flying buttress. By the 15th Century, few large buildings were without flying buttresses, which were often pierced and richly traceried. Many Cathedrals in England, such as Exeter, Salisbury, Winchester and Sherborne Abbey in Dorset, show magnificent examples of flying buttresses as well as the richly decorated buttress pinnacles which often accompany them.
sherborne abbey, dorset, england
Ancient examples of the flying buttress can be found on the Basilica of San Vitale in Ravenna and on the Rotunda of Galerius in Thessaloniki. The architectural-element precursors of the medieval flying buttress derive from Byzantine architecture and Romanesque architecture, in the design of churches, such as Durham Cathedral, where arches transmit the lateral thrust of the stone vault over the aisles; the arches were hidden under the gallery roof, and transmitted the lateral forces to the massive, outer walls.
By the decade of 1160, architects in the Île-de-France region employed similar lateral-support systems that featured longer arches of finer design, which run from the outer surface of the clerestory wall, over the roof of the side aisles (hence are visible from the outside) to meet a heavy, vertical buttress rising above the top of the outer wall. The advantage of such lateral-support systems is that the outer walls do not have to be massive and heavy in order to resist the lateral-force thrusts of the vault. Instead, the wall surface could be reduced (allowing for larger windows, glazed with stained glass), because the vertical mass is concentrated onto external buttresses.
The design of early flying buttresses tended to be heavier than required for the static loads to be borne, e.g. the Chartres Cathedral (ca. 1210), and around the apse of the Saint Remi Basilica, which is an extant, early example in its original form (ca. 1170). Later architects progressively refined the design of the flying buttress, and narrowed the flyers, some of which were constructed with one thickness of voussoir (wedge brick) with a capping stone atop, e.g. the Amiens Cathedral, the Le Mans Cathedral, and the Beauvais Cathedral.
The architectural design of Late Gothic buildings featured flying buttresses, some of which featured flyers decorated with crockets (hooked decorations) and sculpted figures set in aedicules (niches) recessed into the buttresses. In the event, the architecture of the Renaissance eschewed the lateral support of the flying buttress in favor of thick-wall construction. Despite its disuse for function and style in construction and architecture, in the early 20th century, the flying-buttress design was revived by Canadian engineer William P. Anderson to build lighthouses.
|
<urn:uuid:5854c861-9a01-4394-a4d2-a387e7978e95>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.609375,
"fasttext_score": 0.025323867797851562,
"language": "en",
"language_score": 0.9359629154205322,
"url": "https://www.juniorsbook.com/tell-me-why/what-is-a-flying-buttress/"
}
|
Readers ask: What is a positive feedback loop?
What is an example of a positive feedback loop?
What is a positive feedback loop simple definition?
Positive feedback is a process in which the end products of an action cause more of that action to occur in a feedback loop. This amplifies the original action. It is contrasted with negative feedback, which is when the end results of an action inhibit that action from continuing to occur.
What is a good example of positive feedback?
A good example of positive feedback involves the amplification of labor contractions. The contractions are initiated as the baby moves into position, stretching the cervix beyond its normal position. The feedback increases the strength and frequency of the contractions until the baby is born.
What makes something a positive feedback loop?
Why is it called a positive feedback loop?
Global Climate Change and the Electric Power Industry. A closed chain of cause and effect that acts to destabilize a system is sometimes called a positive feedback loop. (The term “positive” comes from control theory. It does not denote that the feedback will lead to changes that are good or bad.)
You might be interested: Question: What age do babies talk?
What is meant by a feedback loop?
What is feedback loop in communication?
Feedback Loops & the Benefits of Rapid Communication. A feedback loop is defined as a system where the output of a system becomes the input for the next iteration of the system.
Is sweating positive or negative feedback?
What is an example of a negative feedback loop in the environment?
A good example of a negative feedback mechanism will be if the increase in temperature increases the amount of cloud cover. The increased cloud thickness or amount could reduce incoming solar radiation and limit warming.
What is positive feedback in communication?
What is positive feedback? Positive feedback is communication that recognizes another’s strengths, achievements or successes.
How do you give good feedback examples?
Reinforcing employee feedback examples
1. “Something I really appreciate about you is….”
2. “I think you did a great job when you…
3. “I would love to see you do more of X as it relates to Y”
4. “I really think you have a superpower around X”
5. “One of the things I admire about you is…”
6. “I can see you’re having a positive impact in…”
What does positive feedback mean?
You might be interested: Readers ask: What to do if dog eats chocolate?
How does the negative feedback loop work?
negative feedback loops, in which a change in a given direction causes change in the opposite direction. For example, an increase in the concentration of a substance causes feedback that ultimately causes the concentration of the substance to decrease.
Which body process is controlled using a positive feedback loop?
In a positive feedback loop, feedback serves to intensify a response until an endpoint is reached. Examples of processes controlled by positive feedback in the human body include blood clotting and childbirth.
What are the three common components of a feedback loop?
Terms in this set (3)
• Receptor. Receives signals from the nerves.
• Control Center. Brain receives message/ signals the effector.
• EffectorEffector receives signal from control center -causes the change.
Leave a Comment
|
<urn:uuid:d0ad0fbe-907c-4a36-9647-67f0796ba574>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.09375,
"fasttext_score": 0.9961570501327515,
"language": "en",
"language_score": 0.9035050868988037,
"url": "https://beavercountybookfest.com/useful/readers-ask-what-is-a-positive-feedback-loop.html"
}
|
How Do Pigs Sleep?
Pigs are highly sociable animals, and they love being together with other pigs because this makes them feel protected since they’re banded as a unit. So sleeping together makes a big part of their social life.
In this article, I explain how pigs sleep and all you need to know about it. This knowledge will help you understand more about your pigs behavior and when to spot healthy behavior.
Being aware of your pigs behavior plays a big part in their overall health, so it’s very important we take care of it.
How Do Pigs Sleep? Pigs are sociable animals, so they prefer sleeping beside other pigs. By doing this, the pigs feel close, safe, and united. They usually sleep in a side position or their belly; the living condition will also influence how they sleep.
Aside from that, by sleeping together, the pigs also feel a sense of comfort because they feel warm when they are all sleeping side by side..
Regardless of their tight sleeping space, pigs prefer to squeeze in close to each other. When pigs sleep tightly together, this is a sign of the pig’s closeness with each other.
Positions Pigs Take When Sleeping
There are various sleeping positions that a pig would do, and it all depends on the space they have and other factors.
Generally, pigs sleep in a side position or on their belly, but there are many positions they can take depending on how much space they have or how comfortable they feel.
The available space for the pigs to sleep in plays a significant factor in what position the pigs would sleep in.
Pigs prefer sleeping on their side because it is their most comfortable sleeping position.
It is essential to note that when a pig sleeps on its belly and their feet are tucked under its body; this could be a sign that the pig is feeling either uncomfortable or too cold in the area they are sleeping in.
There are other sleeping positions pigs would sometimes do, and this would always depend on how comfortable a pig is; an example of this is when you see a pig sleep too close to a wall, this is a sign they are feeling too cold in their sleeping area.
It’s important to mention that a great indicator to help you know if the area of where your pigs are sleeping is too cold or not is that they will huddle if it’s too cold. So by doing this, they are just trying to provide warmth to each other.
The pig’s size will also play a part in their sleeping position, with smaller pigs either sleeping on their side or bellies are common while a larger pig would sleep on its side.
How Many Hours Do Pigs Spleep?
Pigs usually sleep for an extended amount of time, with their regular sleeping schedule taking up 7-15 hours a day. However, it is essential to note that pigs can sometimes sleep longer or shorter than 7-15hours, depending on how they are feeling and going through.
The younger the pig, the more they will typically sleep.
Pigs also like to play around and do many activities. All this behavior or lakoff will also determine how much they will sleep.
Just like humans, if a particular day you did a lot of fisical work, you might be more prone to sleep more.
But also, if he is not sleeping too much, it might be a sign that he is not eating right during the day.
Where Do Pigs Sleep?
Pigs usually sleep in a sleeping area called the pigpen. Inside a pigpen, they will have an area that will be comfortable enough for them to huddle with each other and sleep in.
The pig pen needs to be able to accommodate all the pigs, having the proper size to include all the pigs and a suitable sleeping area the pigs can comfortably sleep in.
If your pig pen sleeping area can’t accommodate the pigs in terms of size, the pigs will feel uncomfortable, and they will not be able to sleep.
Aside from the pig pen’s size, the temperature of the area should also be noted when it comes to where the pigs would be sleeping.
If the sleeping area is too hot or too cold, the pigs would feel uncomfortable and would either spread out when hot or huddle too close if it’s cold, making it a struggle for them to sleep and rest.
Why Is My Pig Not Sleeping?
If you notice that one of your pigs is not sleeping, this could mean that the pig is uncomfortable. The pig could either be sick or stressed.
They could be experiencing behavior problems such as loss of appetite or depression. If your pig is showing signs of not sleeping, it is crucial to get them checked as soon as possible because they could be sick or in panic.
Take note of other signs such as their eating habits, their breathing, their eyes, their ears are they pointing downwards, and their skin color.
If your pig is in panic, it is important to calm the pig down and make them feel comfortable, and this can be done by playing relaxing music, giving them a blanket, walking with them, and can be avoided by knowing the pig’s stress triggers.
As you can see, there are many variables when determining why they are not sleeping, but it is our job to go through this process, and remember, you can always ask for the help of your local veterinarian.
Conclusion: Where Do Pigs Sleep?
Pigs have designated areas inside a pig pen that they can sleep in, and it is crucial to ensure that their sleeping area is big enough to accommodate all of them in terms of size and that the temperature is not too hot or too cold so that the pigs can sleep in comfortably.
Having a proper pig pen can be a challenge depending on the size and number of how many pigs you have. Still, by providing the pigs with a comfortable designated sleeping area, the pigs will be better-taken care of and will have a healthier performance.
|
<urn:uuid:969b86c5-f343-42ed-917e-c630aa6ac8e3>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.9274802207946777,
"language": "en",
"language_score": 0.9679965972900391,
"url": "https://thetilth.com/how-do-pigs-sleep/"
}
|
Skip to main content
River Forth - Crossing Scotland
The Forth gave Stirling a key place in Scottish history. Until 1936 it was the first point from the east where the river could be crossed by road. The main traffic on Scottish roads until the late nineteenth century was the cattle brought south by drovers to be sold in the great market at Falkirk. The drovers crossed the Forth at Stirling. Where they watered the cattle in the river before the last stage of the journey to Falkirk, about 20 kilometres further on. The first railway north of Stirling also crossed the Forth There This railway brought an end to droving, because it was cheaper to load cattle on to trains than to drive them south on foot.
For 500 years, from the thirteenth century to the eighteenth, there was a series of wars between the english and the Scots. A vocanic rock rises over 120 metres above the low-lying and marshy ground beside the river, commanding a view in all directions and with sheer cliff-faces on two sides. It was the perfect site for a fort, and from the twelfth to the seventeenth century Stirling Castle was the headquarters and palace of the Scottish kings. The Present-day castle at Stirling was mostly built between 400 and 500 years ago, but there has been a castle on the site for well over 1000 years.
The land below the castle was the scene of two famous battles in Scottish history. In 1297 Scotland's great national hero William Wallace soundly defeated an invading English army at the Battle of Stirling Bridge, catching the soldiers at a disadvantage when they were half-way across. In 1314 another famous Scots leader, Robert the Bruce, led his army to victory over the English at the Battle of Bannockburn, four kilometres away on the Forth flood plain.
Below Stirling, the Forth continues to wind through an area known as the 'Link of Forth' as far as alloa, where it begins to open out into the Firth of Forth. The word 'firth' is used in Scotland to describe an inlet of the sea which is the mouth of a river. Other Scottish river valleys which called "firth" include the Moray Firth, the Dornoch Firth, the Firth of Cromarty and the Firth of Clyde.
Most of the old industries of the Firth of Forth, such as iron-making, coal-mining and shipbuilding, have gone. But, since the discovery of North Sea oil in the 1960s, Grangemouth and Mossmoran in Fife have become important centres for oil and petrochemicals. Petrochemicals are loaded at Grangemouth docks and oil is exported through a specially-built terminal at Hound Point, opened in 1975.
The south bank of the Forth is dominated by Edinburgh. scotland's capital city since 1437 and now the site of the new Scottish parliament.
Popular posts from this blog
Panic or panick
Does pearls reproduce by itself through time
|
<urn:uuid:e4139fe1-377c-4114-921f-894f40fd53db>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.02201831340789795,
"language": "en",
"language_score": 0.9760895371437073,
"url": "https://en.dayabook.com/2009/02/river-forth-crossing-scotland_20.html"
}
|
INA Trials – UPSC GS1
The agitation launched by the Congress post the capture of Indian National Army soldiers in 1945 is considered as landmark on many counts. Examine why. (200 Words)
The INC leaders were released to affect the Constitutional deadlock and they found masses ready to act. Further agenda was gifted to them in form of public trails of INA Prisoners of War which were captured by British. Also the elections were announced to be held in 1945-46. All this provided a great platform for mobilization of masses and INC prepared a defence plan for INA trials.
1. The agitation often got mixed with election campaigning although INC did not need much of it. Huge crowds with masses excited over the return of nationalist leaders, gathered in sessions.
2. Press support was immense. Daily editorials, priority coverage and support for INA men helped people form opinion.
3. No communal clashes occurred during this period and as a matter of symbolism, British had inadvertently put One Hindu, One Muslim and One Sikh on trial first. INC, Muslim League, Sikh bodies, all supported leniency for INA.
4. The support for INA men was unprecedented in all sections of society. Even Indian soldiers who may have fought them, believed them to misguided patriots.
5. Soon people began to perceive this issue as India versus British. Students, youth, workers, etc. started to pledge revenge on British if any INA man was sentenced. Instances of hartals, processions, attacks of authorities, etc. began to increase. The matter went out if control for British when Calcutta hartals and Royal Indian Navy strike occurred.
6. The demand for leniency to these patriots was made even before their trials were announced. Funds were established for these men so that they could be rehabilitated. Generous donations were received.
Prominent lawyers which took up the case were Bhulabhai Desai, Tej Bahadur Sapru and JL Nehru.
Thus altogether, the INA trails marshalled public opinion immensely. It had a huge psychological impact over wide geographical areas and along all social lines.
|
<urn:uuid:b8203aa8-2083-441a-8163-ee2c425aab38>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.890625,
"fasttext_score": 0.03482145071029663,
"language": "en",
"language_score": 0.9831333756446838,
"url": "https://www.ias4sure.com/wikiias/gs1/ina-trials/"
}
|
237 years later, the return of a Hawaiian chief’s treasured feather cape and helmet to Hawaii
chief kalaniopuu hawaii cape bishop museum
It’s cloudy and very windy outside the six-story Te Papa Tongarewa museum in Wellington, New Zealand.
A delegation from Hawaii flew from Oahu to Aotearoa a few days before and are walking in a tight procession, following the deep, trumpet sounds of the taonga puoro (traditional Maori musical instruments), up an outdoor staircase. These men and women from the Office of Hawaiian Affairs (OHA), Bishop Museum and Hawaiian Airlines are on their way to an important and historic event—one that’s been a long time coming. Some are dressed in suits and ties, others in elaborate dresses with distinct Hawaiian designs, and still others, like the lua (hand-to-hand fighting) practitioners who make up the kiai (guards), are dressed in traditional Hawaiian wears of malo (loincloths) and kihei (rectangular tapa garments worn over one shoulder and tied in a knot). At the top is Te Ara a Hine, Te Papa’s entrance to its marae (a communal meeting space), and it’s here where the group stops. Standing together and forming a line, they face the Aotearoa delegation and Hawaiian High Chief Kalaniopuu’s ahu ula (feather cloak)
and mahiole (feather helmet) which they are there to receive.
In 1779, British explorer Captain Cook visited the Hawaiian Islands and was generously welcomed by Kalaniopuu in Hawaii Island’s Kealakekua Bay. Feather-work cloaks were regarded to be extremely valuable to Native Hawaiians and they were only worn by chiefs. “Kalaniopuu takes off his cloak and helmet and places it on Captain Cook, as well as presents him with several other feather cloaks at his feet,” says Marques Marzan, Bishop Museum’s cultural resource specialist. “Those other cloaks would have been spoils of war.”
The Hawaii delegation arrive at the Te Papa marae, with Kamanopono Crabbe and Marques Marzan among those in front.
Photo: The Office of Hawaiian Affairs
Traditionally, a chief would have only one cloak—an identifier visually symbolizing himself in a battle—and the length and size of the cloak, and the kinds of feathers used, indicated status. Because of the incredible responsibility and level of trust involved, Marzan says a special class of people, laborers and craftspeople, would have been used to make these royal garments. First, cordage was prepared from the olona (a native shrub), then taken to create the net backing of the cloak. The kia manu (birdcatchers) had the time-consuming task of gathering the feathers, after which another crafter would bind the feathers to the netting and, by doing so, would create a unique design for the chief. Similarly, the helmet required the collection of an ieie vine to create the wicker work that made its foundation. Kalaniopuu’s ahu ula, estimated to have feathers from 20,000 birds, shows the great amount of labor and craftsmanship needed to create these pieces. “To offer his own personal cloak, being the paramount chief of that particular area of Hawaii Island, made a big statement,” says Marzan, who believes it was done in recognition of Cook’s status.
All of the items left Hawaii on board Cook’s ship, following a battle that ended Cook’s life, and they ended up in England where they eventually were bought at an auction by the family of Lord St. Oswald, before he gifted the collection to New Zealand’s Dominion Museum (the predecessor of Te Papa Tongarewa) in 1912. Nobody knows why New Zealand was chosen by Oswald, but the museum staff have cherished and taken care of it just as much as they would their own Maori taonga (treasures).
The Hawaii and Aotearoa groups enter the marae to take their seats, after a ceremonial warrior challenge, a karanga (a Maori welcoming call) and haka powhiri (Maori chant and dance) are complete. OHA’s CEO, Kamanaopono Crabbe, then stands to deliver his speech in olelo Hawaii (Hawaiian language), drawing connections between the Maori and Hawaiian cultures, bonded together through stories of their pasts and ancestries. He uses gestures to show how Maui fished the Islands out of the sea—a similar story of both cultures—all while an artistic depiction of the demigod lassoing the sun stares down on him from the top of the marae.
Many members of OHA, including Crabbe, have deep ties to the ahu ula and mahiole and have hoped for its return for many years. In 1998, when Te Papa opened, Crabbe was part of the ceremony and performed a chant for the ahu ula when it was redisplayed. OHA chairperson Robert Lindsey Jr., and other members of its staff, Mehana Hind and Keola Lindsey, are also lineal descendants of Kalaniopuu, making this journey a very personal one for them. Since 2013, OHA and the Bishop Museum had been discussing the return of the priceless artifacts to the Islands, and Te Papa believed now was the time to do it, granting a long-term loan of 10 years with a high probability of an extension. “Te Papa had a desire to return it back to Hawaii, but they wanted to make sure that it was maintained properly,” says Marzan. “They wanted it to be housed at the Bishop Museum, and the Bishop Museum worked closely with OHA to make that happen.”
A member of the kiai.
Photo: The Office of Hawaiian Affairs
The feelings of heavy emotion, positive energy and gratefulness to Te Papa for its willingness to send these meaningful treasures back to Hawaii is reflected by the songs, dances and chants performed by the Hawaii group in attendance, and by the gifts they give in return to the Te Papa museum, tokens of their gratitude—Hawaiian spears, lei hulu (feather lei), lei poo (lei worn on head), a chiefly fan made by Marzan, and a large wooden bowl, among other things.
“As the few who were able to travel here and represent all of our people back home and around the world, I’m in awe of [our men] and what they were able to accomplish here, telling the different parts of Kalaniopuu’s life, and drawing connections between us and the Maoris,” says Hind, following the ceremony. “It happened at the right time, the right place, and I can’t wait to take it home,” she adds, referring to the openness Te Papa had in making this happen. “Some [people back home] will have spiritual connections, some will have family connections, and that’s exciting.”
The ahu ula and mahiole are clearly significant for their provenance and history, but it also has lasting effects that relate them to the present-day. With this loan, the Bishop Museum, which only has three feathered helmets, and Hawaiian artisans will be able to learn even more about the skill and craftsmanship needed to create them. “I had never seen the three rows of oo (a black honey-eater bird) feathers on the crest before,” says Sam Ohu Gon, senior cultural advisor for The Nature Conservancy, about the mahiole. The ahu ula is also special because it’s one of the few cloaks that has evidence of being a shorter cape at one time, then being extended to a longer cloak later. For many others, it inspires cultural pride and provides a connection to the chief. Traditionally, Native Hawaiians believed their kings held mana (supernatural power) that was like that of a god, so some believe these royal pieces, which were very carefully created for and worn by Kalaniopuu, continue to hold the chief’s mana and should be equally revered.
The Hawaii delegation, including Kamanaopono Crabbe in red, stand around the crates before they are driven to
Auckland, New Zealand for their flight home.
Photo: The Office of Hawaiian Affairs
The ahu ula and mahiole are carefully packed inside a large crate and sent on a 10-hour road trip across the north island of New Zealand, from Wellington to Auckland—the kiai never leaving its side—and then on a nine-hour flight back to Honolulu.
Once we arrive at the Honolulu International Airport, I disembark from the plane and watch through the glass windows of the arrival gate as the Hawaiian Airlines’ baggage handlers begin to unload its cargo hold. Soon, the crate carrying these extremely significant and powerful pieces representing Kalaniopuu will be unloaded onto the tarmac, where the delegation is standing and waiting to welcome them home.
Kalaniopuu’s ahu ula and mahiole are currently on display at the Bishop Museum in its exhibit, “He Nae Akea: Bound Together.” 1525 Bernice St., Honolulu, Oahu, (808) 847-3511, bishopmuseum.org/kalaniopuu/.
Categories: Culture, Oʻahu
|
<urn:uuid:37832846-cac1-4fe6-a3c9-c95b269b2750>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.024802207946777344,
"language": "en",
"language_score": 0.9614189863204956,
"url": "https://www.hawaiimagazine.com/237-years-later-the-return-of-a-hawaiian-chiefs-treasured-feather-cape-and-helmet-to-hawaii/"
}
|
Skip to navigationSkip to content
A jumping spider named Kim might help us build flying robots
By Meghan McDonough
Published Last updated This article is more than 2 years old.
Researchers at the University of Manchester trained a regal jumping spider to hop varying distances and heights, with the goal of deepening scientists’ understanding of jump mechanics.
Regal jumping spiders, which are roughly the size of a human fingernail, can leap six times their body length from a standing start. (As a reference point, humans can only manage 1.5 times their height.)
The researchers found that the spider, nicknamed Kim, applied more force for short distances and modified her angle for longer leaps. As part of the study, the researchers took a 3D scan of Kim and built a tiny model based on her anatomy and body structure.
Scientists hope that this knowledge can help them build flying and jumping robots in the future.
|
<urn:uuid:b0d807dd-315a-42f2-9b39-c02cda109cca>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.84375,
"fasttext_score": 0.05200064182281494,
"language": "en",
"language_score": 0.9287640452384949,
"url": "https://qz.com/1277127/a-jumping-spider-might-inspire-the-next-generation-of-flying-robots/"
}
|
Skip main navigation
Fish and dyscalculia
In this video, we’ll look into something quite interesting (and not exactly *fishy*): fish and their role in understanding dyscalculia.
In this video, we will look further into fish and their role in understanding dyscalculia. As was mentioned in the previous step, if you want to study the genetics behind mathematical abilities you might benefit from a faster growing species, such as fish! Scandalous. Not at all!. Did you know that we did zebrafish, we share at least 70% of our genes? Less than 30% make the difference between Einstein and a small fish! Let’s see some advantages in using fish as a model. They have sufficient physiological complexity and high physiological homology to humans. There is ease of genetic manipulation. Fish reproduce quickly and abundantly.
They experience a rapid development, as they hatch in less than three days and become mature by day 90, making them helpful in studying neurodevelopmental disorders There is high space and the cost-efficiency and excellent potential for screening. And lastly fish have smaller brains which can be better assessed using the newest imaging techniques. Most studies of numerical abilities in fish have been done at the University of Padua. Everything started during my PhD in 2004.
Let’s see how we taught fish to distinguish between the number 2 versus the number 3 Fish were inserted a small tank with two doors and the only way to join their conspecifics was by passing through the door marked with three elements rather than the one we only two (where they couldn’t pass) If they wanted to reach the conspecifics outside, they would have to learn that only one tunnel the one associated to a given numerosity of dots is the one that would permit them to rejoin their social companions! We then controlled for non-numerical variables So some stimuli were controlled for the overall area of the objects Which means that the quantity of Black was the same in both groups.
Another set was controlled for the overall luminance. A third set was controlled for the overall perimeter And others for the convex hull which is the overall space occupied by the most lateral items. By using this procedure, we found for the very first time in the literature that fish can use numerical information! While showing that a fish has numerical abilities is important it still isn’t enough to develop an animal model model for dyscalculia. We need more. We need to show that the cognitive mechanisms underlying fish and humans or at least similar How? By looking at their performance in similar tasks! What does this mean?
If something is easy for human and easy for fish, and something else is difficult for both species. we may suppose that the two species share similar cognitive skills. For this reason, we compared fish and human performance by presenting exactly the same stimuli. We had the two experiments. In the experiment one we studied the role of total numerosity of the items. Basically, we always had the same numerical ratio 1 is to 2. Based on this ratio we presented 4 vs 8 15 vs 30 and 100 vs 200. So what’ changes is the total numerosity of the items. We want to see whether the performance decreases while increasing the total numerosity whether there is an upper limit.
In another experiment, we presented a similar number of items from 20 to 21,
but we change the numerical ratio, from a 1:2 ratio where you have 7 vs 14
to a 3:4 ratio where you have 9 vs 12.
And we found that for fish and the total numerosity is irrelevant meaning that the discriminating 4 vs 8 is as easy as 100 vs 200- But in contrast, numerical ratio is important and discriminating a 1:2 ratio is easier than 3:4 ratio. Once we were able to observe the performance of fish we then presented to humans exactly the same stimuli using a fast numerosity judgment to prevent the use of verbal counting. And these were the results. the numerical systems of humans and fish don’t have an upper limit, meaning that we can discriminate even hundreds of element
with a 1:2 ratio while our accuracy depends on the numerical ratio. See? Fish can not only use numbers but they also apparently use a similar mechanism to quantify objects a fact that has been covered by important media such as the National Geographic! Another way to assess similarities in numerical competence between humans and animals consists in assessing whether animals also have ordinal abilities. Ordinality is the capacity to locate an object on the basis of its numerical position This ability can be very useful in nature.
For instance a bear can find ffood either by using spatial information such as the overall distance from the starting point or by enumerating the trees So food is not behind the first tree nor behind the second one but behind The third tree. We investigated this issue in guppies. This was the apparatus. We wanted to see if they could find a particular feeder in a series of identical ones using only ordinal information. This was the view from above In detail in experiment 1 feeders were placed one after the other in the direction of the current. Food was inserted only in the third feeder.
So we inserted the yellow plates above all the feeders and fish were free to enter the experimental area and remove only one plate. To prevent the possibility that fish could have used spatial cues different special arrangements were presented, so that fish could only use ordinal information. We changed the orientation of the feeders this time in a row perpendicular to the subjects. And the results were much clearer. Subjects selected the third feeder more than by chance And they did NOT select the second or the fourth feeder. So here, guppies seemed to use ordinal information. But we didn’t stop here. We then asked which information is spontaneously encoded by fish.
I mean, in the previous experiment, fish were prevented from using spatial cues. But maybe in nature they use them. So which is spontaneous for fish touse? Spatial or ordinal cues? To address this issue, we set up an experiment where in the training phase, both ordinal and spatial cues were available (by keeping feeders at the same distance). Then in test phase we put in contrast ordinal and spatial information to see which information they use. For example, in the test phase, if guppies use ordinal information they were expected to select this one or this one, if they use spatial information. And we found that fish use both information, although they seem to prefer ordianal information… …
And indeed there is a significant difference between the two conditions. In summary guppies can be trained to use ordinal information. When left free to use ordinal and/or spatial cues they show the ability to use both. The University of Trento with Prof. Vallortigara and the Queen Mary University of London with Prof. Brennan have combined their efforts to study the genetics of numerical abilities in this species model zebrafish. The project is still in progress and unfortunately we cannot summarize the details here. But anyway what is clear is that fish have become the current experimental tool to understand the genetics of dyscalculia. We need to identify genes and assess the relative contribution of the environment in controlled laboratory conditions.
This is the main contribution of fish in the comprehension of the building blocks of our mathematical abilities. The road is long but I believe we are on the right path!
Smell something fishy?
In this video, we’ll look into something quite interesting (and not exactly fishy): fish and their role in understanding dyscalculia.
As was mentioned in the last step, if we want to study the genetics behind mathematical abilities, we might benefit from a faster growing species, such as fish.
Watch the video to learn more
This article is from the free online
Research Methods in Psychology: Using Animal Models to Understand Human Behaviour
Created by
FutureLearn - Learning For Life
Our purpose is to transform access to education.
Learn more about how FutureLearn is transforming access to education
|
<urn:uuid:5cf537d6-1cc9-4065-a02e-446cea1d77dd>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5,
"fasttext_score": 0.053591132164001465,
"language": "en",
"language_score": 0.9544166326522827,
"url": "https://www.futurelearn.com/info/courses/research-methods-psychology-animal-models-to-understand-human-behaviour/0/steps/265697"
}
|
22.10.2014 change 22.10.2014
Polish researchers discovered the oldest ancestor of Atlantic horseshoe crab
Fig.: A. Kin/B. Błażejowski Fig.: A. Kin/B. Błażejowski
Dr. Adrian Kin and Dr. Błażej Błażejowski discovered 148 million years old horseshoe crab fossils in the quarry Owadów-Brzezinki (Łódź province). Scientific publication describing the find has just been published in the journal "PLOS ONE".
"Horseshoe crabs are unusual animals that live to this day. They are the subject of research due to their unique properties" - explained Dr. Błażej Błażejowski of the Institute of Paleobiology PAS. According to the scientist, horseshoe crab blue blood has very strong antibacterial properties. A concentrate made from isolated amoebocytes, the active ingredient in horseshoe crab blood, is used in medicine.
Horseshoe crab has a very characteristic build. "Their bodies are masterpieces of weapons of defense!" - the scientist said with amazement. These arthropods do not have clearly separate heads. A pair of large, complex eyes are positioned on the sides of the great, helmet-like head region called prosoma, with attached, smaller, triangular abdomen. "With two compound eyes located on both sides of the prosoma are, 5 eyes simple eyes on the carapace and two on the underside near the mouth horseshoe crabs see well even in the dark under water" - said Dr. Błażejewski.
Horseshoe crab probably owe it to their bodies that they have survived for hundreds of millions of years to the present day. According to the authors of the article, the study of horseshoe crab fossils from the quarry Owadów-Brzezinki revealed no morphological differences from today\'s representatives of the genus Limulus. New species of horseshoe crab discovered in Poland, named Limulus darwini, is the oldest known representative of the genus.
The authors believe that evolutionary conservatism may also be associated with an extremely broad feeding spectrum of these animals and the ability to live in water with different temperatures and salinity, and even no salinity.
Observations made by the Polish palaeontologists have led to propose a new scientific term – stabilomorphism, understood as morphological stabilization of an organism in space and time, whose taxonomic status does not exceed genus-level. It is the result of a highly specialized adaptation strategy, which significantly reduces the need for diverse phenotypic variants, i.e. those that reflect the environmental impact on the body. Researchers have proposed the new definition for organisms on the genus level that survived at least one major extinction or biotic crisis and still live today. In addition to horseshoe crab, this group includes Araucaria and ginko plants.
"In our approach, certain genera, hitherto considered >>living fossils<< - like coelacanth, will lose their current status, as they have not survived a great extinction" - said Dr. Błażejowski.
Fossils were discovered in a unique Fossil-Lagerstätte (deposit of fossils) paleontological site, located in the quarry Owadów-Brzezinki owned by Nordkalk. In the 148 million years old, Upper Jurassic limestones researchers found many fossils of marine and terrestrial organisms in an exceptionally good state of preservation. In addition to horseshoe crabs, scientists also discovered numerous specimens of fish, shrimp and lobster, the remains of small marine reptiles, rare ammonites, as well as terrestrial insects and skeletal remains of pterosaurs.
Co-author of the article and the presented concept, and the discoverer of the site in the quarry Owadów-Brzezinki is prematurely deceased palaeontologist, Dr. Adrian Kin (1979-2012) from the Association of Friends of the Earth Sciences "Phacops".
The article has been published in open access scientific journal PLOS ONE.
PAP - Science and Scholarship in Poland
szz/ agt/
tr. RL
Copyright © Foundation PAP 2022
|
<urn:uuid:3110697e-c0e1-4fb2-8aea-661b977681db>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.019236385822296143,
"language": "en",
"language_score": 0.9180567264556885,
"url": "https://scienceinpoland.pap.pl/en/news/news%2C402380%2Cpolish-researchers-discovered-the-oldest-ancestor-of-atlantic-horseshoe-crab.html"
}
|
History Of Bongabong
Mythical Origin
Several articles were written on the history of Bongabong but not one could be officially considered. The closest assumption, however, is that the name Bongabong was derived from the word “Binago” meaning a big and turbulent river, attributed to the first settlers known as the Mangyans. This turbulent river is now called the “Bongabong River”.
It is believed that the first set of government was established at the original town site in Sitio Anilao where the old church still stands. Due to frequent Moro raids, however, the settlement was later transferred to the southern bank of Bongabong River, opposite to its present site.
The town was given several names such as “Binago” and “Sukol” named after the river leading to Anilao, which was said to be a barrio with historical significance. During the short-lived revolutionary administration, the town’s name was changed to “Sumilang” by Col. Juan Naguit, a close friend of Gen. Emilio Aguinaldo. On 7 December 1927, it was officially recognized as the town of Bongabong through Legislative Bill No. 3415 of the colonial Philippine Commission.
Bongabong and the American Era
During the American Era, the town was attached to Pinamalayan as a barrio due to its poor financial condition, which could not maintain a local government. It was not until 1920 that this town became a separate municipality. With the opening of the national highway in 1937, Bongabong progressed so rapidly. The settlers rushed in to seek land and work. And because of the abundance of undeveloped and uncultivated lands, many settlers were able to acquire larger areas, which convinced them to settle permanently in the area.
The town’s progress may be attributed to its vast agricultural land and forest resources, which are the main sources of the means of livelihood of the people. The town’s 36 barangays are distributed over a vast sprawling agricultural area. Coconut plantations cover the coastal plains. The opening of several sawmills in 1945 along with an increasing number of commercial establishments also contributed to this progress. The income of Bongabong then began to soar. Minor products abound in the area which includes almaciga and rattan. Many fishermen enjoy lucrative income from the excellent fishing grounds along the coast of the municipality.
The first Municipality in the Island of Mindoro who fought and expressed its grievances against the cruelty and tyranny of the Spaniards against the Filipinos & the Municipality created & recognized under Legislative Act. No. 3415 on December 7, 1927.
MUNICIPAL MAYOR’S AND OIC’S (During the 20th Century)
CAMILO UMALI - Appointed during the Spanish Regime when the town was still called SUMILANG.
ISIDRO UMALI - Appointed during the Civil Government in 1902.
|
<urn:uuid:039bfddf-e0c4-4686-b829-1492a2806bc7>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.05400288105010986,
"language": "en",
"language_score": 0.9796507954597473,
"url": "https://www.travelorientalmindoro.ph/Page/History/History-of-Bongabong"
}
|
setting a price on people in Shakespeare’s Cymbeline
In Debt: The First 5,000 Years, David Graeber observes that people usually want to distinguish sharply between their fellow human beings and other animals or objects. Therefore, most societies treat money in either of two ways.
Some societies use money for ordinary commodities and abhor using it to buy people. They prohibit not only slavery but also the use of dowries and ransoms and the purchasing of sex, offices and titles, children, and body parts.
Other societies use money only for people. Individuals pay ransoms and dowries, purchase slaves, and make monetary gifts, which often accompany a change of status, such as a promise to submit to someone’s authority. However, in these societies, people are careful never to use money for commodities, which drastically limits the significance of slavery. They also avoid exchanging people for money by making heavy use of asymmetrical gifts and carefully distinguishing gifts from barter.
Evil results when the two systems combine, because then it becomes profitable to sell human beings. This is generally a consequence of violent external power, such as European colonialism after 1450.
Shakespeare’s Cymbeline (ca. 1611) seems pervasively concerned with anxiety about money turning people into objects.
In Scene 1, we learn what is now called the “back story” by overhearing an expository dialogue between two gentlemen. Apparently, the king has been very generous to an orphan, Postumus. The king’s gifts should have put Postumus in his power, but the young man has instead taken Imogen, the royal daughter, as his lover. As a consequence, he will be banished–excluded from the society. The First Gentleman uses a market metaphor to assess Postumus’ high worth as an individual. Imogen has sacrificed her status to be Postumus’ lover, and
her own price
Proclaims how she esteem'd him and his virtue;
By her election may be truly read
What kind of man he is.
Before he leaves the court, Postumus and Imogen exchange a ring and a bracelet as a kind of informal marriage ceremony (albeit without a dowry or bride-price). First, Imogen simply gives Postumus an object that she suggests is incalculably valuable: not exchangeable for any other good.
Look here, love;
This diamond was my mother's: take it, heart;
But keep it till you woo another wife,
When Imogen is dead.
Here she also grants Postumus the freedom to marry another woman in the event of her own death. Postumus responds by giving Imogen a bracelet, which he minimizes as a “trifle” but imagines as the price of making her his prisoner. This exchange turns the bracelet into the equivalent of her diamond, and of herself.
As I my poor self did exchange for you,
To your so infinite loss, so in our trifles
I still win of you: for my sake wear this;
It is a manacle of love; I'll place it
Upon this fairest prisoner.
Gallantly, he assess his own worth as infinitely less than Imogen’s, yet he implies that the exchange has made them equals.
The exiled Postumus then takes refuge in the house of Philario, whom Postumus’ father had more than once saved in battle. In Debt, Graeber explores the widespread idea that saving someone’s life obliges you to care for that person, since you’re responsible for the fact that he’s alive. Graeber suggests a different explanation: people who save or spare others are typically powerful and are expected to make the ones whom they spare into their dependents. The gift symbolizes their authority. For instance, late in this play, Cymbeline pardons his own daughter, believing her to be a boy named Fidele, and follows this life-saving act by promising another gift:
And ask of Cymbeline what boon thou wilt,
Fitting my bounty and thy state, I'll give it.
Postumus’ own final action in the play is to spare a condemned enemy voluntarily. But his status in Philario’s household is ambiguous. He’s the son-in-law of a king and also an exile; he needs Philario as much as Philario needed his father. It’s not clear who is being generous to whom.
In Philario’s household, Postumus meets an Italian, Iachimo, who is obsessed with market logic. (Italy was then the center of banking and international commerce). Iachimo assesses Postumus’ worth by considering the “catalogue of his endowment” and “perus[ing] him by items”–like a customer in a store. He doubts the “words” said about Postumus (his reputation), because this man has voluntarily exchanged his privileges as a courtier for a woman: “This matter of marrying his king’s daughter, wherein he must be weighed rather by her value than his own, words him, I doubt not, a great deal from the matter.”
Postumus has bragged that his mistress (note the possessive; and he never uses her name in this scene) is “more fair, virtuous, wise, chaste, constant-qualified and less attemptable than any the rarest of [the] ladies in France.” Here Postumus suggests a rank-ordering of women, such that the value of each one can be mathematically assessed. Iachimo appreciates that “kind of hand-in-hand / comparison” but claims that all British women are less valuable than all Italians.
Postumus insists that he “rates” Imogen as he does his diamond, which is “more than the world enjoys.” Iachimo quips, “Either your unparagoned mistress is dead, or she’s outprized by a trifle.” Postumus replies by differentiating commodities from gifts: “You are mistaken: the one may be sold, or given, if there were wealth enough for the purchase, or merit for the gift: the other is not a thing for sale, and only the gift of the gods.” (Gods do not employ transactional exchanges, because they need nothing.) Iachimo retorts that a ring could be stolen, and then it would certainly be sold for a specific sum. Whether Postumus admits it or not, the diamond has finite value. Therefore, so does Imogen.
The two men begin to discuss a wager, which is the central plot element of the play. Iachimo wants to bet his estate against Postumus’ ring that he can seduce Imogen. He claims that this offer is generous because his estate is worth somewhat more than the diamond, and then he quantifies his offer by betting precisely ten thousand ducats against the ring. Postumus won’t agree, because he is reluctant to set a market price on his gift from Imogen, and hence on her. He offers to bet gold against Iachimo’s gold but will not stake his ring, which “I hold dear as my finger; ’tis part of it.” (The human body is not to be marketed). Iachimo scoffs: “You are afraid, and therein the wiser. If you buy ladies’ flesh at a million a dram, you cannot preserve it from tainting: but I see you have some religion in you, that you fear” losing.
Not wanting to appear reluctant to test Imogen’s virtue, Postumus suggests an alternative to a crude, monetary exchange. “I shall but lend my diamond till your return.” (Giving, receiving, and returning gifts are the foundations of a gift economy, according to Marcel Mauss.) Slipping back into a quantitative comparison–or perhaps mocking that logic–Postumus adds, “my mistress exceeds in goodness the hugeness of your unworthy thinking: I dare you to this match: here’s my ring.” Iachimo agrees:
If I bring you no sufficient testimony that I have enjoyed the dearest bodily part of your mistress, my ten thousand ducats are yours; so is your diamond too: if I come off, and leave her in such honour as you have trust in, she your jewel, this your jewel, and my gold are yours.
Iachimo has set a price of ten thousand ducats on Imogen, on her “dearest” organ, and on the diamond. This logic marks him as the play’s villain, yet Shakespeare grants him effective arguments. Postumus wants to avoid measuring Imogen’s worth (let alone her genitals) in ducats, but his openness to market logic makes him an easy mark for Iachimo. Later, he repents, in a speech that comes once he is manacled as a prisoner of war and believes that Imogen is dead:
.... Must I repent?
I cannot do it better than in gyves [fetters],
Desired more than constrain'd: to satisfy,
If of my freedom 'tis the main part, take
No stricter render of me than my all.
I know you [gods] are more clement than vile men,
Who of their broken debtors take a third,
A sixth, a tenth, letting them thrive again
On their abatement: that's not my desire:
For Imogen's dear life take mine; and though
'Tween man and man they weigh not every stamp;
Though light, take pieces for the figure's sake:
If you will take this audit, take this life,
And cancel these cold bonds. O Imogen!
I'll speak to thee in silence.
Here, Postumus combines tropes of debt, coinage and monetary assessment (“take this audit, take this life”), and the exchange of his life for Imogen’s. He counters his own earlier talk of bonds, bets, and market value and demonstrates that he has learned a moral lesson.
As with many happy endings in Shakespeare, the improbable finale of Cymbeline supplies the right answer, yet the problem that drove the plot lingers. Iachimo is defeated but not actually rebutted. Only a preposterous series of coincidences has made things turn out well. The playwright understands how the world really works in 1611, even if he doesn’t like it.
See also a darker As You Like It; why romantic relationships do not function like markets Seamus Heaney’s Beowulf (on the gift economy in that poem); when chivalry died; and defining capitalism. I found insightful Katherine Gillen’s “Chaste Treasure: Protestant Chastity and the Creation of a National Economic Sphere in The Rape of Lucrece and Cymbeline.”
|
<urn:uuid:1c62ce52-8702-4973-a20c-f98daa41af8f>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.05733799934387207,
"language": "en",
"language_score": 0.9584506154060364,
"url": "https://peterlevine.ws/?p=27234"
}
|
Piano Sight Reading: A Beginner's Guide
Ever wondered how somebody can pick up a piece of written music and just start playing it perfectly? It's not magic (or cheating), they've simply learned the skill of piano sight reading – and you can too!
by Rhian Avery
With the right knowledge and proper practice, you'll be able to read and play practically any piece of music you come across. Sounds good, right? Then let's jump right into it – beginning with a basic understanding of how to read written music.
The basics of reading music
Music is a language. Like any language, music has a written form: musical notation. This includes a vocabulary of notes, markings, and symbols that tell you what to play, when to play it, and how to play it. Here are the key elements that make up musical notation.
The staff
Music is notated on what we call the grand staff. Each note written on the grand staff tells you which corresponding key to play on the piano. The first symbol that appears at the beginning of every music staff is a clef symbol. It tells you which note (A, B, C, D, E, F, or G) is found on each line or space.
The grand staff consists of a treble clef at the top and bass clef below, as shown in the following image.
Typically, you play the notes on the treble clef with your right hand and the notes on the bass clef with your left hand.
The grand staff with treble and bass clef
Middle C and other notes
The lines and spaces of the grand staff are home to various musical symbols, including notes. Middle C lies in the gap between the staves, above the bass clef and below the treble clef. Just as it is the center point for orientation on the staff, so it is on the keyboard.
Now, we'll focus on how to find your way around the notes of the treble clef. First, find middle C (highlighted on the staff and keyboard below.) From here, follow the sequence of the musical alphabet (A to G) to name all the notes found on the treble staff.
Middle C and notes on the treble clef
Instead of counting up from middle C every time, you can use memory aids to identify the notes.
The four spaces of the treble staff spell out "ACE:"
Notes in the space of the treble clef
The five lines of the treble staff are EGBDF. We've heard "Every Good Boy Does Fine" or "Every Girl Boss Does Fine."
Notes on the lines of the treble clef
The same goes for the bass clef. You don't need to count down from middle C to work out the notes. You can use the following memory aids, or make up your own!
The four spaces of the bass clef from bottom to top are ACEG: "All Cows Eat Grass” or “All Cars Eat Gas.”
Notes in the spaces of the bass clef
The five lines of the bass clef are GBDFA: "Good Boys Do Fine Always" or "Good Burritos Don't Fall Apart."
Notes on the lines of the bass clef
Note Values
A note value indicates how long you hold the note. Just as the position of the note tells you which key to play, the shape of the note tells you how long to play it. For now, we'll look at the four main note values:
• A whole note is an empty circle and lasts four counts.
• A half note adds a stem and lasts two counts.
• A quarter note fills in the circle and lasts one count.
• An eighth note has a “flag” and lasts for half of one count.
Lenghts of different notes
Key signature
As its name suggests, a key signature identifies which key a piece of piano music is in. Appearing immediately after the clef symbol on every music staff, the key signature tells you which notes are sharp and flat throughout the piece.
Grand staff with the key signature of G Major
A sharp or flat identified in the key signature indicates that every instance of that note is sharp or flat. For example, if you play a melody in the key of G, you can expect to play all the Fs in the piece as F-sharps.
Note: Most music will not stick entirely to a key signature, adding extra flats or sharps throughout. These are called "accidentals". They are placed on the same lines or spaces as their "natural" notes but with little symbols to the left of the notes.
Time Signature
The time signature appears to the right of the clef symbol. It includes two numbers stacked on top of each other, like this:
4/4 time signature
The two numbers in the time signature tell you how many beats are in each measure of music. The most common time signature is 4/4 – it's so common in fact that it's also referred to as "common time." It has four quarter beats per measure, so you count "one, two, three, four" as you play.
To count properly, you need to know the speed intended for the piece, known as tempo. Traditionally, this is written in Italian terms like Lento ("slowly"), Moderato ("moderately") or Allegro ("fast and bright"). In modern pieces, the tempo is often marked in beats per minute (bpm), referring to the number of quarter counts per minute.
Tempo markings
How to get better at sight reading
Now that you've familiarized yourself with the basics of musical notation, it's time to put that knowledge into practice with some real sight reading.
The most important thing to remember before you start sight reading is that you shouldn't simply jump into playing a piece. Do your groundwork first and skim through the sheet music. This will help you get a better feel of what is expected from a piece, so you can play it more fluently and with fewer mistakes.
Ready to go? Here's a step-by-step guide for how you should prepare to sight read a piece of music:
1. Begin with the basics: check the key signature and the time signature to establish the key you'll be playing in and how many beats will be in each measure.
2. Find the right starting position, putting your fingers over the notes. If black keys are needed, rest your fingers on them.
3. In your head, read the music in short phrases. Think with both hands together. If you prepare each hand separately, you won't get a feel for the harmonies or for the way the hands coordinate throughout the piece.
4. Look for note patterns, such as scales, as well as repeated rhythm patterns.
5. Notice performance markings, such as the suggested speed and dynamics; e.g. loud (f) and quiet (p.).
6. Run through in your head how the piece might sound while imagining the feeling of playing the correct notes. If any hand position changes are needed, move your hands at the right time to each new group of notes.
7. Pay through the piece slowly. Begin by counting and playing, making sure to hold each note value for its appropriate duration. If you are uncertain of a note, don't be afraid to miss it out or to play a note that seems like a good fit. It's more important to keep going at a steady pace than to play everything perfectly.
8. After playing through the piece once, go ahead and work through it one more time. You'll probably notice that you're able to play more fluidly after just one run.
9. Make sight reading a regular part of your practice routine. The more pieces you play – in different keys and styles – the better you will get at sight reading!
Setting yourself up for success
As you work on your sight reading, it can be helpful to set specific goals for improving your skills. It can be something as simple as committing to practice sight reading for 10 minutes a day. You could also buy a book with sight reading exercises and commit to tackling a certain number of exercises each week.
During practice sessions, you might notice that you tend to trip up on certain aspects of sight reading. Maybe you don't always remember which key signature is which. Or maybe you find it tricky to nail down the tempo of your pieces. Make a note of common mistakes and then make an effort to focus on these as you practice – it will take your sight reading a long way!
Lastly, remember that learning to sight read is a lot like learning a language. When you start learning a new language, you have to concentrate on the meaning of each word, then put it into the context of a sentence. Eventually, you understand each sentence without thinking.
Music is the same. It simply takes practice to get good at sight reading. Stick to it and in time, you won't just see a page of notes and symbols. You'll hear chords, melodies, harmonies, and know what to play without even thinking about it.
Start learning today for free
Create a flowkey account to enjoy selected lessons and 8 songs, all for free.
Read next
Piano sheet music with a grand staff
Why Every Piano Beginner Should Learn Music Theory
Understanding the theory behind the music you play is key to becoming a better pianist. Here's why it's worth taking the time to learn the basics.
A hand playing an old piano
Piano Hands: How to Build Better Playing Technique
Having good technique on the piano helps you make progress faster in your practice, play with greater expression and control, and make you less prone to injury.
Statue of Beethoven
5 Beethoven Piano Pieces to Learn for Players of All Levels
From his Pathétique sonata to Für Elise, our selection of essential Beethoven piano pieces is guaranteed to inspire piano players of all skill and experience levels.
Finding and Mastering Intermediate Piano Songs
Ready to take your piano playing to the next level? Check out our top tips for making the jump from beginner to intermediate, and get inspired by our most popular songs for intermediate players.
|
<urn:uuid:4cdcee10-7fe8-4298-92b7-e09b74be5f8e>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.15625,
"fasttext_score": 0.11084568500518799,
"language": "en",
"language_score": 0.944049060344696,
"url": "https://www.flowkey.com/en/piano-sight-reading"
}
|
Science & Technology
Scientists on the hunt for a tree’s tipping point
‘Catastrophe theory’ can shed new light on how drought affects plants
Sometimes things are fine—until they’re not. A boat capsizes. A bridge collapses. The stock market takes an extreme turn.
These are examples of “catastrophe theory,” a tool in mathematics that can be used to describe a set of variables that combine, at a specific point, to completely change a system. It’s a framework that can be applied to a variety of scenarios, and now a University of Georgia scientist wants to use it to better understand how plants use water and respond to drought.
In a new invited review featured in the journal Plant, Cell & Environment, Dan Johnson, an associate professor at the UGA Warnell School of Forestry and Natural Resources, makes the case that instead of thinking about plant responses to water stress as a long, slow decline in plant health, researchers should instead be applying catastrophe theory to dig deeper into the forces at play.
Magnified cross section of a droughted Douglas fir needle vein. The black dots are conduits that have collapsed (embolized) due to the stress of the drought, while the gray/white ones are still functional and contain water.
“I wanted to take it in a quantitative direction and provide something new—a new framework for plant hydraulics,” said Johnson. “We should be shifting how we view this field, which goes back to the time of (Leonardo) da Vinci.”
These days, when scientists study water movement in plants, it’s mostly focused on structure and function. Underneath trees’ bark is the xylem, commonly known as wood, which is a system of tubes that move water from roots to branches. Research often focuses on how the xylem works or how drought affects its function.
But instead of focusing on structural failures, said Johnson, what if researchers investigated the point that caused the plant’s death? “So, I thought, we need to figure out tipping points—points of stress where we know a plant is going to die,” he added. “Same thing for an ecosystem—what is the point at which a forest becomes a grassland?”
Johnson teamed up with two colleagues at Duke University, Gabriel Katul and Jean-Christophe Domec, to develop a way to use mathematical theory to analyze tipping points in plants. Katul is the Theodore S. Coile Distinguished Professor of Hydrology and Micrometeorology and Domec is a visiting professor at Duke’s Nicholas School of the Environment and a professor of sustainable forestry at Bordeaux Sciences Agro in France.
Together, they created a framework that would allow them to track changes in a system—whether it’s a tree or an entire ecosystem—and see the effects they wrought on the larger organism. For example, how do variables such as respiration or growth change when the temperature changes?
Through years of anecdotal experiences, Johnson had an idea that these tipping points existed. But the mathematical framework provided the proof that what he was seeing through years of research wasn’t just a series of coincidences.
The paper is featured on the journal’s website and will appear in print later this year. Johnson said he hopes it becomes a jumping-off point for new work in the field of plant hydraulics.
The team met via Zoom meetings for months to work out the details.
“It was a ton of work, but it was also some of the most fun I’ve had writing a paper because we were learning from each other,” said Johnson. “We started with air bubbles in xylem—this nanometer-size scale—and asked, ‘What controls how an air bubble expands and blocks the vascular network?’” And then we scaled it all the way up to whole-tree and ecosystem levels, and then all the different scales in between. It was an epic amount of work.”
|
<urn:uuid:5ef1352c-e33b-47a6-848d-f8fe523110ff>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.71875,
"fasttext_score": 0.06323021650314331,
"language": "en",
"language_score": 0.9373860955238342,
"url": "https://news.uga.edu/scientists-on-the-hunt-for-a-trees-tipping-point/"
}
|
Presentation is loading. Please wait.
Presentation is loading. Please wait.
The Byzantine Empire & Middle Ages
Similar presentations
Presentation on theme: "The Byzantine Empire & Middle Ages"— Presentation transcript:
1 The Byzantine Empire & Middle Ages
2 The Byzantine Empire The capital of the Roman Empire was moved to Byzantium in 330 C.E by Constantine The West fell in 476 C.E to Germanic Tribes The East continued and was named the Byzantine Empire Its capital was renamed Constantinople.
3 Justinian (483-565 C.E) Considered most famous Byzantine Emperor
Re-conquered the West from Germanic tribes Created the Justinian Code-laws Had great churches built (Hagia Sophia) Theodora-Justinian’s wife; strong woman, fought for women’s rights
4 The Church Divides Christianity in the East lost contact with the Roman Catholic Church in Rome. Eastern Orthodox Church emerged Patriarch-leading figure of Eastern Church Pope in the West Roman Catholic and Eastern Orthodox Churches fought over the use of icons. Byzantine missionaries converted many Slavs using the Cyrillic Alphabet.
5 The Middle Ages (Medieval)
Time in between the fall of Rome and modern era ( C.E) Medieval-Latin for Middle Refers mainly to Western Europe
6 Invasions by Germanic Tribes
476 C.E-Rome conquered by Germanic Tribes Decline of learning Loss of common language New languages emerge Decline of cities Church in Rome remained and became powerful
7 Franks Unite and Convert
The Franks became the most unified and powerful of Germanic tribes Clovis was their first great leader. Converted to Christianity Alliance between Church and King. Charles Martel-Stopped Muslims at the Battle of Tours in 732 C.E.
8 Charlemagne (742-814 C.E) Greatest ruler of the Franks
Created an empire almost as large as the old Rome Spread Christianity Encouraged learning Made an alliance with the Pope Crowned Emperor by Pope
9 Feudalism Develops in Europe
After Rome fell to Germanic tribes, power in Western Europe became decentralized. Charlemagne’s Empire was divided Invasions from C.E by Vikings, Muslims, and Magyars further divided Europe People sought protection from local lords instead of a central ruler.
10 Feudalism System in which kings and local lords grant land (fief) to a vassal in return for services (usually military) People worked on the Lord’s manor or estate
11 The Crusades ( C.E) A series of holy wars fought between Christian and Muslim armies. Sought to gain control of the “Holy Land” or Jerusalem. The main impact was an increase in trade.
Download ppt "The Byzantine Empire & Middle Ages"
Similar presentations
Ads by Google
|
<urn:uuid:e1794a8e-fdf5-4ef5-b4f2-808235c7c620>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.90625,
"fasttext_score": 0.050844430923461914,
"language": "en",
"language_score": 0.9218311309814453,
"url": "https://slideplayer.com/slide/7272029/"
}
|
Is that photo of circular lightning?
Some see the shape of Wisconsin in this looping lightning bolt that struck near Hager City Wisconsin on May 31. (Credit: Jerry Zimmer)
When we see a flash of lightning, it looks as though it forms all at once.
However, a lightning bolt is actually produced in many steps. The bolt occurs so quickly that it looks like a single brilliant flash, but high-speed photography can reveal several distinct bolts.
Lightning is a huge electrical discharge that results from the rising and sinking air motions that occur in thunderstorms. Lightning can travel from cloud to cloud, within the same cloud, or between the cloud and ground. The lightning in the accompanying photograph appears to be cloud-to-ground lightning.
A typical cloud-to-ground flash begins as negative charges in the cloud that travel toward the ground in a sequence of spurts. These spurts of negative charges are called “leaders.”
Leaders travel a few hundred feet. From the lower end of one leader, another leader forms, and from the lower end of that leader, another. The negative charges hop downward from leader to leader, forming an ionized channel.
Each leader heads in a direction that is independent of the previous ones. Leaders can split, forming tree-like branches resulting in a path that is not a straight line. Most lightning appears jagged because of this, but it also can take a curved path, as in this photograph.
As the negative charges approach the ground, there is an upward stream of positive charges. When the two streams meet, an initial flash occurs in the channel and electricity flows back and forth between the cloud and ground, lighting up the sky.
The ionized channel formed by the leaders is three-dimensional. So, while the bolt in the photograph looks like a 2-D outline of our state, it could be a 3-D spiral that just appears 2-D as we look along its axis. Either way, it is a fantastic and unique photograph.
Category: Meteorology, Phenomena, Severe Weather
Comments Off on Is that photo of circular lightning?
Comments are closed.
|
<urn:uuid:319808e1-6b00-4f8e-ae7a-ae2767e3b987>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.75,
"fasttext_score": 0.022524237632751465,
"language": "en",
"language_score": 0.9590585827827454,
"url": "http://wxguys.ssec.wisc.edu/2019/06/10/circular-lightning/"
}
|
Clinical Trial
What is a clinical trial?
A clinical trial is a study conducted to determine the efficacy of behavioral, medical and surgical interventions. Scientists also use clinical trials to evaluate the safety of new drugs and medical devices and detect and prevent illnesses. Usually, scientists test animals first, and if the results are favorable, the FDA approves the treatment for human testing in clinical trials.
In clinical trials, scientists compare the new treatment's value to the standard treatment's value. A new treatment is beneficial if it has less dangerous side effects or higher efficacy than the standard treatment.
There are four phases of clinical trials. An intervention must pass the previous phase to move on to the next.
• Phase I trial: tests a small group of 20-80 healthy individuals to establish side effects, safety and optimal dosage.
• Phase II trial: tests 100-300 individuals to determine effectiveness on certain illnesses. This phase can also test the safety and usually lasts years.
• Phase III trial: tests the safety and effectiveness in hundreds to 3,000 individuals while looking at dosages, populations and drug interactions.
• Phase IV trial: tests the safety and effectiveness in large, diverse populations after receiving FDA approval.
Why are clinical trials important to healthcare?
Clinical trials are important to healthcare because they test and determine if medical interventions are safe and effective in human populations. Because of clinical trials, healthcare providers have many medical interventions, including drugs, devices and treatments, to address patient needs. These interventions let patients live a longer, higher quality of life in many cases.
Explore our data
|
<urn:uuid:c5225f94-0926-447e-a983-90afe9b718be>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.0625,
"fasttext_score": 0.16370850801467896,
"language": "en",
"language_score": 0.898603618144989,
"url": "https://www.definitivehc.com/resources/glossary/clinical-trial"
}
|
Skip to main content
Kindergarten Units
Kindergarten Units
A password is required to view Teacher Guides (contact Antonietta Quinn, [email protected] for assistance).
Pushes and Pulls - 10 instructional sessions
In this unit, kindergartners explore the forces of pushes and pulls as they enjoy a visit to the playground. They learn how to describe the position/motion of objects and the effects of forces on those objects. They experience the effect of slope on the speed of cars going downhill on tracks set at different heights, and forward and backward collisions. The interactions of a kickball game is tons of fun!
Weather For Kindergarten - 18 instructional sessions
Weather KitIn this unit of study, students apply an understanding of the effects of the sun on the Earth's surface. Students develop an understanding of patterns and variations in local weather and the use of weather forecasting to prepare for and respond to severe weather.
Worm Scouts - 18 instructional sessions
Worm ScoutsWhy are there piles of worms evenly spaced along the center of a road? Kindergartners ask questions and observe a classroom compost bin of redworms in order to investigate this phenomenon. On behalf of the Worm Scouts of the World, Scout the Worm guides students through the unit as they explore interdependent relationships in the ecosystem of a worm.
|
<urn:uuid:ae04c907-0d97-4695-8bfb-903f4a6118ee>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.0625,
"fasttext_score": 0.03884565830230713,
"language": "en",
"language_score": 0.893926203250885,
"url": "https://www.boces4science.org/KindergartenUnits.aspx"
}
|
History of Lake Garda
History of Lake Garda
Lake Garda:
Garda Lake is the largest lake in Italy and the third deepest after Lake Como and Maggiore. Apart from its numerous natural wonders, mild climate and its historical importance, nowadays the Lake Garda is mostly known for tourism. As it is so close to the northern border of Italy, the lake is mostly visited by tourists from Germany, Austria and Switzerland.
The lake was formed by a glacier towards the end of the last Ice Age. This is the reason why it is of a typical form of a lake made by a glacier - narrow and deep.
The influence of the Roman Empire grew constantly in the region of the Lake Garda, which was populated by the Cenomani tribe. The first allegiance between the Romans and the Cenomani occurred already in 225 BC, while the complete Romanization of the region happened between 2nd and 1st century BC. In 268, a large battle occurred on the banks of the Lake Benaco (the name of the Lake Garda in the Roman period) in which German coalition forces Alemanni were defeated by the Roman Imperator Claudius II (commonly known as Claudius Gothicus) in which Alemanni suffered great losses and the security of the northern border was ensured for a long time.
After the fall of the Western Roman Empire, the Lombards occupied the southern and eastern banks of the Lake Garda. In the 13th century the whole of its eastern bank fell under the rule of Scaligera Family of Verona (family alla Scala), which built numerous impressive defensive structures, such as: Sirmione Fortress, Malcesine Fortress, Riva del Garda Fortress (on the Lake Garda) and a vast defensive wall east of the lake. In the 14th century, the territory of the lake fell under the rule of Visconti Family (Dukes of Milan), while already in the 15th century the eastern banks were under the rule of the Venetian Republic. In 1426, even its western banks fell under the rule of Venice.
For a long time it was peaceful on the Lake Garda. This peace was interrupted by the fightings in the Spanish Succession Wars in 1701 and the Napoleonic Wars in 1796. In fights between France and Austria in the Napoleonic Wars, the area around the lake was often a scene of battles.
After the Third Independence War, the area that once belonged to Venetian Republic became part of the Kingdom of Italy, while only the northern part of Lake Garda remained under the Austrian rule. The northern part of the lake became the Italian territory only after the end of the First World War.
Did you know?
• Lake Garda, with its 370 m2 surface, is the largest lake in Italy and the third deepest (after Lake Como and Maggiore). The length of the lake is around 52 km, maximum width 17km while the circumference of the lake is 159 km. The deepest point of the lake is 346 meters.
• The Theatre alla Scala in Milan owes its name to the Scaligera Family of Verona (family alla Scala) who ruled over the area of Lake Garda for a long time. Beatrice, Regina della Scala was married to Bernabo Visconti who became the Duke of Milan. The church Santa Maria alla Scala was built in honor of Beatrice in 1381. This church was demolished in 1776 in order to make space for the new theatre, the theatre that soon became known as Theatre alla Scala.
• In 1786, the famous German writer Wolfgang Goethe stayed in Malcesine and Torbole on Lake Garda.
Tourist destinations in Italy:
Discover Venice
Discover Rome
Discover Ravenna
Discover Milan
Lake Garda
Discover Lake Garda
Discover Pisa
Lake Como
Discover Lake Como
Lake Maggiore
Discover Lake Maggiore
Discover Palermo
Florence is the capital of the Italian region of Tuscany, a city of over 400 thousand inhabitants. This city is famous for its art, its priceless and unique art heritage, which includes cultural monuments of various styles, rich museums such as the Uffizi Gallery and the Pitti Palace, as well as magnificent villas, most of which used to belong to the famous Florence Medici family.
Discover Florence
|
<urn:uuid:97e7c75a-229a-4e79-ad87-5bf0ca870efc>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5625,
"fasttext_score": 0.05538243055343628,
"language": "en",
"language_score": 0.9613365530967712,
"url": "https://kasadoo.com/Italy/Lake-Garda/History"
}
|
• 520
Learning Opportunities
Cargo trucks are transporting containers due for export to a seaport terminal.
The containers will be temporarily stored in the terminal to wait for ships to come. To save space, containers are usually stacked up in the terminal.
There are different ships bound for different destinations. Terminal operators have to pick the correct containers from temporary storage to load onto the ships. If the correct containers are on the top of the stack, it will be easy to pick them up for loading. But if a wanted container is underneath some other containers, the overlaying containers must first be moved aside before reaching the wanted container, causing extra operation cost and wasting time.
To manage the container terminal in the most efficient manner, you need a plan.
There are ship A to ship Z, totally 26 different ships bound for 26 different destinations.
You know the schedule of the ships. Ship A will come earlier than Ship B. Ship B will come earlier than Ship C. The ships always come in alphabetical order.
You know the schedule of the cargo trucks. The containers for different ships are arriving in a predictable order. No cargo owner wishes to miss a shipment. All cargoes will arrive before the first ship to come.
You have to plan when the trucks come, how should the containers be stored.
Six trucks are sending six containers to the terminal in this order:
B is a container for ship B. This container comes first.
It is followed by container A, targeted for ship A.
A is followed by two containers C, to be loaded to ship C.
... and so on for the rest.
We can arrange the six containers in two stacks, like this:
___ ___
| A | B |
| A | C |
| B | C |
When ship A comes, we can pick up the two uppermost A containers to load to the ship.
When ship B comes, the two B containers are on the uppermost layer easy to pick up.
When ship C comes, the remaining two C containers are ready for pick up and loading.
The whole process used 2 stacking areas.
Note that we do not sort the containers before stacking them up. Sorting is an option too slow and costly to put in practice.
Now is your turn. You are given the cargo trucks schedule. Find the minimum stacking areas needed to ensure the most efficient shipment loading.
Line 1: An integer N for the number of lines to follow.
The following N lines: each line is an independent test case, which is a string composed of alphabetical upper case letters. Each letter refers to a container targeted for its same-letter ship. The cargoes will be transported to the terminal strictly in the order shown in the string. Process each line as an independent case.
Write N lines, each line is an integer, which is the answer for its corresponding input line.
1 ≤ N ≤ 100
1 ≤ length of each line ≤ 500 characters
In the real world there is a maximum height limit for each stack of containers. In this puzzle we assume there is no such limit.
A higher resolution is required to access the IDE
|
<urn:uuid:fa7a7b55-44b0-4154-b2a3-3182e23a67dd>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.75,
"fasttext_score": 0.8028756380081177,
"language": "en",
"language_score": 0.8956228494644165,
"url": "https://www.codingame.com/training/easy/container-terminal"
}
|
A Traversal is an optic that can see into a structure and set, or modify 0 to N foci. And thus a Traversal is useful when you want to focus into a structure that has 0 to N elements, such as collections etc.
It is a generalization of map. A structure S that has a focus A to which we can apply a function (A) -> B to S and get T. For example, S == List<Int> to which we apply (Int) -> String and we get T == List<String>
A Traversal can simply be created by providing the map function.
import arrow.optics.*
fun main(): Unit {
val traversal: PTraversal<List<Int>, List<String>, Int, String> =
PTraversal { s, f -> }
val source = listOf(1, 2, 3, 4)
val target = traversal.modify(source, Int::toString)
Or by using any of the constructors of Traversal.
Arrow optics also provides a number of predefined Traversal optics.
data class Street(val number: Int, val name: String)
data class Address(val city: String, val street: Street)
data class Company(val name: String, val address: Address)
data class Employee(val name: String, val company: Company)
data class Employees(val employees: List<Employee>)
val john = Employee("John Doe", Company("Arrow", Address("Functional city", Street(23, "lambda street"))))
val jane = Employee("Jane Doe", Company("Arrow", Address("Functional city", Street(23, "lambda street"))))
val employeeData = Employees(listOf(john, jane))
Without lenses, we could use the copy method provided on a data class for dealing with immutable structures. { employee ->
company =
address =
street =
name =
Imagine how complex this would look if we would also introduce sealed class into our domain. This is hard to read, does not scale very well, and it draws attention away from the simple operation we wanted to do name.capitalize().
What we actually wanted to do here is the following: focus into every employee, and then focus into the employee’s company, and then focus into the company’s address, and then focus into the street address, and finally, modify the street name by capitalizing it.
val employees: Lens<Employees, List<Employee>> = Lens(
get = { it.employees },
set = { employee, employees -> employee.copy(employees = employees) }
val everyEmployee = Traversal.list<Employee>()
val employeeCompany: Lens<Employee, Company> = Lens(
get = { },
set = { employee, company -> employee.copy(company = company) }
val companyAddress: Lens<Company, Address> = Lens(
get = { it.address },
set = { company, address -> company.copy(address = address) }
val addressStreet: Lens<Address, Street> = Lens(
get = { it.street },
set = { address, street -> address.copy(street = street) }
val streetName: Lens<Street, String> = Lens(
get = { },
set = { street, name -> street.copy(name = name) }
val employeesStreetName: Traversal<Employees, String> = employees compose everyEmployee compose employeeCompany compose companyAddress compose addressStreet compose streetName
employeesStreetName.modify(employeeData, String::capitalize)
Composing Traversal can be used for accessing and modifying foci in nested structures.
Traversal can be composed with all optics, and results in the following optics:
Iso Lens Prism Optional Getter Setter Fold Traversal
Traversal Traversal Traversal Traversal Traversal Fold Setter Fold Traversal
Polymorphic Traversal
When dealing with polymorphic types, we can also have polymorphic Traversals that allow us to morph the type of the foci. Previously, we used a Traversal<List<Int>, Int>; it was able to morph the Int values in the constructed type List<Int>. With a PTraversal<List<Int>, List<String>, Int, String>, we can morph an Int to a String, and thus, also morph the type from List<Int> to List<String>.
Arrow provides TraversalLaws in the form of test cases for internal verification of lawful instances and third party apps creating their own traversal.
Do you like Arrow?
Arrow Org
|
<urn:uuid:d01f67ec-2d4b-4d5b-86cb-188b6b66a232>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5625,
"fasttext_score": 0.9342589378356934,
"language": "en",
"language_score": 0.847349226474762,
"url": "https://arrow-kt.io/docs/next/optics/traversal/"
}
|
Lusi Mud Volcano, Indonesia
Lusi Mud Volcano, Indonesia
On May 29, 2006, hot mud began to pour from the ground near a gas exploration well, covering fields and villages in the Sidoarjo region of East Java, Indonesia. Despite efforts to staunch the flow, the mud kept coming, forming the world’s largest and fastest growing mud volcano. By the time the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) on NASA’s Terra satellite captured this false-color image on October 20, 2009, the erupting mud truly resembled a volcano.
Walls contain the mudflow to a rectangular region in the center of the image. The landscape beyond the walls is still covered in plants, which are red in this false-color image. Water, usually dark blue in this type of image, is silvery white from reflected sunlight. The bright squares on the right side of the image are shrimp farms, and the ribbon of white along the bottom of the image is the Kali Porong, a river. Reflecting sunlight also colors the outer edges of the mudflow silver and highlights the texture of the growing mound over the vent at the center of the volcano. The mound was not visible in an ASTER image acquired in late 2008.
Called Lusi, the volcano formed suddenly in May 2006 probably because of drilling at the nearby gas well, say scientists from Indonesia, the United Kingdom, the United States, and Australia. The day before the eruption, pressurized gas and fluid flowed into the well, raising the pressure. The fluid and gas escaped into the surrounding earth, forcing mud to the surface along nearby cracks. As of June 2008, as much as 100,000 cubic meters of mud flowed from the volcano every day. This image shows that the eruption continued into 2009.
Lusi’s formation forced more than 30,000 people from their homes, destroyed more than 10,000 homes, schools, and other structures, and may have a wider impact on coastal and marine ecosystems.
References & Resources
|
<urn:uuid:686bbcd1-bc6d-4771-9224-e415514dcbbe>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.796875,
"fasttext_score": 0.04792588949203491,
"language": "en",
"language_score": 0.9227421283721924,
"url": "https://earthobservatory.nasa.gov/images/42526/lusi-mud-volcano-indonesia"
}
|
The Untold Truth Of Tear Gas
According to Anna Feigenbaum, author of Tear Gas: From the Battlefields of World War I to the Streets of Today, there's evidence that French police were experimenting with a precursor to tear gas in the days before World War I, as she told Vox. But it was that European slaughterhouse that saw the first gas warfare gain in popularity, including use of what are termed lacrimators (from the Latin word lacrima, for "tear") — the chemical compound irritates (to say the least) the mucous membranes of the eyes — a stinging sensation, with excessive tearing, per Encyclopedia Britannica. Other damage includes difficulty swallowing, tightness in the chest, coughing, shortness of breath, even a sensation of choking. There were nastier chemical agents used against troops during the conflict, but tear gas worked without (usually) killing anybody.
Business being business, once the war was over, eager minds sought a way to turn that piece of the military industrial complex into simple commerce — kind of like the way Tang moved from NASA to your breakfast table, only much, more more uncomfortable. In 1928, two chemists, Ben Corson and Roger Stoughton, came up with CS gas (using their initials) — chlorobenzylidenemalononitrile. According to the Centers for Disease Control and Prevention (CDC), chloroacetophenone (CN) is also commonly used.
Military, no; civilians, yes
Tear gas is classified as "riot control agent," per CNN, and so can be used by police departments, but is banned as a military weapon by the 1925 Geneva Protocol, writes USA Today. The compound isn't actually a gas at all, but a powder that's mixed into a liquid, pressurized, and then released into the air as droplets. Delivery systems include grenade-like canisters, or through individual aerosols. Anyone hit with tear gas is disabled from action beyond wanting desperately to counteract the effects of the chemical compound.
Effecting similar results are pepper sprays, which cause instant inflammation of the eyes, nose, and mouth. Those sprays require actual contact of the spray on the target — they're also effective against bears, says How Stuff Works. It's the same substance used in PepperBalls for crowd dispersal — essentially paintball ammunition loaded with pepper spray, hitting and causing painful pandemonium for the target and anyone standing nearby.
Theoretically, tear gas effects fade about 15 minutes after the compound is removed from a person, but if it's deployed within an enclosed space or in close proximity can have other, long-term effects, including blindness, glaucoma, and even respiratory failure. Perhaps that's why, according to CNN's June 8, 2020, report, cities like Seattle, Portland, and Denver have banned its use in crowd control.
|
<urn:uuid:d8bee799-c606-478a-9036-e8f0dabfb006>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.08830350637435913,
"language": "en",
"language_score": 0.9580494165420532,
"url": "https://www.grunge.com/216710/the-untold-truth-of-tear-gas/"
}
|
History of Lottery
Lottery is a form of gambling in which a person chooses numbers at random and hopes to win a prize. Some governments outlaw it completely, while others endorse it and organize state and national lotteries. Some governments even regulate the games and set rules and regulations for them. In other countries, such as the United States, lotteries are legal.
The origins of lottery games are incredibly long. In ancient China, people used the lottery to settle legal disputes, assign property rights, and even pay for wars. Lottery games were also used to fund major government projects. Throughout history, lottery games have been played throughout the world. They have become an immensely popular form of entertainment, as well as a popular source of funding. Today, there are many different versions of the game.
Lottery games were originally used to settle legal disputes, distribute jobs, and finance large government projects. The concept of lottery games was subsequently imported to Europe by the Roman Emperor Augustus and was used to fund public projects and wars. It was also used to fund charity and public works projects.
Origins in colonial America
The origins of lottery in colonial America are complex and varied. Initially used by the Virginia Company, the lottery became a major source of revenue for the colonists, helping them to build defenses and roads. It was even used by the Constitutional Congress to raise money for soldiers fighting for the American Revolution. However, this lottery was less successful than the colonists would have hoped. After the Revolution, the lottery became a major source of revenue for the new states. At that time, they weren’t keen on taxing newly independent citizens, so they turned to the lottery to raise funds.
The first lottery was held in 1612, when the Virginia Company wanted to raise funds to rebuild the colony of Jamestown. The first winner was Thomas Sharplisse, who won 4,000 crowns, a small fortune. After this first lottery, the Virginia Company held another one three years later, emphasizing the benefits of white colonization. People were encouraged to buy tickets, as they were perceived to be acting on behalf of their fellow countrymen. The lottery was also used to raise funds for public buildings, roads, and canals.
Origins in the Netherlands
Lottery games first became popular in the Netherlands during the seventeenth century as a way to raise money for public projects and the poor. They also served as an effective way to tax the wealthy. In 1726, the Staatsloterij, the oldest continuously operating lottery, was founded. The word lottery derives from the Dutch noun ‘lot’, meaning ‘fate’.
Since then, the lottery has expanded its popularity in every country around the world. Among the oldest, the Netherlands has the oldest lottery in the world. The Dutch government ran the lottery until 1992 when the Stichting Exploitatie Nederlandse Staatsloterij was established to oversee its operation. In 2007, the Netherlands merged two Dutch lottery companies into one.
Modern lotteries
Modern lotteries are a form of collective representation in late capitalist societies, representing various social forces. The form of lottery has a long history and has historically been a means of economic redistribution and collective representation. While some countries have legalized lotteries, others do not. Nevertheless, the lottery remains an important form of resource circulation and redistribution.
The history of lotteries can be traced back to the Renaissance era, when it was used to finance public works. Some Italian cities were even using lotteries as a way to collect taxes. Prizes for the winners were usually cash, but there were also prizes like carpets, jewels, servants, real estate, and even government contracts. The game that we know today as lotto evolved from a system of randomly selecting five public officials in the city of Genoa. People began betting on the names of these officials in hopes of winning cash prizes.
Addiction hazards
Lottery gambling can have many risks for those who gamble. The risks vary according to the individual, context, and structural factors involved. However, lottery gambling can result in daily dysfunction and deteriorating psychological health. It is important to consider these risks when designing a prevention program. In addition, there are other factors that influence the likelihood of acquiring an addiction to lottery gambling.
One study examined the risks of gambling addiction among patients with gambling disorders. It found that compared with other forms of gambling, lotteries were associated with greater rates of problem gambling. Researchers also found that lotteries were associated with more negative psychological effects.
|
<urn:uuid:58322adc-eecb-4613-b6b1-813a2eec2aed>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.71875,
"fasttext_score": 0.1723618507385254,
"language": "en",
"language_score": 0.9790862202644348,
"url": "http://getindur.com/history-of-lottery/"
}
|
less than 1 minute read
Sharpbill: Oxyruncidae
Sharpbills eat mainly fruit, insects, and insect eggs. They get their name from their pointed bill that allows them to hunt for food using what is called "pry and gape" behavior. When a sharpbill is feeding, it often hangs upside down on a branch and uses its pointed bill to pry into fruit, tightly rolled leaves, or moss growing on the tree. It then forces its bill apart (gapes) and collects seeds or insects from inside the fruit, leaves, or moss. This type of feeding behavior is uncommon. It is an example of a physical trait, the bill, and a behavioral trait, the feeding technique, evolving, changing over time, together to give the bird an advantage over competing species.
Additional topics
Animal Life ResourceBirdsSharpbill: Oxyruncidae - Physical Characteristics, Habitat, Diet, Behavior And Reproduction - GEOGRAPHIC RANGE, SHARPBILLS AND PEOPLE, CONSERVATION STATUS
|
<urn:uuid:badf5e5e-d7f7-4bdf-ada0-0b7c63904d7c>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.890625,
"fasttext_score": 0.8432045578956604,
"language": "en",
"language_score": 0.9099042415618896,
"url": "https://animals.jrank.org/pages/1039/Sharpbill-Oxyruncidae-DIET.html"
}
|
Crops > Grains > Rice > Leptocorisa acuta, white grains, PNG
Crops GrainsRiceLeptocorisa acuta, white grains, PNG
Rice bug, Leptocorisa acuta, PNG
December 2009. A problem on rice in Papua New Guinea. Rice is being damaged in the Aiyura Valley. As the crops are about to form, the seed kernels turn white and prevent grain formation. When the affected kernels are squeezed, a white milky liquid exudes. Rice is a new and emerging crop within the valley. When first planted, there was no problem, but now there is. It occurs on crops grown twice or three times on the same land.
It was thought to be the rice bug (Leptocorisa acuta) feeding during the milking stage. Both the nymphs and adults feed on tender stem and milky grains that cause chaffy or empty grains. The bugs also breeds on various grasses as well as on fruit trees, such as breadfruit, mango, etc. Extensive weedy areas adjacent to rice fields, and staggered rice plantings, favour rice bug populations.
There was a suggestion to check for the whitetip nematode, Aphelenchoides besseyi.
|
<urn:uuid:389e6707-4529-449a-955c-12c479fa826f>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.04336893558502197,
"language": "en",
"language_score": 0.8977543115615845,
"url": "https://www.pestnet.org/crops-grains-rice-leptocorisa-acuta-white-grains-png/"
}
|
Definitions for: Divide
[n] a line that divides two adjacent river systems
[v] perform a division; "Can you divide 49 by seven?"
[v] force, take, or pull apart; "He separated the fighting children"; "Moses parted the Red Sea"
[v] come apart; "The two pieces that we had glued separated"
[v] make a division or separation
[v] act as a barrier between; stand between; "The mountain range divides the two countries"
Webster (1913) Definition: Di*vide", v. t. [imp. & p. p. Divided; p. pr. & vb.
n. Dividing.] [L. dividere, divisum; di- = dis- + root
or pieces; to sunder; to separate into parts.
houses; a stream divides the towns.
profits of stock among proprietors; to give in shares; to
distribute; to mete out; to share.
True justice unto people to divide. --Spenser.
hostile; to set at variance.
If a kingdom be divided against itself, that kingdom
can not stand. --Mark iii.
Every family became now divided within itself.
votes for and against a measure; as, to divide a
legislative house upon a question.
6. (Math.) To subject to arithmetical division.
7. (Logic) To separate into species; -- said of a genus or
generic term.
8. (Mech.) To mark divisions on; to graduate; as, to divide a
9. (Music) To play or sing in a florid style, or with
variations. [Obs.] --Spenser.
Syn: To sever; dissever; sunder; cleave; disjoin; disunite;
detach; disconnect; part; distribute; share.
Di*vide", v. i.
The Indo-Germanic family divides into three groups.
--J. Peile.
2. To cause separation; to disunite.
A gulf, a strait, the sea intervening between
islands, divide less than the matted forest.
3. To break friendship; to fall out. --Shak.
4. To have a share; to partake. --Shak.
separating themselves into two parties (as on opposite
ayes dividing from the noes.
The emperors sat, voted, and divided with their
equals. --Gibbon.
Di*vide", n.
A dividing ridge of land between the tributaries of two
streams; a watershed.
Synonyms: carve up, dissever, disunite, fraction, part, separate, separate, separate, separate, split, split up, water parting, watershed
Antonyms: multiply, unify, unite
See Also: Balkanise, Balkanize, break, break, break, break away, break off, break up, break up, bust, calculate, calve, canton, change, change integrity, chip, chip off, cipher, close off, come away, come off, compartmentalise, compartmentalize, compute, continental divide, cut, cut up, cypher, detach, detach, disarticulate, disconnect, disjoin, disjoint, dismember, dispel, disperse, displace, dissipate, divide, figure, format, gerrymander, gin, Great Divide, Great Dividing Range, halve, initialise, initialize, isolate, keep apart, line, lot, move, paragraph, parcel, partition, partition, partition off, polarise, polarize, quarter, rail, rail off, reckon, reduce, rupture, scatter, section, sectionalise, sectionalize, segment, segregate, sequester, sequestrate, set apart, sever, shut off, sliver, snap, splinter, subdivide, subdivide, take apart, tear, triangulate, unitise, unitize, work out, zone
Try our:
Scrabble Word Finder
Scrabble Cheat
Words With Friends Cheat
Hanging With Friends Cheat
Scramble With Friends Cheat
Ruzzle Cheat
Related Resources:
animals starting with o
animals begin with l
|
<urn:uuid:dc551337-d60e-4eef-af0c-293625a21b7f>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.3129708766937256,
"language": "en",
"language_score": 0.8157114386558533,
"url": "https://www.blogmybrain.com/scrabble-word-finder/word/divide.htm"
}
|
How To Use a E6B Flight Computer
Using an E6B flight computer boils down to lining up values on circular rulers—the outside, middle, and inside known as “scales”—and reading the results. There is a great deal of information on the device, so we’re going to walk through how to decode it for best results.
What Is a Flight Computer?
A flight computer is used by a pilot to determine aircraft groundspeed, time, airspeed and distance calculations, fuel burn, time en route, and density altitude. It also converts knots to miles per hour and vice-versa, true airspeed to calibrated airspeed and vice versa, Celsius to Fahrenheit, and calculates wind correction angles.
How Does a Flight Computer Work?
A mechanical flight computer is basically a slide rule on steroids. They work because someone has figured out the formulas (example: time, speed, and distance) and arranged the values on the scales of the device so that when numeric values line up, the answers the pilot seeks are there.
E6B Flight Computer vs. Electronic Flight Computer
An E6B flight computer, also known as a mechanical flight computer, is made from metal, plastic, or cardboard. It can be intimidating to look at and challenging to use at first—but fortunately, they come with directions. The formulas are printed on the face of the instrument for many of the critical calculations. There are also some fine videos online that can be used to learn how to operate the unit. The mechanical E6B does not require batteries and it does not break when you drop it. In addition, the metal E6Bs can be turned into cutting devices or shovels in a survival situation by sharpening the edge of the device with a rock.
The electronic E6B is a calculator on steroids. By plugging in the formulas printed on the instrument, you can get the information you seek. The electronic E6B is more precise than the mechanical E6B and is easier to read because the results print out on a screen. However, it requires a power source—often batteries—and the screen may be difficult to read in direct sunlight. It can also be damaged by heat and destroyed by impact if and when you drop it or crush it.
How To Use an E6B Flight Computer
The E6B flight computer looks intimidating at first—there are so many scales and numbers and formulas printed on it. But if you can read and follow the instructions—which are conveniently printed on the instrument—you can master the “whiz wheel” with a little practice.
Parts of the Flight Computer
The mechanical E6B flight computer has two sides: the windside, which a pilot uses to determine ground speed and wind correction angles, and the calculator side that is used to determine aircraft fuel burn, temperature and speed conversions, and time, speed, and distance calculations. There are three scales on the calculation side of the E6B, starting from the outside and working in, they are the A scale, the B scale, and the C scale.
It’s helpful to spend a few minutes looking at the fine print on the scales to see what can be gleaned from them. There will be acronyms such as TAS (true airspeed) and CAS (calibrated airspeed) and inside windows that provide information on density altitude.
You will also note there are rulers on the side of the unit that measure nautical miles for the sectional scale, and there is a temperature conversion chart at the bottom of the device.
Scale Values
The numbers on the scales represent varying values, so the user must apply some common sense. For example, one of the calculations you can do is time, speed, distance calculations.
We begin by placing the index pointer—that’s that arrowhead shaped thing on the B scale across from the Ground Speed on the A scale. So if the pilot determined that the ground speed is going to be 100 knots, the pointer will be opposite the number 10 on the A scale.
Let’s say you are trying to determine the time en route to cover a leg that is 13 nm. You know your ground speed is 100 knots and you put the pointer on 10, understanding that it is 100 in this case. Now, find the number 13 on the A scale. Directly below the 13 on the B scale will be the time en route in minutes. No. 13 is directly across from 78. Common sense tells us that it won’t take 78 minutes to travel 13 nm, so the correct answer here is 7.8 minutes.
Calculating Knots/Miles Per Hour
Calculating ground speed, be it in knots or miles per hour (mph) is done on the wind side of the E6B. To get this value you will need to have obtained a weather briefing to get the direction and velocity of the winds before you solve this problem. Let’s say, for example, the winds are from 220 at 10 knots.
Note there is a hole in the center of the face on the wind side—this is sometimes called the grommet, and it creates the center of the face. Place the grommet on one of the heavy horizontal lines. It really doesn’t matter which one, because you establish that this line is the base or zero. Note the horizontal lines are marked in 10-degree increments. Mark the wind velocity up from the dot—so in this example, you would find the next heavy line 10 degrees up and, using a pencil, mark the dot. This is the wind dot. Pro tip: if you are going to be calculating multiple wind velocities, for example at different altitudes, use a different symbol for each. For example, for the winds at 3,000 feet, use an X, and for the winds at 6,000 feet, use a dot, etc. Another method is to use a water-soluble marker in different colors—write the “key” for the wind direction on the nav log: 3,000, red; 6,000, green, etc.
The next step is to place the plotter—that’s a big ruler made of plastic necessary for navigation—on the sectional to determine the true course (TC). Once you have this value, find the TC on the rotating scale on the windside of the E6B and place it under the true index.
True airspeed (TAS) is found in the aircraft performance manual section of the pilot’s operating handbook for that particular airplane. There is a chart that lists TAS for powersettings, altitudes, and temperatures.
For this example, we will say the true course is 190 degrees and the true airspeed is 110.
Slide the wind dot until it is on the horizontal line that has the value of the true airspeed—in this case 110—on the E6B and read the ground speed directly under the grommet—which in this case, is 102.
Calculating Speed, Distance, and Time
Calculating ground speed, be it in knots or mph, can be done by finding the distance traveled and the time it took to travel that distance. This is known as a ground speed check. To do this, you need to know the distance from ground checkpoint to ground checkpoint. This information is written down in the nav log. The pilot obtains this information by measuring the distance on the sectional by using the nautical miles scale on either the plotter or on the ruler marked sides of the E6B.
Let’s say the aircraft is over Big Lake and your next checkpoint is College Campus. You measured the distance and have determined it is 15 nm. You started the timer in the aircraft when you were over Big Lake. When you reached College Campus, you note it took 8 minutes to get there.
Line up 15 on the A scale over the 8.0 on the B scale.
Now note the pointer is lined up with 11.2 on the A scale. Here’s where we use some common sense again—11 mph or 11 knots wouldn’t make sense—but a ground speed of 112, does, and that’s the answer.
Now, let’s try one where the pilot knows the ground speed but isn’t sure of the time it will take to get there.
The distance is 21 nm. The pilot determined the ground speed for the flight would be 120 knots.
Place the index under the 12 (which represents 120 in this case) on the A scale.
Find 21 on the A scale. Directly across from it on the B scale will be the time en route: roughly 10.5 minutes.
Now, let’s solve one for distance. Our pilot knows the ground speed is 120, and has been flying for 10 minutes but hasn’t been paying attention—how far have they traveled? Keep the pointer on the ground speed of 120—note the time on the B scale of 10 minutes—directly across from the time on the A scale is the distance traveled: 20 miles.
Calculating Fuel
In order to calculate fuel burned during a flight, you need to reference the fuel burn charts from the aircraft manual or pilot’s operating handbook for the aircraft. The chart shows the estimated fuel burn per hour as determined by powersetting, temperature, and altitude.
You will also need to know the time en route, factor in the time and fuel spent for taxi and takeoff, approach, and the necessary fuel reserves.
Let’s say the pilot determined it would take approximately 20 minutes to do the run up and taxi for takeoff.
The pilot, using the Time to Climb chart in the POH, determines it will take 10 minutes to reach the designated altitude.
The pilot determines the en route time will be 67 minutes.
The pilot figured 10 minutes for the landing approach.
The regulations call for a 30-minute fuel reserve for VFR flight.
According to the fuel consumption chart in the POH, the fuel burn per hour at the power setting and altitude the pilot has selected is 8.2 gallons per hour (gph).
Total up the time: 20 minutes for taxi/takeoff + 10 minutes time to climb + 67 minutes en route + 10 for approach + 30 for reserve = total fuel required.
Place the point on the calculation side of the E6B to 8.2 on the A scale.
Total up the minutes flying + the fuel reserve = 137 minutes
Find 137 on the B scale—directly across from it on the A scale is 18.8, so the total fuel required for this flight is 18.8 gallons.
Calculating True Airspeed
To calculate your true airspeed (TAS), set your pressure altitude across from the temperature in Celsius in the air temperature window in the center of the E6B.
If needed, use the temperature conversion chart at the bottom of the instrument that can be used to convert Fahrenheit into Celsius.
Opposite the calibrated airspeed (CAS) on the B scale note the true airspeed (TAS) on the A scale.
Calculating Density Altitude
Density altitude is a condition that affects aircraft performance. High density altitude conditions are encountered when there are high temperatures, high field elevations, or high humidity. You only need one value—high temperature, elevation, or humidity—to experience high density altitude.
To calculate density altitude you need to know the temperature and pressure altitude (what the altimeter reads when set to 29.92 in the Kollsman window) but lacking that, use the field elevation which can be obtained off the sectional or airport website.
Find the density altitude window on the E6B. Line up the temperature given over the pressure altitude value or field elevation in the center of the E6B on what is known as the C scale.
Let’s say the temperature outside is 102 degrees Fahrenheit, and the field elevation is 4,000 feet msl.
Use the scale at the bottom of the E6B to convert the temperature to 40 degrees Celsius.
Find the air temperature window on the C scale and line up 40 degrees over 4,000 in the pressure altitude window. The density altitude can be read in the window—conveniently labeled density altitude—in this case, it reads approximately 7,000 feet.
The Most Useful Tool in Your Flight Bag
The E6B is a necessary tool for all pilots—yes, there are apps that can perform these calculations for you, but they require a power source to operate, and if the device is broken or runs out of juice, you are in a bad situation. You may find it easier to use the mechanical E6B for multiple applications—for example, let’s say you have determined that your ground speed for the flight will be 107 knots. Place the pointer on 107, then look on the A scale and note the distances of the checkpoints you have selected: 16 nm, 21 nm, 19 nm. How long will it take you to reach each one? 9 minutes, just under 12 minutes, and 10.5 minutes—all computed with a glance, as opposed to having to clear and re-enter integers into an electronic E6B. However, the electronic E6B (because it is essentially a calculator) can be easier to use for some people.
How do you convert calibrated altitude to true altitude?
Set pressure altitude opposite C in the window. Opposite CAL ALT on B scale read TRUE ALT on A scale.
What is better, an analog (mechanical) or electronic flight computer?
Analog (mechanical) devices, once you learn to use them, are quicker to use because you can set the pointer on the ground speed and simply glance around the whiz wheel to see the estimated time en route. With an electronic flight computer, you have to keep re-entering the equations. In addition, the mechanical E6B is not temperature sensitive, and because it is made from cardboard, plastic, and/or metal, it is less susceptible to damage if dropped. However, some people find the multiple scales on the mechanical E6B intimidating and prefer the relative straightforwardness of the electronic flight computer.
Enjoy Safer Flights with Sentry Plus
The all-new Sentry Plus is loaded with safety features: subscription-free weather, dual band ADS-B traffic, backup attitude, and a carbon monoxide detector.
New to Flying?
Already have an account?
|
<urn:uuid:fee51b7c-bfc5-42c7-958c-efe21d10eea5>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.5064069032669067,
"language": "en",
"language_score": 0.9043064713478088,
"url": "https://www.flyingmag.com/guides/how-to-use-a-e6b-flight-computer/"
}
|
Kadalie, Clements
ca. 1896–1951
South African labor leader
Clements Kadalie, an early African labor leader, organized a black union that challenged white rule in SOUTH AFRICA. After graduating from high school in his home country of Nyasaland (now MALAWI), Kadalie traveled through southeastern Africa. He arrived in CAPE TOWN in 1918. That year he founded the Industrial and Commercial Workers Union of Africa, which became known as the Industrial and Commercial Union or ICU. Africans referred to the union as ICU Mlungu, or “I see you, white man.”
In its first two years, the ICU led successful strikes around the country. The union was so effective that it won wage increases for Cape Town dockworkers merely by threatening to strike. By the 1920s over 100,000 workers had joined the ICU, making it the largest nonwhite union in the country. However, the union's size also made it a threat to the white government of South Africa.
In 1923 the leader of the South African government, Jan SMUTS, passed a law that increased segregation in towns. The following year he granted all workers except blacks the right to bargain with employers as a group. In response, Kadalie encouraged blacks to support a political coalition running against Smuts in the 1924 election. The coalition won, but once in office it failed to improve conditions for black workers. Instead it adopted a policy that reserved certain jobs for whites. The ICU broke up in 1929. However, Kadalie formed a new union called the Independent ICU. He later spent two months in jail for leading the Independent ICU in a general strike. Kadalie wrote an autobiography, My Life and the ICU: The Autobiography of a Black Trade Unionist in South Africa. It was not, however, published until 1970—nearly 20 years after the author's death. (See also Unions and Trade Associations.)
|
<urn:uuid:9f146834-a876-4e86-8363-2d7c47ec7a21>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5,
"fasttext_score": 0.04612469673156738,
"language": "en",
"language_score": 0.94273442029953,
"url": "https://geography.name/kadalie-clements/"
}
|
What Should You Know About Phlebitis?
Picture of an vein inflamed with phlebitis.
Picture of an vein inflamed with phlebitis.
What Is the Medical Definition of Phlebitis?
Phlebitis (fle-BYE-tis) is a condition in which a vein becomes inflamed (phleb=vein + it is=inflammation). The inflammation may cause pain and swelling. When the inflammation is caused by a blood clot or thrombus, it is called thrombophlebitis. Thrombophlebitis usually occurs in leg veins, but it may also affect the veins in the arms.
What Are Phlebitis Symptoms?
Some people with phlebitis have no symptoms, but others may experience signs like pain, tenderness, redness, and a bulging vein.
What Causes Phlebitis?
Phlebitis can be caused by many things, for example, sitting to long on long drives, train or plane rides, varicose veins, some cancers, and after surgery.
What Are the Types of Phlebitis?
There are two sets of veins in the arms and legs, 1) the superficial veins that run just under the skin, and 2) the deep veins. Superficial phlebitis affects veins on the skin surface. The condition is rarely serious and usually resolves with local treatment of the inflammation with warm compresses and anti-inflammatory medications. Sometimes superficial phlebitis can be associated with deep vein thrombophlebitis and medical evaluation may be needed. Phlebitis in the deep veins is referred to as deep vein thrombophlebitis (or DVT, deep vein thrombosis) affects the veins located deeper in the arms and legs. Blood clots (thrombi) that form may embolize or break off and travel to the lungs. This is a potentially life-threatening condition called pulmonary embolism.
What Is the Treatment for Phlebitis?
Doctors treat phlebitis based on what condition is causing it.
What Are the Symptoms and Signs of Superficial Phlebitis and DVT?
Superficial phlebitis
• There is usually a slow onset of a tender red area along the superficial veins on the skin. A long, thin red area may be seen as the inflammation follows the path of the superficial vein. It may spread in a spider like pattern if smaller feeder veins become involved.
• This area may feel hard, warm, and tender. The skin around the vein may be itchy and swollen.
• The area may begin to throb or burn.
• Symptoms may be worse when the leg is lowered, especially when first getting out of bed in the morning.
• A low-grade fever may occur.
• Sometimes phlebitis may occur at the site where a peripheral intravenous (IV) line was started. The surrounding area may be sore and tender along the vein.
• If an infection is present, symptoms may include redness, fever, pain, swelling, or breakdown of the skin.
Deep vein thrombophlebitis
The classic signs and symptoms include redness, warmth, swelling, and pain in the affected extremity. Often one extremity is more swollen than the other. Occasionally the discoloration may be more bluish than red.
Spider & Varicose Veins: Causes, Before and After Treatment Images See Slideshow
What Causes Phlebitis?
Superficial phlebitis is usually caused by local trauma to a vein. Superficial phlebitis is most often caused by an intravenous catheter (IV) placed in a vein, and the vein becomes irritated. Superficial phlebitis may or not have a blood clot form to cause the pain and inflammation. In the legs, superficial phlebitis can be associated with varicose veins.
Causes of deep vein thrombosis or thrombophlebitis include:
• inactivity (blood pools in the veins and tends to clot if a person is inactive for a prolonged period of time);
• trauma, and
• blood clotting abnormalities (may be inherited).
Risk factors for DVT include:
• Prolonged inactivity (for example, a long airplane or car ride, an extremity immobilized in a cast or splint, being bedridden for an illness or after surgery, a sedentary lifestyle, inactivity with little or no exercise)
• Obesity
• Smoking cigarettes, especially when combined with hormone replacement therapy or birth control pills
• During pregnancy, the enlarged uterus can also compress the large veins in the pelvis increasing the risk of blood clotting.
• Certain medical conditions such as cancer or blood disorders that increase the potential of blood clotting
• Injury to the arms or legs
When Should You Call a Doctor for Phlebitis?
Call your doctor if there is swelling or pain in an extremity. Especially, if there are risk factors for deep vein thrombophlebitis including prolonged travel, bed rest, or recent surgery.
Deep vein thrombophlebitis requires immediate medical care, especially if you have any of these signs and symptoms:
• High fever with any symptoms in an arm or leg
• Lumps in a leg
• Severe pain and swelling in an arm or leg
• Chest pain and shortness of breath, which could be the symptoms of pulmonary embolism (blood clot in the lung).
How Do You Know if You Have Phlebitis?
A healthcare professional will ask you questions about your swollen arm or leg and will give you a physical exam. If the diagnosis is superficial phlebitis, often no further tests are necessary. If there is concern about deep vein thrombosis (DVT), further tests may be ordered.
• D-Dimer is a chemical that is released by blood clots as they begin to disintegrate. If this blood test is normal, then a blood clot is not present. Unfortunately, the test does not tell the doctor the location where a blood clot might be. For instance, it will be positive in people with a bruise or those who have recently had surgery. This blood test needs to be ordered only when there is a low risk of DVT being present. A positive test usually requires that some imaging test of the arm or leg be ordered to look for a potential blood clot.
• Ultrasound can detect clots or blockage of blood flow, especially in larger, more proximal (upper leg) veins. A small hand-held instrument (probe) is pressed against the patient's skin to help identify blood clots and the location of the obstruction. This is a non-invasive test which is relatively painless.
• Sometimes the ultrasound test cannot adequately "see" the veins and determine whether a clot is present. Venography may be required in which dye is injected directly into the vein and X-rays are taken to evaluate the vein.
Can You Treat Phlebitis at Home?
The pain from superficial phlebitis can be treated at home by applying a warm compress to the affected area, and taking nonsteroidal anti-inflammatory pain relievers (NSAIDs) like ibuprofen (Motrin, Advil), naproxen (Aleve, Anaprox, Naproxen), and aspirin to prevent a blood clot in the leg. Prescription leg compression stockings (knee or thigh high) improve blood flow and may help to relieve pain and swelling, and decrease the risk of developing DVT.
What Is the Treatment for Phlebitis?
Treatment for superficial phlebitis includes warm compresses and anti-inflammatory medications such as ibuprofen. Compression stockings may be helpful. If there is a skin infection associated with the superficial phlebitis, antibiotics may be prescribed.
Treatment for deep vein thrombophlebitis are blood thinning drugs to prevent pulmonary embolism. Initial treatment may begin with enoxaparin (Lovenox), an injectable medication that immediately thins the blood. Warfarin (Coumadin) is also started immediately but takes a few days to reach therapeutic levels in the blood, so Lovenox is used as a bridge until that occurs. INR is a blood test that measures the clotting function of blood and is used as a guide to determine warfarin dosing.
Are Superficial Phlebitis or DVT Life-Threatening?
Superficial phlebitis is rarely serious and usually responds to pain control, elevation, and warm compresses.
Deep vein thromboembolism is potentially life-threatening if not treated, pulmonary embolism is a potential complication. It is important to find out why the DVT occurred and minimize the risk factors for a future occurrence. DVT can damage the internal structure of the vein leading to the complication of a post-phlebitic leg with chronic leg swelling and pain.
What Can You Do to Prevent Phlebitis or DVT?
The best way to prevent phlebitis is to be active. Participate in daily exercise such as walking, swimming, jogging, cycling, dance classes, etc. Avoid prolonged periods of sitting or lying down (if possible). Avoid bed rest for prolonged periods.
If you are limited to bed rest, wear supportive stockings. When traveling and movement is limited for long periods of time, get up and move around occasionally or stop at a rest stop and move around. Keep hydrated and drink plenty of fluids. Changing of IV lines will help prevent phlebitis.
Health Solutions From Our Sponsors
DVT (Blood Clot in the Leg)
Phlebitis in the deep veins
Fauci, AS, et al. Harrison's Principles of Internal Medicine, 20th Ed. United States: McGraw-Hill Education, 2018.
Patient Comments & Reviews
|
<urn:uuid:5c98274c-1262-47a0-aa5c-2baa6d724095>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5625,
"fasttext_score": 0.028684377670288086,
"language": "en",
"language_score": 0.9067671895027161,
"url": "https://www.emedicinehealth.com/phlebitis/article_em.htm"
}
|
Icing occurs when supercooled water freezes at impact with airplane´s surface. The freezing process is possible when there is supercooled water present in temperatures 0ºC ... -40ºC. In practice, there is no significant icing in clouds with the top temperature below -15ºC. Most common (and severe) cases of icing occurs in temperatures 0ºC ... -12ºC.
The amount or percentage of supercooled water within clouds is hard to measure. At mid-levels an estimate has been made combining radar and lidar measurements. This gives a rough picture of the occurrence of icing depending on temperature. The real values may be greater, because this method cannot take into account fronts and possible multiple icing layers. An aircraft measurement has shown that there might be as many as four separate icing layers on top of each other.
Fig. 2.1. Fraction of clouds (between 0 and 1) containing highly reflective layers (indication of liquid water) as a function of cloud temperature/K. Data collected by lidar (www.met.reading.ac.uk/).
|
<urn:uuid:be8c10fd-0c78-4604-9793-1049e3b47706>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.609375,
"fasttext_score": 0.0349007248878479,
"language": "en",
"language_score": 0.9129602313041687,
"url": "https://resources.eumetrain.org/data/2/253/navmenu.php?tab=2&page=1.0.0"
}
|
Travel through wormholes is possible, but slow
Credit: CC0 Public Domain
A Harvard physicist has shown that wormholes can exist: tunnels in curved space-time, connecting two distant places, through which travel is possible.
But don't pack your bags for a trip to other side of the galaxy yet; although it's theoretically possible, it's not useful for humans to through, said the author of the study, Daniel Jafferis, from Harvard University, written in collaboration with Ping Gao, also from Harvard and Aron Wall from Stanford University.
"It takes longer to get through these wormholes than to go directly, so they are not very useful for ," Jafferis said. He will present his findings at the 2019 American Physical Society April Meeting in Denver.
Despite his pessimism for pan-galactic travel, he said that finding a way to construct a through which light could travel was a boost in the quest to develop a theory of quantum gravity.
"The real import of this work is in its relation to the black hole information problem and the connections between gravity and ," Jafferis said.
The new theory was inspired when Jafferis began thinking about two that were entangled on a quantum level, as formulated in the ER=EPR correspondence by Juan Maldacena from the Institute for Advanced Study and Lenny Susskind from Stanford. Although this means the between the black holes is shorter than the wormhole connection—and therefore the wormhole travel is not a shortcut—the theory gives new insights into quantum mechanics.
"From the outside perspective, travel through the wormhole is equivalent to quantum teleportation using entangled black holes," Jafferis said.
Jafferis based his theory on a setup first devised by Einstein and Rosen in 1935, consisting of a connection between two black holes (the term wormhole was coined in 1957). Because the wormhole is traversable, Jafferis said, it was a special case in which information could be extracted from a black hole.
"It gives a causal probe of regions that would otherwise have been behind a horizon, a window to the experience of an observer inside a spacetime, that is accessible from the outside," said Jafferis.
To date, a major stumbling block in formulating traversable wormholes has been the need for negative energy, which seemed to be inconsistent with quantum gravity. However, Jafferis has overcome this using quantum field theory tools, calculating quantum effects similar to the Casimir effect.
"I think it will teach us deep things about the gauge/gravity correspondence, quantum gravity, and even perhaps a new way to formulate mechanics," Jafferis said.
More information: The presentation, "Traversable wormholes" will take place at 11:21 a.m. MT, Saturday, April 13, in room Plaza D of the Sheraton Denver Downtown Hotel. Abstract: meetings.aps.org/Meeting/APR19/Session/B02.2
Citation: Travel through wormholes is possible, but slow (2019, April 15) retrieved 28 November 2022 from https://phys.org/news/2019-04-wormholes.html
Explore further
Scientists dismiss the idea of travel through wormholes
Feedback to editors
|
<urn:uuid:499f8637-bb8e-4f6f-9042-c2862a835d2a>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.75,
"fasttext_score": 0.019053161144256592,
"language": "en",
"language_score": 0.9519397020339966,
"url": "https://phys.org/news/2019-04-wormholes.html"
}
|
Avant-garde is a French term meaning “vanguard”, used to describe works that are cutting edge. It refers to any group that is innovative, unorthodox, or experimental in inventing and applying new ideas, techniques or art forms. Avant-garde works are often radical and shocking, pushing the boundary of what is considered acceptable.
Some examples of avant-garde art include Dadaism, Surrealism, and Abstract Expressionism. These movements were all characterized by their rejection of traditional values and conventions. They sought to create something new and expressive, often shocking the mainstream audience.
Avant-garde artists often experiment with new mediums and techniques, pushing the boundaries of what is possible. They are not afraid to take risks, and their work often challenges conventional ideas about art.
Despite their rebellious nature, avant-garde artists have had a significant impact on the course of art history. Their innovative works have inspired generations of artists and helped to shape the way we think about art today.
|
<urn:uuid:5daa0023-7bc9-4522-a4bd-74e0f491a8cd>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.765625,
"fasttext_score": 0.9979448318481445,
"language": "en",
"language_score": 0.9692521095275879,
"url": "https://www.artmatcher.com/glossary/avant-garde/"
}
|
Flocking is the behaviour exhibited when a group of birds, called a flock, are foraging or in flight.
Two flocks of common cranes
A swarm-like flock of starlings
Computer simulations and mathematical models that have been developed to emulate the flocking behaviours of birds can also generally be applied to the "flocking" behaviour of other species. As a result, the term "flocking" is sometimes applied, in computer science, to species other than birds.
This article is about the modelling of flocking behaviour. From the perspective of the mathematical modeller, "flocking" is the collective motion by a group of self-propelled entities and is a collective animal behaviour exhibited by many living beings such as birds, fish, bacteria, and insects.[1] It is considered an emergent behaviour arising from simple rules that are followed by individuals and does not involve any central coordination.
|
<urn:uuid:285612e6-07de-4f55-a2d3-74b28d5948f2>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.6724173426628113,
"language": "en",
"language_score": 0.9474549889564514,
"url": "https://www.wikiwand.com/en/Flocking_(behavior)"
}
|
A Childhood Game
A Childhood Game
A Childhood Game
In the morning, before the sun rose, a group of Nigerian-Igbo boys, girls, and boys, ages four to six, would gather in the front yard of the family home and use a dry twig to scratch a grid of columns. and rows within a six-foot square area on sandy, earthy soil. Then we would take turns lining up with our backs to the grill. From outside the margin, the first boy would throw a pebble at his head, hoping that he would land on one of the smaller units on the grid. Then, still facing the edge of the grid, the thrower must retrieve the stone, wherever it may have fallen, from outside the edge.
A good throw was when the stone landed with a thud in the center of a unit, where the child could support himself on one leg and one hand, stretch the body and retrieve it with the free hand. A successful throw and retrieve gave the boy ownership of the drive, and he could use the acquired drives to retrieve thrown pebbles in the future. The most affordable units to get were those closest to the fringes, and we would try those first. A pebble that did not fall into any unit was a bad throw, allowing the next child to throw it.
Aiming and throwing overhand from behind was a challenge for most kids. It was like groping in the dark. You had to mentally calculate the position of each of the units so that a thrown pebble could fall on them without slipping.
There was a lot of motor planning (praxis) in that critical part of the play. For example, the child had to think about how much force to apply to the stone and in which direction he wanted it to go. He also had to remember which units were still open, and those units that have not yet been acquired. Retrieving the stone from where it fell was also a challenge. To do that, they had to support his body on one leg and one arm, while using the other hand to pick up the pebble. This maneuver must have put the vestibular balance system to the test, as well as the joints and proprioception. Children who did not have a sound balance system would often tip over and fall on their abdomen.
Occasions also arose where children were expected to hop around units on one leg to retrieve the pebble. It was against the rule for the soles of the feet to touch the lines. Avoiding breaking the rule required a lot of precision and praxis, and coordination between the visual system, (A Childhood Game) the motor system, and the vestibular system. We did multiple reps and reps. Each game lasted for hours and became more difficult when each child had to place their stone on a remaining unit in the corner of the grid. However, I think we persevered because we were competing with each other and because the play was challenging.
That’s not to say there weren’t frustrations. Children with balance difficulties were especially frustrated with this particular game. Ironically, I remember the frustrating aspect of the game more than the routine parts. I remember the tendency of the stone to slip off the grid, (A Childhood Game)the numerous times the children stepped on the lines, and the children fell on their abdomens when they extended their right hand while balancing on their left arm and left leg. Falling, while disappointing, was also fun. Unfortunately, like cultures, bona fide Igbo children’s games continue to disappear from the playlist of games that children can play.
Leave a Reply
|
<urn:uuid:7e875299-3410-499d-9da6-c1429ce57e90>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.10492807626724243,
"language": "en",
"language_score": 0.982332170009613,
"url": "https://trampolinecare.com/a-childhood-game/"
}
|
Crimping tool
Updated: 08/02/2020 by Computer Hope
A crimping tool is a device used to conjoin two pieces of metal by deforming one or both of them to hold each other. The result of the tool's work is called a crimp. An example of crimping is affixing a connector to the end of a cable. For instance, network cables and phone cables are created using a crimping tool (shown below) to join RJ-45 and RJ-11 connectors to both ends of phone or Cat 5 cable.
Phone and Networking crimping tool
How does it work?
To use this crimping tool, each wire is first placed into the connector. Then, the connector with wires are placed into the crimping tool, and the handles are squeezed together. Crimping punctures the plastic connector and holds each of the wires, allowing data to transmit through the connector.
Network terms, Tools
|
<urn:uuid:fb944c56-d441-4873-a13d-65fffe980126>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.609375,
"fasttext_score": 0.8798699378967285,
"language": "en",
"language_score": 0.9209766983985901,
"url": "https://www.computerhope.com/jargon/c/crimp.htm"
}
|
Did You Know? The Port Trade Centre of Arikamedu and Roman Exchange with the Indian Subcontinent
© Jayaseerlourdhuraj
Throughout history the Indian Subcontinent has had extensive commercial links with regions to the west through both overland and maritime trade. Many sources dating as far back as the 1st millennium BCE attest to trade between Western Asian and the west coast of the Indian Subcontinent and it is believed that the Babylonians used teak and cedar woods imported from the Indian Subcontinent as early as the 7th and 6th centuries BCE. Much later, merchants from the South of the Arabian Peninsula embarked on extensive maritime trade with the Indian Subcontinent supplying goods from the region to the Mediterranean and Western Asia. During the Roman period close contact between these regions and the Indian Subcontinent intensified, with the Emperor Augustus receiving two embassies, most likely trade missions, from the Indian Subcontinent around 21- 25 BCE. These commercial links typically reached Northern India overland and Peninsula India via maritime routes. However, much less is known about maritime contact with the eastern coast of the Indian Subcontinent compared to the western coast during the same period.
One site which has provided considerable insight into Silk Roads contacts on the south eastern coast of the Indian Subcontinent is Arikamedu, an archaeological site located in Southern India close to the city Puducherry on the banks of the Ariyankuppam river. Arikamedu was an Indo-Roman trading city and one of the earliest known Indo-Pacific bead making centres. The site was mentioned in the Periplus of the Erythraean Sea an anonymous Greco-Roman text of the 1st century CE which described the known coastal landmarks and ports of the Indian Subcontinent’s coastline. Here Arikamedu was referred to by the Roman name ‘Poduke’, appearing again as ‘Poduke emporion’ in Ptolemy’s atlas Geographia in the mid-1st century CE.
Excavations at the site have uncovered substantial evidence of a Roman trading settlement including amphorae, lamps, glassware, coins, beads made of stone, glass and gold, and gems. Based on these finds it appears the settlement engaged in considerable trade with the Roman and later Byzantine world during an extensive period from the 2nd century BCE to the 8th century CE. In addition to this trade Arikamedu was also a centre of manufacture in its own right producing textiles, particularly the cotton fabric muslin, jewellery, stone, glass, and gold beads (for which the settlement was particularly renowned). Many distinctive wares have been uncovered which clearly pre-date Roman exchange including products made locally such as shells, beads and pottery indicating a flourishing local craft tradition before the arrival of foreign influences. Some of the most significant finds from this site of Silk Roads exchange include Indo-Pacific beads, red and black ceramics, and large stones used to mark graves, all of which pre-date its history as a trading post.
The considerable amount of pottery that has been uncovered at Arikamedu can be categorised into three different types, ‘Arretine’ ware named for the Roman city Arezzo in Tuscany where it was produced and imported, amphorae, and rouletted ware, a decorative pottery characterised by an engraved rim on a grey or black surface covered in spiral linear patterns. The rouletted ware has been the subject of much study as later excavations in the 1990s demonstrated that, contrary to earlier scholarship which believed rouletted ware to have been imported from the West, this pottery was actually produced locally, if not at Arikamedu itself then somewhere in South Asia. Despite these findings, the rouletted ware found at Arikamedu often reveals a distinctive foreign influence, most likely from its contacts with Rome, which was blended with local styles. Additionally, it is possible that craftsmen from the Roman world lived and worked at workshops in Arikamedu as two gemstones called intaglio (a distinctive style of engraved gem and major luxury art form in the Ancient World) featuring designs frequently used by Greco-Roman gem cutters have been uncovered at the site.
Sites such as Arikamedu attest to the ways in which exchange between the Roman world and the Indian Subcontinent was multifaceted and allowed for transfers in multiple directions both West-East and East-West. A relationship that began with commercial trade also allowed for a great interaction and transfusion of skills and culture from one region to another particularly in terms of pottery, gem cutting, and stone bead production, allowing what were distant communities to share various elements of craft culture and enriching both societies considerably.
This platform has been developed and maintained with the support of:
UNESCO Headquarters
7 Place de Fontenoy
75007 Paris, France
Social and Human Sciences Sector
Research, Policy and Foresight Section
Silk Roads Programme
Follow us
|
<urn:uuid:3ce12d92-5a88-4b79-b72e-95f79f257840>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.625,
"fasttext_score": 0.02409452199935913,
"language": "en",
"language_score": 0.821453869342804,
"url": "https://en.unesco.org/silkroad/content/did-you-know-port-trade-centre-arikamedu-and-roman-exchange-indian-subcontinent"
}
|
Coding Class
Quizgum : overriding
I'll find out about overriding.
It's hard to say but simple.
It means that the methods of the parent class override or add functionality to the child class.
In other words, when there is a method called hello() in the parent class, create and use the method hello() with the same name in the child class.
class GoogleCar
public function stateOfTheArtAIDrivingSystem()
return "Google AI Driving";
class Car extends GoogleCar
public $wheels;
public $doors = 4;
protected $color = 4;
private $size;
private $company;
public function stateOfTheArtAIDrivingSystem()
return "AI driving, which adds functionality to existing Google AI driving, uses IOT to connect to all vehicles, connects the car and the human brain, stops the brain while driving, and accidents can never happen without human intervention";
$ever = new Car;
echo $ever->stateOfTheArtAIDrivingSystem();
This method is called overriding.
Redefine functionality by identifying the names of the methods of the parent class.
If the method name is the same, you can see that the method of the child class is called, not the parent class.
Result of the code above
If a method is really important you may want to make sure that nobody can override it. Next we'll learn how to make it impossible to override.
|
<urn:uuid:45d57ba1-bba3-4152-adf8-b5c066fe823f>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.7743194103240967,
"language": "en",
"language_score": 0.8579450845718384,
"url": "https://www.quizgum.com/coding/eng/PHP/overriding/"
}
|
What are oxalates?
Oxalates are salts that form when oxalic acid binds with positively charged ions, particularlt calcium, and in smaller amounts, sodium, potassium, or magnesium (1, 2, 3, 4).
They are naturally occurring in both plants and humans and have antinutrient properties (3, 5).
Note: The terms oxalate and oxalic acid are often used interchangeably.
What do oxalates do?
In plants, oxalates play a role in calcium regulation, detoxification of heavy metals, and protection against herbivores (6, 7).
In humans, oxalates are a normal byproduct of metabolism (8).
Which foods contain oxalates?
Oxalate content varies widely based on the plant variety, growing conditions, time of harvest, and the methods used for measurement (9, 10).
The highest amounts are generally found in the leaves of plants, followed by the seeds and the stem (10).
The following table lists the oxalate content of common foods:
Category Food (100 g) Description Oxalate content (mg)
Vegetables Asparagus Raw 130 (11)
Beet greens Raw 300-920 (10)
Beetroot Boiled 48-675 (11, 12)
Beetroot Raw 64-450 (10, 12)
Bell pepper Raw 40 (11)
Broccoli Raw 14-190 (11, 12)
Brussels sprouts Raw 15-360 (11, 12)
Cabbage Raw 0-125 (10, 11)
Carrot Raw 44-500 (11, 12)
Cassava Raw 1260 (11)
Cauliflower Raw 150 (11)
Celery Raw 190 (11)
Chives Raw 1480 (11)
Cilantro Raw 10 (11)
Collard greens Raw 450 (11)
Corn Raw 10 (11)
Cucumber Raw 20 (11)
Eggplant Raw 55 (11)
Endive Raw 110 (11)
Garlic Raw 360 (11)
Green beans Raw 38 (11)
Kale Raw 20 (11)
Leek 89 (11)
Lettuce Raw 5-330 (10, 11)
Okra Raw 50 (11)
Onion Raw 50 (11)
Parsley Raw 140-1700 (10, 11)
Parsnip Raw 40 (11)
Potato Raw (20-141) (10, 12)
Radish Raw 480 (11)
Rhubarb Raw 532 – 800 (11, 12)
Rutabaga Raw 30 (11)
Spinach Raw 320-1260 (10, 11)
Squash Raw 20 (11)
Swiss chard Raw 964-1167 (12)
Tomato Raw 5-50 (10, 11)
Turnip greens Raw 50 (11)
Watercress Raw 310 (11)
Fruit Apple Raw 0-30 (10)
Berries Raw 15-88 (11)
Currants Raw 2-90 (10)
Grapes Raw 25 (11)
Lime & lemon peel Raw 83-110 (11)
Nuts Almonds Roasted 447-491 (13)
Cashews Roasted 231-263 (x, 13)
Hazelnuts Raw 221-223 (13)
Macadamia nuts Raw 40-43 (13)
Peanuts Roasted 131-148 (13)
Pecans Raw 62-66 (13)
Pistachio nuts Roasted 46-51 (13)
Walnuts Raw 70-77 (13)
Legumes Beans Cooked 8-85 (13)
Lentils Cooked 8 (13)
Peas Cooked 4-6 (13)
Soy flour Raw 183 (11)
Tofu Raw 275 (11)
Grains Barley flour 56 (11)
Brown rice flour 37 (11)
Buckwheat flour 269 (11)
Corn meal 54 (11)
Enriched wheat flour 40 (11)
Rye flour 51 (11)
Wheat germ 269 (11)
Whole wheat flour 67 (11)
Other Black pepper 419 (11)
Cocoa powder 500-900 (10)
Coffee 50-150 (10)
Dark chocolate 155-585 (13)
Tea 300-2000 (10)
*Higher in black tea than green or herbal tea (14)
How are oxalates processed by the body?
Oxalates can be absorbed from food or created within the human body.
1. Dietary oxalate absorption
As much as half of the oxalates found in the body come from food (15).
Absorption occurs throughout the GI tract, but mainly in the small intestine (16).
Free oxalic acid (not bound to any minerals) is soluble, making it more readily absorbed than oxalate that has become insoluble by binding to minerals (17, 18).
Factors that increase oxalate absorption include the following:
• Fat malabsorption – The presences of fatty acids in the colon increases oxalate absorption and competitively binds to calcium, increasing the amount of free oxalate available (19, 20)
Factors that decrease oxalate absorption include the following:
• High calcium intake – calcium binds to oxalic acid, decreasing its absorption (21)
• High magnesium intake – magnesium binds to oxalic acid, decreasing its absorption (22)
• Oxalate-degrading bacteria in the gut – Bacteria such as Oxalobacter formigenes can break down oxalates before they are absorbed (23)
Any unabsorbed oxalate from food is excreted in the feces (16, 23).
2. Endogenous oxalate synthesis
At least half of the oxalate in circulation is created in the liver as a byproduct of metabolism (15, 24).
It can be formed from the breakdown of other compounds, such as vitamin C or glyoxalate (derived from amino acids like glycine and hydroxyproline) (10, 24, 25, 26, 27).
Because the human body is incapable of metabolizing it, newly formed oxalate that enters circulation is simply filtered out by the kidneys and excreted in the urine (28, 29).
There is also some evidence that the small intestine and the colon have the ability to secrete oxalate, which may be expelled in the feces, but the overall significance of this finding is not clear (16).
Are there tests to measure oxalate levels in humans?
Yes, there are several different methods to test oxalate levels:
1. Urinary oxalate
The most commonly used test is a 24-hour urine collection to evaluate urinary oxalate excretion (30).
Normal levels range from 20-40 mg oxalate excreted per 24 hours. Higher levels indicate hyperoxaluria (excess oxalate) (7, 11).
2. Urinary oxalate metabolites
Glyceric acid and glycolic acid are metabolites of oxalate that can be measured in the urine and used to detect inherited metabolic disorders such as primary hyperoxaluria, in which excess oxalate is produced within the body (31, 32).
They are included (along with oxalic acid) in the organic acids test from Great Plains Laboratory.
3. Plasma oxalate
In patients with kidney disease, urinary oxalate excretion decreases and becomes less accurate as kidney function decreases, so plasma oxalate levels are often used instead (27).
Normal plasma oxalare levels range from 1-5 μmol/L, while patients with hyperoxaluria can reach levels as high as 80 μmol/L (27, 33).
Are oxalates bad for you?
There are several ways that oxalates can have negative impacts on health:
1. Can impair mineral absorption.
When oxalic acid is present in the gut alongside calcium or magnesium, they can bind to form calcium oxalate and magnesium oxalate (34, 35).
Calcium oxalate and magnesium oxalate are very poorly absorbed, reducing the bioavailability of calcium and magnesium from food and supplements (36).
Calcium and magnesium found in foods that naturally contain oxalates (like spinach) are only partially available for absorption. One study found that only 35% of the calcium in spinach was absorbed in calcium-deficient rats (34).
These decreases in mineral absorption may be even more significant when a high fiber diet is consumed, since fiber can also bind minerals and reduce absorption (37, 38, 39).
Although some websites claim that iron and zinc absorption are also inhibited by oxalates, the research does not support this (40, 41, 42, 43)
2. Promotes the formation of kidney stones.
Most kidney stones are made of calcium oxalate crystals that form when the urine contains more calcium oxalate than the fluid in the urine is able to dilute (44).
As urinary oxalate levels increase, the likelihood of kidney stone formation increases, because there is more oxalate available to bind with calcium (45).
3. Can be deposited in organs and other tissues.
Oxalate crystals have been found in a variety of tissues throughout the body, including the kidneys, heart, thyroid, bones, joints, eyes, and skin (46, 47)
Over time, the accumulation of these deposits can lead to pain and even organ dysfunction (47).
This occurs most often in patients with primary hyperoxaluria, but can also occur in people who have oxalate metabolism disorders and poor kidney function, since the body cannot effectively eliminate the high levels of oxalates (27).
4. May play a role in autism spectrum disorders (ASD)?
There is very weak evidence that oxalates may be involved in the pathogenesis of ASD.
This is based on one study, which found that plasma oxalate levels were three times higher in children with ASD compared with controls (48, 49).
However, it is unclear whether this increase is due to poor renal clearance, increased absorption, or both.
It is also unclear whether higher levels of oxalates are clinically significant in the etiology of ASD.
5. May increase pain in vulvodynia.
There is also very weak evidence that oxalates may aggravate vulvodynia (vulvar pain syndrome).
One study found that 24% of women with vulvodynia who followed a low oxalate diet and took 400 mg of calcium citrate 3x per day, for 3 months, experienced decreased pain levels (50).
However, other studies have failed to find any correlation (51, 52).
Do oxalates have any health benefits?
There are no known health benefits in humans (7).
What is a low-oxalate diet?
There is no universal definition for what constitutes a low-oxalate diet, but <100 mg/day is generally considered to be a reasonable goal (53, 54).
A stricter 50 mg/day limit is also sometimes used and can reduce urinary oxalate excretion by 25 to 30% (55, 56).
Because it’s so difficult to know exactly how much oxalate is in certain foods, a simpler recommendation is to avoid or limit high-oxalate foods (57).
What is the best way to reduce oxalates in food?
Boiling oxalate-rich vegetables reduces the oxalate content by 30-87% (as long as the cooking water is not consumed), while steaming reduces by 5-53% (12, 58).
Baking is the least effective method, eliminating 0-15% of oxalates (12, 58).
What are some strategies for reducing oxalate levels in the body?
1. Ensure adequate calcium intake.
In the intestines, calcium binds with oxalate, reducing its absorption and causing it to be excreted in the feces (59).
Strong evidence shows that both dietary calcium and calcium supplements (at least 500 mg/day) significantly reduce urinary oxalate levels (59, 60, 61, 62, 63, 64, 65, 66).
2. Stay hydrated.
While drinking water doesn’t technically reduce oxalate levels, it does dilute the urine and decrease the likelihood that calcium oxalate crystals will form kidney stones.
It is recommended to drink enough water to produce 2.5 liters of urine per day (67). Clear or pale yellow urine is a good sign of adequate hydration.
3. Avoid excess vitamin C intake.
A large body of research indicates that large doses of supplemental vitamin C (500-2000 mg/day) significantly increase urinary oxalate levels in both healthy subjects and those with a history of kidney stones, resulting in an increased risk of stone formation (68, 69, 70, 71, 72, 73).
More research is needed to fully explain why this happens, but we do know that oxalate is formed from the breakdown of the oxidized form of ascorbic acid (74).
4. Ensure adequate magnesium intake.
Research shows that supplementation with various forms of magnesium (250-300 mg/day, with food) significantly lowers oxalate absorption and urinary oxalate levels, although calcium tends to be more effective (22, 75, 76).
5. Ensure adequate vitamin b6 intake.
Some studies show that vitamin B6 (in doses ranging from 10-500 mg/day) may decrease urinary oxalate excretion by decreasing endogenous oxalate production, although other studies have found conflicting results (45, 77, 78, 79, 80, 81).
6. Avoid gelatin and collagen supplements
Very limited evidence suggests that gelatin consumption (5-10 grams per day) significantly increases urinary oxalate excretion in healthy subjects (26).
It is thought that this might occur because hydroxyproline, an amino acid found in collagen and gelatin, is a precursor to glyoxylate, which can be converted to oxalate in the liver (26).
7. Consider a fish oil supplement.
Limited evidence suggests that fish oil supplementation (900 mg EPA + 600 mg DHA/day) alters oxalate transporter activity, leading to a decrease in urinary oxalate excretion, except in patients following very low-oxalate diets (<50 mg/day) (56, 82, 83, 84)
8. Optimize gut microbiota.
Certain strains of bacteria produce enzymes that degrade oxalates in the gut, preventing them from being absorbed (85).
The most studied of these strains is Oxalobacter formigenes, which reduces urinary oxalate levels in animal studies, although the research from clinical trials is conflicting (86, 87, 88, 89, 90, 91, 92).
Scroll to Top
|
<urn:uuid:56c59934-8946-4535-b352-4e1dfabd1dd3>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.703125,
"fasttext_score": 0.18631350994110107,
"language": "en",
"language_score": 0.891976535320282,
"url": "https://www.functionalnutritionanswers.com/oxalates/"
}
|
why is the jejunum always found to be empty after death? how can it indicate about the time passed after death??
Dear student,
Please find below the solution to the asked query
The word jejunum is derived from the Latin word jejunus that means empty of food. It is usually found empty even after death because of the intensive peristaltic activity of its muscles that pushes undigested food quickly out of it into the large intestine.
The presence of food in stomach and small intestines provides evidence to the pathologists to determine the time of death. Pathologists know the time period for which ingested and undigested food remains in stomach and small intestines. Based on this, they can determine the time of death. For example, food remains in stomach for six hours and if stomach is filled at the time of autopsy, then it means that death has occurred immediately after having meals.
Hope this information will clear your doubts about the jejunum.
• 4
What are you looking for?
|
<urn:uuid:a20e19aa-60b3-4aad-a8ce-18736ef2bc95>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.59375,
"fasttext_score": 0.9915723204612732,
"language": "en",
"language_score": 0.9415397644042969,
"url": "https://aakashsrv1.meritnation.com/ask-answer/question/why-is-the-jejunum-always-found-to-be-empty-after-death-how/digestion-and-absorption/9854217"
}
|
The Servicemen's Readjustment Act of 1944, commonly known as the G.I. Bill, was a law that provided a range of benefits for some of the returning World War II veterans (commonly referred to as G.I.s). The original G.I. Bill expired in 1956, but the term "G.I. Bill" is still used to refer to programs created to assist some of the U.S. military veterans.
It was largely designed and passed through Congress in 1944 in a bipartisan effort led by the American Legion who wanted to reward practically all wartime veterans. Since the First World War the Legion had been in the forefront of lobbying Congress for generous benefits for war veterans.
The final bill provided immediate financial rewards for practically all World War II veterans, thereby avoiding the highly disputed postponed life insurance policy payout for World War I veterans that had caused political turmoil in the 1920s and 1930s. Benefits included low-cost mortgages, low-interest loans to start a business or farm, one year of unemployment compensation, and dedicated payments of tuition and living expenses to attend high school, college, or vocational school.
More Info:
|
<urn:uuid:1883593a-cc15-4025-be21-e1454510e9be>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.796875,
"fasttext_score": 0.2601277828216553,
"language": "en",
"language_score": 0.9701592326164246,
"url": "https://quizzclub.com/games/welcome/in-the-u-s-what-1944-program-funds-the-college-educations-of-those-who-served-in-the-military/answer/2631196/"
}
|
Ordinance of Nullification
From Encyclopedia Britannia
Jump to navigation Jump to search
The Ordinance of Nullification declared the Tariffs of 1828 and 1832 null and void within the state borders of South Carolina, beginning on February 1, 1833.[1] It began the Nullification Crisis. Passed by a state convention on November 24, 1832,[2] it led to President Andrew Jackson's proclamation against South Carolina, the Nullification Proclamation on December 10, 1832,[3] which threatened to send government ground troops to enforce the tariffs. In the face of the military threat, and following a Congressional revision of the law which lowered the tariff, South Carolina repealed the ordinance.
The protest that led to the Ordinance of Nullification was caused by the belief that the tariffs of 1828 and 1832 favored the North over the South and therefore violated the Constitution. This led to an emphasis on the differences between the two regions and helped set the stage for conflict during the antebellum era.
1. "Avalon Project - South Carolina Ordinance of Nullification, November 24, 1832". avalon.law.yale.edu. Retrieved 2017-03-23.
2. The Doctrines of Nullification and Succession, A Historical Study; Mouse, Howard Newcomb; http://heinonline.org/HOL/LandingPage?handle=hein.journals/sclr2&div=30&id=&page=
3. The Life of Andrew Jackson; HJ Sage; 2011; http://www.saylor.org/site/wp-content/uploads/2012/02/ENGL405-1.2.3-The-Life-of-Andrew-Jackson.pdf
External links
|
<urn:uuid:093f0e29-42c1-46b1-855c-07a88f5df9e7>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.796875,
"fasttext_score": 0.27592378854751587,
"language": "en",
"language_score": 0.8781761527061462,
"url": "https://www.encyclopediabritannia.org/wiki/Ordinance_of_Nullification"
}
|
A Digital Clock
Once having discussed timers, perhaps a clock is the most natural application of such knowledge. Two clocks are discussed in this chapter - one with a digital (or textual) display and the other emulates the old fashioned analog display (with three hands).
Popup windows
The digital clock positions itself in the upper-right corner of the screen and has a dialog frame. A snapshot of the digital clock running is shown below.
Until now, all the windows have been created with the compound style StyleStandard. The enumerator style::Standard is defined in the i++ header as:
Standard= window |
caption |
system_menu |
ThickFrame |
minimizeBox |
this style is also referred to as "WS_OVERLAPPEDWINDOW" in Win32 (as distinct from win+). Rather than use the standard style, the style for the digital clock is defined when creating the window, as shown below.
handle window_handle = create_window((const character*)nameAtom,title,
style::Popup | style::DialogFrame | style::system_menu | style::caption);
This combination of style bits creates a window of style known as "popup" - with a dialog frame, a title bar and a system menu. This style is most commonly used for dialog frames. Notice that the window cannot be resized (that is, it does not possess sizing borders). Moreover, the system menu has the sizing options disabled; however, the window may still be moved.
Positioning the window
The digital clock positions itself at the top right corner of the screen and ensures that it can accommodate the required text. The portion of the window procedure that performs the required calculations is shown below.
case message::create:
handle device_context = create_informational_device_context("DISPLAY",(const character*)null,(const character*)null,(const device_mode*)null);
windows::string DateTimeString = FormatDateTime();
dimensions Extent;
Extent = (Extent * 110) / 100;
int Width = Extent(0) + 2*get_system_metrics(system_metric::FixedFrameWidth);
int height = Extent(1) + get_system_metrics(system_metric::Captionheight)
+ 2*get_system_metrics(system_metric::FixedFrameheight);
int X = get_system_metrics(system_metric::ScreenWidth) - Width;
Width, height,place::NoZorder | place::NoRedraw);
By way of querying information, an informational device context is created via the function create_informational_device_context. An informational device context may be used for querying attributes - but is unable to be used to render drawing. A normal device context may also have been used. Note that code within the message message::create is executed prior to the window being made visible. The text extent of the present time is calculated and expanded by 10%. The width and height of the frames as well of the height of the caption is then factored into the size calculation and the size of the window is set.
International date and Time Functions
The rest of the digital clock code is quite straight forward. When a timer message is received, the screen is invalidated and the paint routine does the rest. The paint routine merely formats the text to be centered in the client rectangle (horizontally and vertically). It calls the function FormatDateTime() to acquire the appropriate text to draw. The function FormatDateTime() is shown below.
string FormatDateTime()
character date[30];
character Time[30];
get_date_format(locale_user_default,0,null,"dddd MMMM d ",date,sizeof(date));
return string(date) + string(Time);
windows has builtin functions to perform formatting of dates and times. An application should use these functions to deal with dates and times so as to remain internationally compliant. after querying the requisite quantities, strings are concatenated and returned to the drawing routine.
|
<urn:uuid:c22627e3-022f-4d1a-b378-480e62fcd1c5>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.984375,
"fasttext_score": 0.03550976514816284,
"language": "en",
"language_score": 0.792705237865448,
"url": "http://uuindouus.net/English/Native/a63.html"
}
|
Synonyms/Hypernyms (Ordered by Estimated Frequency) of noun opposition
8 senses of opposition
Sense 1
resistance, opposition -- (the action of opposing something that you disapprove or disagree with; "he encountered a general feeling of resistance from many citizens"; "despite opposition from the newspapers he went ahead")
=> action -- (something done (usually as opposed to something said); "there were stories of murders and other unnatural actions")
Sense 2
opposition, oppositeness -- (the relation between opposed entities)
=> relation -- (an abstraction belonging to or characteristic of two entities or parts together)
Sense 3
confrontation, opposition -- (the act of hostile groups opposing each other; "the government was not ready for a confrontation with the unions"; "the invaders encountered stiff opposition")
=> resistance -- (group action in opposition to those in power)
Sense 4
opposition, opponent, opposite -- (a contestant that you are matched against)
=> contestant -- (a person who participates in competitions)
Sense 5
opposition -- (a body of people united in opposing something)
=> body -- (a group of persons associated by some common tie or occupation and regarded as an entity; "the whole body filed out of the auditorium"; "the student body"; "administrative body")
Sense 6
opposition -- (a direction opposite to another)
=> direction -- (the spatial relation between something and the course along which it points or moves; "he checked the direction and velocity of the wind")
Sense 7
=> adversary, antagonist, opponent, opposer, resister -- (someone who offers opposition)
Sense 8
Opposition -- (the major political party opposed to the party in office and prepared to replace it if elected; "Her Majesty's loyal opposition")
=> party, political party -- (an organization to gain political power; "in 1992 Perot tried to organize a third party at the national level")
2022, Cloud WordNet Browser
|
<urn:uuid:14b7f3c2-2570-406d-865b-51cb0fa42905>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.20433777570724487,
"language": "en",
"language_score": 0.9271225929260254,
"url": "https://cloudapps.herokuapp.com/wordnet/?q=opposition"
}
|
It’s National Atomic Veterans Day
Today marks the anniversary of the U.S.’s first detonation of a nuclear weapon conducted by the U.S. Army in the Jornada del Muerto desert in New Mexico. While that in itself is significant, July 16th has also become a day to honor the nation’s atomic Veterans. So, what is an atomic Veteran?
According to the Department of Veterans Affairs, an atomic Veteran is defined as a Veteran who, as part of his/her military service:
• Participated in an above-ground nuclear test between 1945 and 1962;
• Was part of the U.S. military’s occupation forces in/around Hiroshima/Nagasaki before 1946; or
• Was held as a prisoner of war (POW) in/near Hiroshima/Nagasaki (certain cases).
The path for these Veterans has not been easy as many developed serious health conditions due to exposure to radiation. Because of the classified nature of nuclear operations, they also couldn’t seek medical care or disability compensation from the VA. It wasn’t until 1966 when Congress repealed the Nuclear Radiation and Secrecy Agreements Act that atomic Veterans could discuss their experiences and begin to apply for VA benefits. In 1979, the National Association of Atomic Veterans (NAAV) was formed to provide assistance to atomic Veterans.
In 1983, President Reagan declared July 16th as National Atomic Veterans Day as, “a day dedicated to those patriotic Americans who through their participation in these tests helped lead the United States to the forefront of technology in defense of our great Nation and the freedoms we as Americans hold so dear.” Reagan’s declaration, however, was just for July 16, 1983, not for each succeeding year. Additional action was not taken until 2015 when the state of Virginia adopted National Atomic Veterans Day for each year thereafter.
National Atomic Veterans Day was not officially declared for successive years until 2021 when President Biden signed legislation introduced by VA Congresswoman Abigail Spanberger recognizing atomic Veterans as part of the National Defense Authorization Act (NDAA) for Fiscal Year (FY) 2022. The White House proclamation for 2021 is quoted below:
Atomic Veterans served our Nation with distinction, but their service came at a great cost. Many developed health conditions due to radiation exposure, yet because they were not able to discuss the nature of their service, they were unable to seek medical care or disability compensation from the Department of Veterans Affairs for their illnesses. Decades later in 1996, the United States Congress repealed the Nuclear Radiation and Secrecy Agreements Act, allowing Atomic Veterans to tell their stories and file for benefits. By then, thousands of Atomic Veterans had died without their families knowing the true extent of their service.
Our Nation has one truly sacred obligation: to properly prepare and equip our troops when we send them into harm’s way, and to care for them and their families when they return from service. As Commander in Chief, I am committed to fulfilling our obligation to the Atomic Veterans and their families, and ensuring that all of our Nation’s veterans have timely access to needed services, medical care, and benefits.
On this National Atomic Veterans Day, our country remembers the service and sacrifices of Atomic Veterans. Their heroism and patriotism will never be forgotten and we always honor their bravery and devotion to duty.
A Proclamation on National Atomic Veterans Day, 2021, Issued July 15, 2021
There are approximately 195,000 atomic Veterans in the United States.
How to Observe National Atomic Veterans Day
1. Show thanks
To show thanks to atomic Veterans for their sacrifice, you can spend some time writing letters or creating cards. By doing so, at least they will know that they are appreciated.
2. Contact NAAV
The National Association of Atomic Veterans (NAAV) is a non-profit organization. You can contact them for information, and you may want to make a donation or volunteer.
3. Reach out to Veterans
If you know Veterans, it’s the best time to reach out to them. Remember to thank them for their service to the country. You may want to hear about their experiences during the nuclear tests and the atomic bombings. You can also personally offer some help in case they need it
|
<urn:uuid:1ea17b01-c0c1-4a87-a730-960da640268c>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.671875,
"fasttext_score": 0.01909571886062622,
"language": "en",
"language_score": 0.9505480527877808,
"url": "https://sacrainbowsitrep.com/2022/07/16/atomic-vets-day/"
}
|
Unequal sex ratio
Ne with unequal sex ratios in a breeding population
In many species, a very small number of individuals of one sex or the other do most or almost all of the breeding. Recall that under these conditions, Ne = (4)(Nm)(Nf) / (Nm + Nf). As the sex ratio increase, the effective population number (Ne) falls rapidly as a fraction of the population census count (Nc). In the extreme case, where a single individual of either sex is the only breeding individual, Ne = 4, no matter how large the census count. A notable example is Elephant Seals (Mirounga angustirostris), where a single alpha male has sole reproductive access to a so-called 'harem' comprising 90% of more of the breeding females. The reciprocal example is the hive of eusocial insects, where a single female "queen" has access to several hundred "drones" and is the parent of 10s of 1,000s of workers, all of whom are half-sisters.
HOMEWORK: In the table above, the total population size
Nc drops as the number of males Nm decreases. Repeat the calculation, and adjust Nf so that total Nc = 2,000. Compare the numbers and graphs for the two calculations.
Figure & Text material © 2021 by Steven M. Carr
|
<urn:uuid:6cbf6499-f1c8-4aa3-bfbf-6461b4aea37e>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.9351458549499512,
"language": "en",
"language_score": 0.8975551724433899,
"url": "https://www.mun.ca/biology/scarr/Unequal_sex_ratio.html"
}
|
What are the four main elements of flamenco?
What are the four main elements of flamenco?
Flamenco is an art form comprising of songs, dances, and instrumental music associated with southern Spain….Flamenco includes six primary elements:
• Cante. Singing.
• Toque. Guitar playing.
• Baile. Dance.
• Jaleo. Singing and choruses.
• Palmas. Hand clapping.
• Pitos. Finger snapping.
What are the 3 elements of flamenco?
Flamenco comes from the nomadic gypsies in Andalucía, a region in the south of Spain. It is made up of 3 primary elements. Three things the continually-moving people could always carry with themselves while they traveled – the cante, the baile & the compás. Cante is the singing that accompanies the baile, the dance.
How many components are there in flamenco?
Flamenco is a difficult form of art which transmits passion in each of its three components: song, dance and music.
What does flamenco music consist of?
Flamenco, which UNESCO recently recognized as part of the World’s Intangible Cultural Heritage, is a complex art form incorporating poetry, singing (cante), guitar playing (toque), dance (baile), polyrhythmic hand-clapping (palmas), and finger snapping (pitos).
What is the most important element of flamenco?
What are the main instruments in flamenco?
Typical instruments Vocals clapping guitar castanets cajón flamenco
Derivative forms Flamenco rock nuevo flamenco
Alegrias bulerias fandango malagueñas rumba flamenca sevillanas siguiriyas soleá tango tientos verdiales
What is another element of flamenco?
Today, the elements of flamenco include: singing (cante), guitar playing (toque), dance (baile), and handclaps (palmas). The center of the flamenco group is the vocals. The dancer through her movements interprets the emotions of the singer.
What makes a flamenco guitar different?
Flamenco. Classical guitars generally have either a cedar or spruce top, with practically any type of back/side combination. On the other hand, flamenco guitars emphasize a much easier and faster playability, which is made possible by lowered action with almost no neck relief.
Why was flamenco created?
flamenco, form of song, dance, and instrumental (mostly guitar) music commonly associated with the Andalusian Roma (Gypsies) of southern Spain. In Spain they encountered the rich cultures of the Sephardic Jews and the Moors. Their centuries-long cultural intermingling produced the unique art form known as flamenco.
What makes flamenco special?
How was flamenco created?
What percussion instruments are used in flamenco?
Castanets in Spain Castanets are often played by singers or dancers. Castanets are commonly used in the flamenco dance. In fact, Spanish folk dance “Sevillanas” is the style typically performed using castanet.
Do all five elements of flamenco have to be present?
Additionally, not all five elements have to be present in flamenco. Sometimes you’ll see only cante and guitarra, or baile and palmas, just guitar, etc. There are all kinds of possibilities.
What instruments are used in flamenco music?
You already know about the two main settings for flamenco. There can be additional elements present. The most common is cajón , but other instruments like flute, bass, or violin may be included as well. Additionally, not all five elements have to be present in flamenco.
What is flamenco dance and where does it come from?
Flamenco dance and the guitar music that accompanies it comes from southern Spain in the Andalusian region associated with the Roma or gypsy people. In Spain, the Roma are called Gitanos.
What do I need to start flamenco dancing?
Probably the most important thing you will need to start flamenco dancing is patience. The art of flamenco dance is often difficult to master. Besides learning intricate steps and movements, you will also need to learn how to nonverbally communicate with a musician or a singer.
|
<urn:uuid:0c7c6fa4-cdd2-4132-b79a-1f8b21a9bce5>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.9790672063827515,
"language": "en",
"language_score": 0.9299052953720093,
"url": "https://heimduo.org/what-are-the-four-main-elements-of-flamenco/"
}
|
What Would Have Been Orestes Proper Course of Action, had He Been Alive Today?
Orestes, the son of Agamemnon, is the main character of the ancient Greek play, Libation Bearers, which was written by a man named Aeschylus. This play was the sequel to the play Agamemnon. This play recounts the events after the tragic end of Agamemnon in the previous play. To recap Agamemnon had sacrificed his own daughter to be able to sail to Troy, this in turn led his wife to murder him after he returned home from Troy. Orestes at the time was exiled, but does return home to visit his father’s grave; there he reunites with his sister Electra. This leads to a course of events which leaves the question: what would have been Orestes proper course of action, had he been alive today in the modern world?
After this reunion Orestes and Electra both relate greatly over their resentment towards their mother, and her lover. They both decide to avenge their father’s death, by murdering their mother, and her lover who also happened to be their grandfather on their father’s side. Also to note Orestes did not really have a choice when it came to this plot since the Oracle of Delphi told him that if he did not do this he himself would face judgment for his father’s death. To do so Orestes disguises as someone else and Electra behaves as though nothing has happened. This ends up being a success and Orestes kills his mother and grandfather.
Nowadays this situation would be completely different. For example in ancient Greece there was no law enforcement like it is today. If Orestes was around today he would have probably gone to the authorities to report his mother and his grandfather, for his father’s murder, if he found the proper evidence. Instead of going ahead and murdering them Orestes most likely will look for evidence against his mother and grandfather. But if he did choose to kill his mother and grandfather which would be a pretty unlikely situation today, that would be much harder than it would have been in ancient Greece, since there would be the law enforcement to worry about and covering up the murder, so not to be caught. Overall I believe a modern Orestes would most likely report his mother instead of murdering her, since that is the more logical and appropriate action to take.
Ancient Greek plays are a unique area of literature with rather insane, absurd story lines, and mythological tales; the play Libation Bearers, is no exception. The main character of Libation Bearers, Orestes, if he was a man of today would have behaved much differently in handling the situation of his father’s murder. Thus, this would have most likely been Orestes proper course of action had he been alive today.
1. gershomid says:
Normal family quarrels in Ancient Greece
Liked by 1 person
Leave a Comment
WordPress.com Logo
Twitter picture
Facebook photo
Connecting to %s
|
<urn:uuid:554940c4-3d81-418c-9c81-3b07226ad0ed>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.3392027020454407,
"language": "en",
"language_score": 0.9857425689697266,
"url": "https://theworkofadreamer.com/2021/12/08/what-would-have-been-orestes-proper-course-of-action-had-he-been-alive-today/"
}
|
Taking a Look at the Golden Ratio
Decent Essays
Golden Ratio is found by dividing a line into two parts so that the longer part divided by the smaller part equals the whole length divided by the longer part. Golden ratio is very similar to pi because it is an infinite number and it goes on forever. It is usually rounded to around 1.618. The formula for golden ratio is a/b = (a+b)/b. It has been around for a long time so it is not known who made up the golden ratio. Since the golden ratio is used all around the world it is known in many names such as the golden mean, phi, the divine proportion, extreme and mean proportion, etc. Golden ratio was used in arts from the beginning of people and still is used today. It has been used in architecture, math, sculptures and nature. Euclid talks about it in his book elements. Golden ratio is also used in Fibonacci numbers and Lucas numbers. Golden ratio also comes in the form of a rectangle. Golden has been found in many places over and over, so it’s not clear where the golden ratio originated or who found the golden ratio but some say that the Pythagoreans were the first to bring up the idea of the golden ratio. Due to the discovery in many places, it gets many names. Euclid wrote about the golden ratio in his book, The Elements. The Element is a book about geometry. In Euclid’s book, he describes the golden ratio as the extreme and mean ratio. He says the line is divided into mean and ratio by point c. It also explains what a golden ratio is even though he did not call it golden
Get Access
|
<urn:uuid:5b13f013-4936-4097-a2ef-5e8c3ddeb712>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.5056827068328857,
"language": "en",
"language_score": 0.9791537523269653,
"url": "https://www.bartleby.com/essay/Taking-a-Look-at-the-Golden-Ratio-P3WP7LEJDM6A"
}
|
What is Hikikomori?
Hikikomori (Japanese: ひきこもり or 引き籠もり, lit. “pulling inward, being confined”), also known as “acute social withdrawal” , is total withdrawal from society and seeking extreme degrees of social isolation and confinement. Hikikomori refers to both the phenomenon in general and the recluses themselves. Hikikomori have been described as loners or “modern-day hermits”. Estimates suggest that half a million Japanese youths have become social recluses, as well as more than half a million middle-aged individuals.
The Japanese Ministry of Health, Labour, and Welfare defines hikikomori as a condition in which the affected individuals refuse to leave their parents’ house, do not work or go to school and isolate themselves away from society and family in a single room for a period exceeding six months. The psychiatrist Tamaki Saitō defines hikikomori as “a state that has become a problem by the late twenties, that involves cooping oneself up in one’s own home and not participating in society for six months or longer, but that does not seem to have another psychological problem as its principal source”.
More recently, researchers have developed more specific criteria to more accurately identify hikikomori. During a diagnostic interview, trained clinicians evaluate for:
• Spending most of the day and nearly every day confined to home;
• Marked and persistent avoidance of social situations, and social relationships;
• Social withdrawal symptoms causing significant functional impairment;
• Duration of at least six months; and
• No apparent physical or mental aetiology to account for the social withdrawal symptoms.
The psychiatrist Alan Teo first characterised hikikomori in Japan as modern-day hermits, while the literary and communication scholar Flavio Rizzo similarly described hikikomori as “post-modern hermits” whose solitude stems from ancestral desires for withdrawal.
While the degree of the phenomenon varies on an individual basis, in the most extreme cases, some people remain in isolation for years or even decades. Often hikikomori start out as school refusers, or futōkō (不登校) in Japanese (an older term is tōkōkyohi (登校拒否)).
Common Traits
While many people feel the pressures of the outside world, hikikomori react by complete social withdrawal. In some more extreme cases, they isolate themselves in their bedrooms for months or years at a time. They usually have few or no friends. In interviews with current or recovering hikikomori, media reports and documentaries have captured the strong levels of psychological distress and angst felt by these individuals.
While hikikomori favour indoor activities, some venture outdoors occasionally. The withdrawal from society usually starts gradually. Affected people may appear unhappy, lose their friends, become insecure and shy, and talk less.
According to Japanese government figures released in 2010, there are 700,000 individuals living as hikikomori within Japan, with an average age of 31. Still, the numbers vary widely among experts. These include the hikikomori who are now in their 40s (as of 2011) and have spent 20 years in isolation. This group is generally referred to as the “first-generation hikikomori.” There is concern about their reintegration into society in what is known as “the 2030 Problem,” when they are in their 60s and their parents begin to die. Additionally, the government estimates that 1.55 million people are on the verge of becoming hikikomori. Tamaki Saitō, who first coined the phrase, originally estimated that there may be over one million hikikomori in Japan, although this was not based on national survey data. Nonetheless, considering that hikikomori adolescents are hidden away and their parents are often reluctant to talk about the problem, it is extremely difficult to gauge the number accurately.
A 2015 Cabinet Office survey estimated that 541,000 recluses aged 15 to 39 existed. In 2019, another survey showed that there are roughly 613,000 people aged 40 to 64 that fall into the category of “adult hikikomori”, which Japan’s welfare minister Takumi Nemoto referred to as a “new social issue.”
While hikikomori is mostly a Japanese phenomenon, cases have been found in the United States, United Kingdom, Oman, Spain, Italy, India, Sweden, South Korea, and France.
Hypotheses on the Cause(s)
Developmental and Psychiatric Conditions
Hikikomori is similar to the social withdrawal exhibited by some people with autism spectrum disorders, a group of developmental disorders that include Asperger syndrome, PDD-NOS and “classic” autism. This has led some psychiatrists to suggest that hikikomori may be affected by autism spectrum disorders and other disorders that affect social integration, but that their disorders are altered from their typical Western presentation because of Japanese sociocultural pressures. Suwa & Hara (2007) discovered that 5 of 27 cases of hikikomori had a high-functioning pervasive developmental disorder (HPDD), and 12 more had other disorders or mental diseases (6 cases of personality disorders, 3 cases of obsessive-compulsive disorder, 2 cases of depression, 1 case of slight mental retardation); 10 out of 27 had primary hikikomori. The researchers used a vignette to illustrate the difference between primary hikikomori (without any obvious mental disorder) and hikikomori with HPDD or other disorder. Alan Teo and colleagues conducted detailed diagnostic evaluations of 22 individuals with hikikomori and found that while the majority of cases fulfilled criteria for multiple psychiatric conditions, about 1 in 5 cases were primary hikikomori. Till date, however, hikikomori is not included in the DSM-5, due to insufficient data.
According to Michael Zielenziger’s book, Shutting Out the Sun: How Japan Created Its Own Lost Generation, the syndrome is more closely related to posttraumatic stress disorder. The author claimed that the hikikomori interviewed for the book had discovered independent thinking and a sense of self that the current Japanese environment could not accommodate.
The syndrome also closely parallels the terms avoidant personality disorder, schizoid personality disorder, schizotypal personality disorder, agoraphobia or social anxiety disorder (also known as “social phobia”).
Social and Cultural Influence
Sometimes referred to as a social problem in Japanese discourse, hikikomori has a number of possible contributing factors. Alan Teo has summarised a number of potential cultural features that may contribute to its predominance in Japan. These include tendencies toward conformity and collectivism, overprotective parenting, and particularities of the educational, housing and economic systems.
Acute social withdrawal in Japan appears to affect both genders equally. However, because of differing social expectations for maturing boys and girls, the most widely reported cases of hikikomori are from middle- and upper-middle-class families; sons, typically their eldest, refuse to leave the home, often after experiencing one or more traumatic episodes of social or academic failure.
In The Anatomy of Dependence, Takeo Doi identifies the symptoms of hikikomori, and explains its prevalence as originating in the Japanese psychological construct of amae (in Freudian terms, “passive object love”, typically of the kind between mother and infant). Other Japanese commentators such as academic Shinji Miyadai and novelist Ryū Murakami, have also offered analysis of the hikikomori phenomenon, and find distinct causal relationships with the modern Japanese social conditions of anomie, amae and atrophying paternal influence in nuclear family child pedagogy. Young adults may feel overwhelmed by modern Japanese society, or be unable to fulfil their expected social roles as they have not yet formulated a sense of personal honne and tatemae – one’s “true self” and one’s “public façade” – necessary to cope with the paradoxes of adulthood.
The dominant nexus of hikikomori centres on the transformation from youth to the responsibilities and expectations of adult life. Indications are that advanced industrialised societies such as modern Japan fail to provide sufficient meaningful transformation rituals for promoting certain susceptible types of youth into mature roles. As do many societies, Japan exerts a great deal of pressure on adolescents to be successful and perpetuate the existing social status quo. A traditionally strong emphasis on complex social conduct, rigid hierarchies and the resulting, potentially intimidating multitude of social expectations, responsibilities and duties in Japanese society contribute to this pressure on young adults. Historically, Confucian teachings de-emphasizing the individual and favouring a conformist stance to ensure social harmony in a rigidly hierarchized society have shaped much of East Asia, possibly explaining the emergence of the hikikomori phenomenon in other East Asian countries.
In general, the prevalence of hikikomori tendencies in Japan may be encouraged and facilitated by three primary factors:
• Middle class affluence in a post-industrial society such as Japan allows parents to support and feed an adult child in the home indefinitely.
• Lower-income families do not have hikikomori children because a socially withdrawing youth is forced to work outside the home.
• The inability of Japanese parents to recognise and act upon the youth’s slide into isolation; soft parenting; or co-dependence between mother and son, known as amae in Japanese.
• A decade of flat economic indicators and a shaky job market in Japan makes the pre-existing system requiring years of competitive schooling for elite jobs appear like a pointless effort to many.
Role of Modern Technology
Although the connection between modern communication technologies, such as the Internet, social media and video games, and the phenomenon is not conclusively established, it is considered at least an exacerbating factor that can deepen and nurture withdrawal. Previous studies of hikikomori in South Korea and Spain found that some of them showed signs of Internet addiction, though researchers do not consider this to be the main issue. However, according to associate professor of psychiatry at Kyushu University in Fukuoka, Takahiro Kato, video games and social media have reduced the amount of time that people spent outside and in social environments that require direct face to face interaction. The emergence of mobile phones and then smartphones may also have deepened the issue, given that people can continue their addiction to gaming and online surfing anywhere, even in bed.
Japanese Education System
The Japanese education system, like those found in China, Singapore, India, and South Korea, puts great demands upon youth. A multitude of expectations, high emphasis on competition, and the rote memorization of facts and figures for the purpose of passing entrance exams into the next tier of education in what could be termed a rigid pass-or-fail ideology, induce a high level of stress. Echoing the traditional Confucian values of society, the educational system is viewed as playing an important part in society’s overall productivity and success.
In this social frame, students often face significant pressure from parents and the society in general to conform to its dictates and doctrines. These doctrines, while part of modern Japanese society, are increasingly being rejected by Japanese youth in varying ways such as hikikomori, freeter, NEET (Not currently engaged in Employment, Education, or Training), and parasite singles. The term “Hodo-Hodo zoku” (the “So-So tribe”) applies to younger workers who refuse promotion to minimise stress and maximise free time.
Beginning in the 1960s, the pressure on Japanese youth to succeed began successively earlier in their lives, sometimes starting before pre-school, where even toddlers had to compete through an entrance exam for the privilege of attending one of the best pre-schools. This was said to prepare children for the entrance exam of the best kindergarten, which in turn prepared the child for the entrance exam of the best elementary school, junior high school, high school, and eventually for their university entrance exam. Many adolescents take one year off after high school to study exclusively for the university entrance exam, and are known as ronin. More prestigious universities have more difficult exams. The most prestigious university with the most difficult exam is the University of Tokyo.
Since 1996, the Japanese Ministry of Education has taken steps to address this ‘pressure-cooker’ educational environment and instil greater creative thought in Japanese youth by significantly relaxing the school schedule from six-day weeks to five-day weeks and dropping two subjects from the daily schedule, with new academic curricula more comparable to Western educational models. However, Japanese parents are sending their children to private cram schools, known as juku, to ‘make up’ for lost time.
After graduating from high school or university, Japanese youth also have to face a very difficult job market in Japan, often finding only part-time employment and ending up as freeters with little income, unable to start a family.
Another source of pressure is from their co-students, who may harass and bully (ijime) some students for a variety of reasons, including physical appearance, wealth, or educational or athletic performance. Some have been punished for bullying or truancy, bringing shame to their families. Refusal to participate in society makes hikikomori an extreme subset of a much larger group of younger Japanese that includes freeters.
Japanese Financial Burden
Some organizations such as the non-profit Japanese organisation NPO lila have been trying to combat the financial burden the hikikomori phenomenon has had on Japan’s economy. The Japanese CD and DVD producer Avex Group produces DVD videos of live-action women staring into a camera to help hikikomori learn to cope with eye contact and long spans of human interaction. The goal is to help hikikomori reintegrate into society by personal choice, thereby realising an economic contribution and reducing the financial burden on parents.
“80-50 Problem”
Described in Japanese literature and media, first from the late 2010s, hikikomori of youth from earlier days, as have their parents upon whom they rely. The “80-50 problem” refers to the hikikomori children being in their 50s (or thereabouts), with their only means of support being their ageing parents who are in their 80s (or thereabouts).
A Japanese government Cabinet Office survey counted roughly 540,000 hikikomori people in 2015. However, this survey covers a restricted age group of 15 to 39 years of age. Hikikomori people in their 40s and 50s are consequently not surveyed or otherwise studied.
In 2019, Japanese psychiatrist Dr. Saitō Tamaki held a press briefing at the Foreign Press Centre Japan on the subject of hikikomori. Among addressing ageing, he recommended practical advice to that parents with hikikomori, such as drawing up a lifetime financial plan for hikikomori children, so they can get by after the parents are gone. He also recommended that parents should not fear embarrassment or be concerned about appearances as they look at the options, including disability pensions or other forms of public assistance for their children. Given the Japanese government – failing to see the urgency of the problem – is demonstrating no motion toward developing substantive policies or systems related to the ageing of hikikomori, Dr Tamaki has emphasised the urgency and necessity for families to plan ahead.
Treatment Programmes
When it comes to psychosocial support, it is hard for therapists to attain direct access to hikikomori; research to find different and effective treatment plans to aid hikikomori has been ongoing. One such treatment plan is focused on the families of hikikomori. Such focus primarily includes, educational intervention programmes (e.g. lectures, role-play, etc.) that are geared towards reducing any averse stigma that family members have towards psychiatric disorders like hikikomori. These educational programmes are derived from other established family support programmes, specifically Mental Health First Aid (MFHA) and Community Reinforcement and Family Training (CRAFT). CRAFT specifically trains family members express positive and functional communication, whereas MFHA provides skills to support hikikomori with depression/suicidal like behaviour. Studies so far that have modified the family unit’s behavioural response to a hikikomori has yielded positive results, indicating that family behaviour is essential for recovery, however further research is still needed.
Although there has been a primary emphasis on educating family members, there are still therapy programmes for the hikikomori to participate themselves in. For example, the use of exercise therapy. The individual psychotherapy methods that are being stressed in current research are primarily motivated on cultivating self-confidence within the hikikomori. With that being said, however, studies have delineated that efficacious treatment towards hikikomori requires a multifaceted approach rather than the utilisation of one individual approach, such as individual psychotherapy or family therapy.
Pandemic Impact
Based on prior outbreaks (e.g. SARS, MERS, etc.), studies have shown that quarantined individuals, due to increased loneliness, have heightened stress-related mental disturbances. Considering that political, social, and/or economical challenges already bring people to express hikikomori like behaviour, researchers theorise that since all the aforementioned factors are by-products of a pandemic, many postulate a hikikomori phenomenon common in a post-pandemic world. In fact, people who do experience mental disturbances in Japan generally view seeking the help of a psychiatrist as shameful or a reason for them to be socially shunned. Experts predict an increase in focus on both the youth and also on mental health specifically through effective telemedicine to either the affected individual and/or their respective family unit.
Furthermore, with hikikomori becoming more prevalent amid a pandemic, experts theorise that it will bring out more empathy and constructive attention towards the issue.
What is Agoraphobia?
Agoraphobia is an anxiety disorder characterised by symptoms of anxiety in situations where the person perceives their environment to be unsafe with no easy way to escape. These situations can include open spaces, public transit, shopping centres, or simply being outside their home. Being in these situations may result in a panic attack. The symptoms occur nearly every time the situation is encountered and last for more than six months. Those affected will go to great lengths to avoid these situations. In severe cases people may become completely unable to leave their homes.
Agoraphobia is believed to be due to a combination of genetic and environmental factors. The condition often runs in families, and stressful or traumatic events such as the death of a parent or being attacked may be a trigger. In the DSM-5 agoraphobia is classified as a phobia along with specific phobias and social phobia. Other conditions that can produce similar symptoms include separation anxiety, post-traumatic stress disorder, and major depressive disorder. Those affected are at higher risk of depression and substance use disorder.
Without treatment it is uncommon for agoraphobia to resolve. Treatment is typically with a type of counselling called cognitive behavioural therapy (CBT). CBT results in resolution for about half of people. Agoraphobia affects about 1.7% of adults. Women are affected about twice as often as men. The condition often begins in early adulthood and becomes less common in old age. It is rare in children. The term “agoraphobia” is from Greek ἀγορά, agorā́, meaning a “place of assembly” or “market-place” and -φοβία, -phobía, meaning “fear.”
Refer to Hikikomori.
Signs and Symptoms
Agoraphobia is a condition where sufferers become anxious in unfamiliar environments or where they perceive that they have little control. Triggers for this anxiety may include wide-open spaces, crowds (social anxiety), or travelling (even short distances). Agoraphobia is often, but not always, compounded by a fear of social embarrassment, as the agoraphobic fears the onset of a panic attack and appearing distraught in public. Most of the time they avoid these areas and stay in the comfort of their safe haven, usually their home.
Agoraphobia is also defined as “a fear, sometimes terrifying, by those who have experienced one or more panic attacks”. In these cases, the sufferer is fearful of a particular place because they have experienced a panic attack at the same location at a previous time. Fearing the onset of another panic attack, the sufferer is fearful or even avoids a location. Some refuse to leave their homes even in medical emergencies because the fear of being outside of their comfort areas is too great.
The sufferers can sometimes go to great lengths to avoid the locations where they have experienced the onset of a panic attack. Agoraphobia, as described in this manner, is actually a symptom professionals check when making a diagnosis of panic disorder. Other syndromes like obsessive compulsive disorder (OCD) or post-traumatic stress disorder (PTSD) can also cause agoraphobia. Essentially, any irrational fear that keeps one from going outside can cause the syndrome.
Agoraphobics may suffer from temporary separation anxiety disorder when certain other individuals of the household depart from the residence temporarily, such as a parent or spouse, or when the agoraphobic is left home alone. Such temporary conditions can result in an increase in anxiety or a panic attack or feeling the need to separate themselves from family or maybe friends.
People with agoraphobia sometimes fear waiting outside for long periods of time; that symptom can be called “macrophobia.”
Panic Attacks
Agoraphobia patients can experience sudden panic attacks when traveling to places where they fear they are out of control, help would be difficult to obtain, or they could be embarrassed. During a panic attack, epinephrine is released in large amounts, triggering the body’s natural fight-or-flight response. A panic attack typically has an abrupt onset, building to maximum intensity within 10 to 15 minutes, and rarely lasts longer than 30 minutes. Symptoms of a panic attack include palpitations, rapid heartbeat, sweating, trembling, nausea, vomiting, dizziness, tightness in the throat, and shortness of breath. Many patients report a fear of dying, fear of losing control of emotions or fear of losing control of behaviours.
Research has uncovered a link between agoraphobia and difficulties with spatial orientation. Individuals without agoraphobia are able to maintain balance by combining information from their vestibular system, their visual system, and their proprioceptive sense. A disproportionate number of agoraphobics have weak vestibular function and consequently rely more on visual or tactile signals. They may become disoriented when visual cues are sparse (as in wide-open spaces) or overwhelming (as in crowds). Likewise, they may be confused by sloping or irregular surfaces. In a virtual reality study, agoraphobics showed impaired processing of changing audiovisual data in comparison with subjects without agoraphobia.
Substance Induced
Chronic use of tranquilisers and sleeping pills such as benzodiazepines has been linked to onset of agoraphobia. In 10 patients who had developed agoraphobia during benzodiazepine dependence, symptoms abated within the first year of assisted withdrawal. Similarly, alcohol use disorders are associated with panic with or without agoraphobia; this association may be due to the long-term effects of alcohol consumption causing a distortion in brain chemistry. Tobacco smoking has also been associated with the development and emergence of agoraphobia, often with panic disorder; it is uncertain how tobacco smoking results in anxiety-panic with or without agoraphobia symptoms, but the direct effects of nicotine dependence or the effects of tobacco smoke on breathing have been suggested as possible causes. Self-medication or a combination of factors may also explain the association between tobacco smoking and agoraphobia and panic.
Attachment Theory
Some scholars have explained agoraphobia as an attachment deficit, i.e. the temporary loss of the ability to tolerate spatial separations from a secure base. Recent empirical research has also linked attachment and spatial theories of agoraphobia.
Spatial Theory
In the social sciences, a perceived clinical bias exists in agoraphobia research. Branches of the social sciences, especially geography, have increasingly become interested in what may be thought of as a spatial phenomenon. One such approach links the development of agoraphobia with modernity. Factors considered contributing to agoraphobia within modernity are the ubiquity of cars and urbanization. These have helped develop the expansion of public space, on one hand, and the contraction of private space on the other, thus creating in the minds of agoraphobia-prone people a tense, unbridgeable gulf between the two.
Evolutionary Psychology
An evolutionary psychology view is that the more unusual primary agoraphobia without panic attacks may be due to a different mechanism from agoraphobia with panic attacks. Primary agoraphobia without panic attacks may be a specific phobia explained by it once having been evolutionarily advantageous to avoid exposed, large, open spaces without cover or concealment. Agoraphobia with panic attacks may be an avoidance response secondary to the panic attacks, due to fear of the situations in which the panic attacks occurred.
Most people who present to mental health specialists develop agoraphobia after the onset of panic disorder. Agoraphobia is best understood as an adverse behavioural outcome of repeated panic attacks and subsequent anxiety and preoccupation with these attacks that leads to an avoidance of situations where a panic attack could occur. Early treatment of panic disorder can often prevent agoraphobia. Agoraphobia is typically determined when symptoms are worse than panic disorder, but also do not meet the criteria for other anxiety disorders such as depression. In rare cases where agoraphobics do not meet the criteria used to diagnose panic disorder, the formal diagnosis of agoraphobia without history of panic disorder is used (primary agoraphobia).
Systematic desensitisation can provide lasting relief to the majority of patients with panic disorder and agoraphobia. The disappearance of residual and sub-clinical agoraphobic avoidance, and not simply of panic attacks, should be the aim of exposure therapy. Many patients can deal with exposure easier if they are in the company of a friend on whom they can rely. Patients must remain in the situation until anxiety has abated because if they leave the situation, the phobic response will not decrease and it may even rise.
A related exposure treatment is in vivo exposure, a CBT method, that gradually exposes patients to the feared situations or objects. This treatment was largely effective with an effect size from d = 0.78 to d = 1.34, and these effects were shown to increase over time, proving that the treatment had long-term efficacy (up to 12 months after treatment).
Psychological interventions in combination with pharmaceutical treatments were overall more effective than treatments simply involving either CBT or pharmaceuticals. Further research showed there was no significant effect between using group CBT versus individual CBT.
Cognitive restructuring has also proved useful in treating agoraphobia. This treatment involves coaching a participant through a dianoetic discussion, with the intent of replacing irrational, counterproductive beliefs with more factual and beneficial ones.
Relaxation techniques are often useful skills for the agoraphobic to develop, as they can be used to stop or prevent symptoms of anxiety and panic.
Antidepressant medications most commonly used to treat anxiety disorders are mainly selective serotonin reuptake inhibitors. Benzodiazepines, monoamine oxidase inhibitor, and tricyclic antidepressants are also sometimes prescribed for treatment of agoraphobia. Antidepressants are important because some have anxiolytic effects. Antidepressants should be used in conjunction with exposure as a form of self-help or with CBT. A combination of medication and cognitive behaviour therapy is sometimes the most effective treatment for agoraphobia.
Benzodiazepines and other anxiolytic medications such as alprazolam and clonazepam are used to treat anxiety and can also help control the symptoms of a panic attack. If taken for too long, they can cause dependence. Treatment with benzodiazepines should not exceed 4 weeks. Side effects may include confusion, drowsiness, light-headedness, loss of balance, and memory loss.
Alternative Medicine
Eye movement desensitisation and reprocessing (EMDR) has been studied as a possible treatment for agoraphobia, with poor results. As such, EMDR is only recommended in cases where cognitive-behavioural approaches have proven ineffective or in cases where agoraphobia has developed following trauma.
Many people with anxiety disorders benefit from joining a self-help or support group (telephone conference-call support groups or online support groups being of particular help for completely housebound individuals). Sharing problems and achievements with others, as well as sharing various self-help tools, are common activities in these groups. In particular, stress management techniques and various kinds of meditation practices and visualisation techniques can help people with anxiety disorders calm themselves and may enhance the effects of therapy, as can service to others, which can distract from the self-absorption that tends to go with anxiety problems. Also, preliminary evidence suggests aerobic exercise may have a calming effect. Since caffeine, certain illicit drugs, and even some over-the-counter cold medications can aggravate the symptoms of anxiety disorders, they should be avoided.
Agoraphobia occurs about twice as commonly among women as it does in men. The gender difference may be attributable to several factors: sociocultural traditions that encourage, or permit, the greater expression of avoidance coping strategies by women (including dependent and helpless behaviours), women perhaps being more likely to seek help and therefore be diagnosed, and men being more likely to abuse alcohol in reaction to anxiety and be diagnosed as an alcoholic. Research has not yet produced a single clear explanation for the gender difference in agoraphobia.
Panic disorder with or without agoraphobia affects roughly 5.1% of Americans, and about 1/3 of this population with panic disorder have co-morbid agoraphobia. It is uncommon to have agoraphobia without panic attacks, with only 0.17% of people with agoraphobia not presenting panic disorders as well.
In Popular Culture
Notable Cases
• Woody Allen (b. 1935), American actor, director, musician.
• Kim Basinger (b. 1953), American actress.
• Earl Campbell (b. 1955), American pro football player.
• Macaulay Culkin (b. 1980), American actor, known for his portrayal of Kevin McCallister in Home Alone and Home Alone 2: Lost in New York, said he had “self-diagnosed” agoraphobia.
• Paula Deen (b. 1947), American chef, author, and television personality.
• H.L. Gold (1914-1996), science fiction editor – as a result of trauma during his wartime experiences, his agoraphobia became so severe that for more than two decades he was unable to leave his apartment. Towards the end of his life, he acquired some control over the condition.
• Daryl Hannah (b. 1960), American actress.
• Howard Hughes (1905-1976), American aviator, industrialist, film producer and philanthropist.
• Olivia Hussey (b. 1951), Anglo-Argentine actress.
• Shirley Jackson (1916-1965), American writer – her agoraphobia is considered to be a primary inspiration for the novel We Have Always Lived in the Castle.
• Elfriede Jelinek (b. 1946), Austrian writer, Nobel Prize laureate in Literature in 2004.
• Bolesław Prus (1847-1912), Polish journalist and novelist.
• Peter Robinson (b. 1962), British musician known as Marilyn.
• Brian Wilson (b. 1942), American singer and songwriter, primary songwriter of the Beach Boys, a former recluse and agoraphobic who has schizophrenia.
What is Panic Disorder?
Panic disorder is an anxiety disorder characterised by reoccurring unexpected panic attacks. Panic attacks are sudden periods of intense fear that may include palpitations, sweating, shaking, shortness of breath, numbness, or a feeling that something terrible is going to happen. The maximum degree of symptoms occurs within minutes. There may be ongoing worries about having further attacks and avoidance of places where attacks have occurred in the past.
The cause of panic disorder is unknown. Panic disorder often runs in families. Risk factors include smoking, psychological stress, and a history of child abuse. Diagnosis involves ruling out other potential causes of anxiety including other mental disorders, medical conditions such as heart disease or hyperthyroidism, and drug use. Screening for the condition may be done using a questionnaire.
Panic disorder is usually treated with counselling and medications. The type of counselling used is typically cognitive behavioural therapy (CBT) which is effective in more than half of people. Medications used include antidepressants and occasionally benzodiazepines or beta blockers. Following stopping treatment up to 30% of people have a recurrence.
Panic disorder affects about 2.5% of people at some point in their life. It usually begins during adolescence or early adulthood but any age can be affected. It is less common in children and older people. Women are more often affected than men.
Signs and Symptoms
Panic disorder sufferers usually have a series of intense episodes of extreme anxiety during panic attacks. These attacks typically last about ten minutes, and can be as short-lived as 1-5 minutes, but can last twenty minutes to more than an hour, or until helpful intervention is made. Panic attacks can wax and wane for a period of hours (panic attacks rolling into one another), and the intensity and specific symptoms of panic may vary over the duration.
In some cases, the attack may continue at unabated high intensity or seem to be increasing in severity. Common symptoms of an attack include rapid heartbeat, perspiration, dizziness, dyspnoea, trembling, uncontrollable fear such as: the fear of losing control and going crazy, the fear of dying and hyperventilation. Other symptoms are a sensation of choking, paralysis, chest pain, nausea, numbness or tingling, chills or hot flashes, faintness, crying and some sense of altered reality. In addition, the person usually has thoughts of impending doom. Individuals suffering from an episode have often a strong wish of escaping from the situation that provoked the attack. The anxiety of panic disorder is particularly severe and noticeably episodic compared to that from generalised anxiety disorder. Panic attacks may be provoked by exposure to certain stimuli (e.g. seeing a mouse) or settings (e.g. the dentist’s office). Nocturnal panic attacks are common in people with panic disorder. Other attacks may appear unprovoked. Some individuals deal with these events on a regular basis, sometimes daily or weekly.
Limited symptom attacks are similar to panic attacks but have fewer symptoms. Most people with PD experience both panic attacks and limited symptom attacks.
Studies investigating the relationship between interoception and panic disorder have shown that people with panic disorder feel heartbeat sensations more intensely when stimulated by pharmacological agents, suggesting that they experience heightened interoceptive awareness compared to subjects without PD.
Psychological Models
While there is not just one explanation for the cause of panic disorder, there are certain perspectives researchers use to explain the disorder. The first one is the biological perspective. Past research concluded that there is irregular norepinephrine activity in people who have panic attacks. Current research also supports this perspective as it has been found that those with panic disorder also have a brain circuit that performs improperly. This circuit consists of the amygdala, central gray matter, ventromedial nucleus of the hypothalamus, and the locus ceruleus.
There is also a cognitive perspective. Theorists believe that people with panic disorder may experience panic reactions because they mistake their bodily sensations for life-threatening situations. These bodily sensations cause some people to feel as though are out of control which may lead to feelings of panic. This misconception of bodily sensations is referred to as anxiety sensitivity, and studies suggest that people who score higher on anxiety sensitivity surveys are fives times more likely to be diagnosed with panic disorder.
Panic disorder has been found to run in families, which suggests that inheritance plays a strong role in determining who will get it.
Psychological factors, stressful life events, life transitions, and environment as well as often thinking in a way that exaggerates relatively normal bodily reactions are also believed to play a role in the onset of panic disorder. Often the first attacks are triggered by physical illnesses, major stress, or certain medications. People who tend to take on excessive responsibilities may develop a tendency to suffer panic attacks. Post-traumatic stress disorder (PTSD) patients also show a much higher rate of panic disorder than the general population.
Prepulse inhibition has been found to be reduced in patients with panic disorder.
Substance Misuse
Substance abuse is often correlated with panic attacks. In a study, 39% of people with panic disorder had abused substances. Of those who used alcohol, 63% reported that the alcohol use began prior to the onset of panic, and 59% of those abusing illicit drugs reported that drug use began first. The study that was conducted documented the panic-substance abuse relationship. Substance abuse began prior to the onset of panic and substances were used to self-medicate for panic attacks by only a few subjects.
In another study, 100 methamphetamine-dependent individuals were analysed for co-morbid psychiatric disorders; of the 100 individuals, 36% were categorised as having co-morbid psychiatric disorders. Mood and Psychotic disorders were more prevalent than anxiety disorders, which accounted for 7% of the 100 sampled individuals.
Tobacco smoking increases the risk of developing panic disorder with or without agoraphobia and panic attacks; smoking started in adolescence or early adulthood particularly increases this risk of developing panic disorder. While the mechanism of how smoking increases panic attacks is not fully understood, a few hypotheses have been derived. Smoking cigarettes may lead to panic attacks by causing changes in respiratory function (e.g. feeling short of breath). These respiratory changes in turn can lead to the formation of panic attacks, as respiratory symptoms are a prominent feature of panic. Respiratory abnormalities have been found in children with high levels of anxiety, which suggests that a person with these difficulties may be susceptible to panic attacks, and thus more likely to subsequently develop panic disorder. Nicotine, a stimulant, could contribute to panic attacks. However, nicotine withdrawal may also cause significant anxiety which could contribute to panic attacks.
It is also possible that panic disorder patients smoke cigarettes as a form of self-medication to lessen anxiety. Nicotine and other psychoactive compounds with antidepressant properties in tobacco smoke which act as monoamine oxidase inhibitors in the brain can alter mood and have a calming effect, depending on dose.
A number of clinical studies have shown a positive association between caffeine ingestion and panic disorder and/or anxiogenic effects. People who have panic disorder are more sensitive to the anxiety-provoking effects of caffeine. One of the major anxiety-provoking effects of caffeine is an increase in heart rate.
Certain cold and flu medications containing decongestants may also contain pseudoephedrine, ephedrine, phenylephrine, naphazoline and oxymetazoline. These may be avoided by the use of decongestants formulated to prevent causing high blood pressure.
Alcohol and Sedatives
About 30% of people with panic disorder use alcohol and 17% use other psychoactive drugs. This is in comparison with 61% (alcohol) and 7.9% (other psychoactive drugs) of the general population who use alcohol and psychoactive drugs, respectively. Utilisation of recreational drugs or alcohol generally make symptoms worse. Most stimulant drugs (caffeine, nicotine, cocaine) would be expected to worsen the condition, since they directly increase the symptoms of panic, such as heart rate.
Deacon and Valentiner (2000) conducted a study that examined co-morbid panic attacks and substance use in a non-clinical sample of young adults who experienced regular panic attacks. The authors found that compared to healthy controls, sedative use was greater for non-clinical participants who experienced panic attacks. These findings are consistent with the suggestion made by Cox, Norton, Dorward, and Fergusson (1989) that panic disorder patients self-medicate if they believe that certain substances will be successful in alleviating their symptoms. If panic disorder patients are indeed self-medicating, there may be a portion of the population with undiagnosed panic disorder who will not seek professional help as a result of their own self-medication. In fact, for some patients panic disorder is only diagnosed after they seek treatment for their self-medication habit.
While alcohol initially helps ease panic disorder symptoms, medium- or long-term alcohol abuse can cause panic disorder to develop or worsen during alcohol intoxication, especially during alcohol withdrawal syndrome. This effect is not unique to alcohol but can also occur with long-term use of drugs which have a similar mechanism of action to alcohol such as the benzodiazepines which are sometimes prescribed as tranquilisers to people with alcohol problems. The reason chronic alcohol misuse worsens panic disorder is due to distortion of the brain chemistry and function.
Approximately 10% of patients will experience notable protracted withdrawal symptoms, which can include panic disorder, after discontinuation of benzodiazepines. Protracted withdrawal symptoms tend to resemble those seen during the first couple of months of withdrawal but usually are of a subacute level of severity compared to the symptoms seen during the first 2 or 3 months of withdrawal. It is not known definitively whether such symptoms persisting long after withdrawal are related to true pharmacological withdrawal or whether they are due to structural neuronal damage as a result of chronic use of benzodiazepines or withdrawal. Nevertheless, such symptoms do typically lessen as the months and years go by eventually disappearing altogether.
A significant proportion of patients attending mental health services for conditions including anxiety disorders such as panic disorder or social phobia have developed these conditions as a result of alcohol or sedative abuse. Anxiety may pre-exist alcohol or sedative dependence, which then acts to perpetuate or worsen the underlying anxiety disorder. Someone suffering the toxic effects of alcohol abuse or chronic sedative use or abuse will not benefit from other therapies or medications for underlying psychiatric conditions as they do not address the root cause of the symptoms. Recovery from sedative symptoms may temporarily worsen during alcohol withdrawal or benzodiazepine withdrawal.
The neuroanatomy of panic disorder largely overlaps with that of most anxiety disorders. Neuropsychological, neurosurgical, and neuroimaging studies implicate the insula, amygdala, hippocampus, anterior cingulate cortex (ACC), lateral prefrontal cortex, and periaqueductal grey. During acute panic attacks, viewing emotionally charged words, and rest, most studies find elevated blood flow or metabolism. However, the observation of amygdala hyperactivity is not entirely consistent, especially in studies that evoke panic attacks chemically. Hippocampus hyperactivity has been observed during rest and viewing emotionally charged pictures, which has been hypothesized to be related to memory retrieval bias towards anxious memories. Insula hyperactivity during the onset of and over the course of acute panic episodes is thought to be related to abnormal introceptive processes; the perception that bodily sensations are “wrong” is a transdiagnostic finding(i.e. found across multiple anxiety disorders), and may be related to insula dysfunction. Rodent and human studies heavily implicate the periaqueductal grey in generating fear responses, and abnormalities related to the structure and metabolism in the PAG have been reported in panic disorder. The frontal cortex is implicated in panic disorder by multiple lines of evidence. Damage to the dorsal ACC has been reported to lead to panic disorder. Elevated ventral ACC and dorsolateral prefrontal cortex during symptom provocation and viewing emotional stimuli have also been reported, although findings are not consistent.
Researchers studying some individuals with panic disorder propose they may have a chemical imbalance within the limbic system and one of its regulatory chemicals gamma-aminobutyric acid (GABA-A). The reduced production of GABA-A sends false information to the amygdala which regulates the body’s “fight or flight” response mechanism and, in return, produces the physiological symptoms that lead to the disorder. Clonazepam, an anticonvulsant benzodiazepine with a long half-life, has been successful in keeping the condition under control.
Recently, researchers have begun to identify mediators and moderators of aspects of panic disorder. One such mediator is the partial pressure of carbon dioxide, which mediates the relationship between panic disorder patients receiving breathing training and anxiety sensitivity; thus, breathing training affects the partial pressure of carbon dioxide in a patient’s arterial blood, which in turn lowers anxiety sensitivity. Another mediator is hypochondriacal concerns, which mediate the relationship between anxiety sensitivity and panic symptomatology; thus, anxiety sensitivity affects hypochondriacal concerns which, in turn, affect panic symptomatology.
Perceived threat control has been identified as a moderator within panic disorder, moderating the relationship between anxiety sensitivity and agoraphobia; thus, the level of perceived threat control dictates the degree to which anxiety sensitivity results in agoraphobia. Another recently identified moderator of panic disorder is genetic variations in the gene coding for galanin; these genetic variations moderate the relationship between females suffering from panic disorder and the level of severity of panic disorder symptomatology.
The DSM-IV-TR diagnostic criteria for panic disorder require unexpected, recurrent panic attacks, followed in at least one instance by at least a month of a significant and related behaviour change, a persistent concern of more attacks, or a worry about the attack’s consequences. There are two types, one with and one without agoraphobia. Diagnosis is excluded by attacks due to a drug or medical condition, or by panic attacks that are better accounted for by other mental disorders.
The ICD-10 diagnostic criteria:
• The essential feature is recurrent attacks of severe anxiety (panic), which are not restricted to any particular situation or set of circumstances and are therefore unpredictable.
The dominant symptoms include:
• Sudden onset of palpitations.
• Chest pain.
• Choking sensations.
• Dizziness.
• Feelings of unreality (depersonalisation or derealisation).
• Secondary fear of dying, losing control, or going mad.
• Panic disorder should not be given as the main diagnosis if the person has a depressive disorder at the time the attacks start; in these circumstances, the panic attacks are probably secondary to depression.
The Panic Disorder Severity Scale (PDSS) is a questionnaire for measuring the severity of panic disorder.
Panic disorder is a serious health problem that in many cases can be successfully treated, although there is no known cure. Identification of treatments that engender as full a response as possible, and can minimise relapse, is imperative. CBT and positive self-talk specific for panic are the treatments of choice for panic disorder. Several studies show that 85% to 90% of panic disorder patients treated with CBT recover completely from their panic attacks within 12 weeks. When CBT is not an option, pharmacotherapy can be used. SSRIs are considered a first-line pharmacotherapeutic option.
Panic disorder is not the same as phobic symptoms, although phobias commonly result from panic disorder. CBT and one tested form of psychodynamic psychotherapy have been shown efficacious in treating panic disorder with and without agoraphobia. A number of randomized clinical trials have shown that CBT achieves reported panic-free status in 70-90% of patients about 2 years after treatment.
A 2009 Cochrane review found little evidence concerning the efficacy of psychotherapy in combination with benzodiazepines such that recommendations could not be made.
Symptom inductions generally occur for one minute and may include:
• Intentional hyperventilation creates lightheadedness, derealisation, blurred vision, and dizziness.
• Spinning in a chair creates dizziness and disorientation.
• Straw breathing creates dyspnoea and airway constriction.
• Breath holding creates sensation of being out of breath.
• Running in place creates increased heart rate, respiration, and perspiration.
• Body tensing creates feelings of being tense and vigilant.
Another form of psychotherapy that has shown effectiveness in controlled clinical trials is panic-focused psychodynamic psychotherapy, which focuses on the role of dependency, separation anxiety, and anger in causing panic disorder. The underlying theory posits that due to biochemical vulnerability, traumatic early experiences, or both, people with panic disorder have a fearful dependence on others for their sense of security, which leads to separation anxiety and defensive anger. Therapy involves first exploring the stressors that lead to panic episodes, then probing the psychodynamics of the conflicts underlying panic disorder and the defence mechanisms that contribute to the attacks, with attention to transference and separation anxiety issues implicated in the therapist-patient relationship.
Comparative clinical studies suggest that muscle relaxation techniques and breathing exercises are not efficacious in reducing panic attacks. In fact, breathing exercises may actually increase the risk of relapse.
Appropriate treatment by an experienced professional can prevent panic attacks or at least substantially reduce their severity and frequency – bringing significant relief to 70% to 90% of people with panic disorder. Relapses may occur, but they can often be effectively treated just like the initial episode.
vanApeldoorn, F.J. et al. (2011) demonstrated the additive value of a combined treatment incorporating an SSRI treatment intervention with CBT. Gloster et al. (2011) went on to examine the role of the therapist in CBT. They randomised patients into two groups: one being treated with CBT in a therapist guided environment, and the second receiving CBT through instruction only, with no therapist guided sessions. The findings indicated that the first group had a somewhat better response rate, but that both groups demonstrated a significant improvement in reduction of panic symptomatology. These findings lend credibility to the application of CBT programs to patients who are unable to access therapeutic services due to financial, or geographic inaccessibility. Koszycky et al. (2011) discuss the efficacy of self-administered CBT (SCBT) in situations where patients are unable to retain the services of a therapist. Their study demonstrates that it is possible for SCBT in combination with an SSRI to be as effective as therapist-guided CBT with SSRI. Each of these studies contributes to a new avenue of research that allows effective treatment interventions to be made more easily accessible to the population.
Cognitive Behavioural Therapy (CBT)
CBT encourages patients to confront the triggers that induce their anxiety. By facing the very cause of the anxiety, it is thought to help diminish the irrational fears that are causing the issues to begin with. The therapy begins with calming breathing exercises, followed by noting the changes in physical sensations felt as soon as anxiety begins to enter the body. Many clients are encouraged to keep journals. In other cases, therapists may try and induce feelings of anxiety so that the root of the fear can be identified.
Comorbid clinical depression, personality disorders and alcohol abuse are known risk factors for treatment failure.
As with many disorders, having a support structure of family and friends who understand the condition can help increase the rate of recovery. During an attack, it is not uncommon for the sufferer to develop irrational, immediate fear, which can often be dispelled by a supporter who is familiar with the condition. For more serious or active treatment, there are support groups for anxiety sufferers which can help people understand and deal with the disorder.
Current treatment guidelines American Psychiatric Association and the American Medical Association primarily recommend either CBT or one of a variety of psychopharmacological interventions. Some evidence exists supporting the superiority of combined treatment approaches.
Another option is self-help based on principles of CBT. Using a book or a website, a person does the kinds of exercises that would be used in therapy, but they do it on their own, perhaps with some email or phone support from a therapist. A systematic analysis of trials testing this kind of self-help found that websites, books, and other materials based on CBT could help some people. The best-studied conditions are panic disorder and social phobia.
Interoceptive Techniques
Interoceptive exposure is sometimes used for panic disorder. People’s interoceptive triggers of anxiety are evaluated one-by-one before conducting interoceptive exposures, such as addressing palpitation sensitivity via light exercise. Despite evidence of its clinical efficacy, this practice is reportedly used by only 12-20% of psychotherapists. Potential reasons for this underutilisation include “lack of training sites, logistical hurdles (e.g. occasional need for exposure durations longer than a standard therapy session), policies against conducting exposures outside of the workplace setting, and perhaps most tellingly, negative therapist beliefs (e.g. that interoceptive exposures are unethical, intolerable, or even harmful).”
Appropriate medications are effective for panic disorder. Selective serotonin reuptake inhibitors are first line treatments rather than benzodiazepines due to concerns with the latter regarding tolerance, dependence and abuse. Although there is little evidence that pharmacological interventions can directly alter phobias, few studies have been performed, and medication treatment of panic makes phobia treatment far easier (an example in Europe where only 8% of patients receive appropriate treatment).
Medications can include:
• Antidepressants (SSRIs, MAOIs, tricyclic antidepressants and norepinephrine reuptake inhibitors).
• Antianxiety agents (benzodiazepines):
• Use of benzodiazepines for panic disorder is controversial.
• The American Psychiatric Association states that benzodiazepines can be effective for the treatment of panic disorder and recommends that the choice of whether to use benzodiazepines, antidepressants with anti-panic properties or psychotherapy should be based on the individual patient’s history and characteristics.
• Other experts believe that benzodiazepines are best avoided due to the risks of the development of tolerance and physical dependence.
• The World Federation of Societies of Biological Psychiatry, say that benzodiazepines should not be used as a first-line treatment option but are an option for treatment-resistant cases of panic disorder.
• Despite increasing focus on the use of antidepressants and other agents for the treatment of anxiety as recommended best practice, benzodiazepines have remained a commonly used medication for panic disorder.
• They reported that in their view there is insufficient evidence to recommend one treatment over another for panic disorder.
• The APA noted that while benzodiazepines have the advantage of a rapid onset of action, that this is offset by the risk of developing a benzodiazepine dependence.
• The UKs National Institute of Clinical Excellence (NICE) came to a different conclusion, they pointed out the problems of using uncontrolled clinical trials to assess the effectiveness of pharmacotherapy and based on placebo-controlled research they concluded that benzodiazepines were not effective in the long-term for panic disorder and recommended that benzodiazepines not be used for longer than 4 weeks for panic disorder.
• Instead NICE clinical guidelines recommend alternative pharmacotherapeutic or psychotherapeutic interventions.
• When compared to placebos, benzodiazepines demonstrate possible superiority in the short term but the evidence is low quality with limited applicability to clinical practice.
Other Treatments
For some people, anxiety can be greatly reduced by discontinuing the use of caffeine. Anxiety can temporarily increase during caffeine withdrawal.
Panic disorder typically begins during early adulthood; roughly half of all people who have panic disorder develop the condition between the ages of 17 and 24, especially those subjected to traumatic experiences. However, some studies suggest that the majority of young people affected for the first time are between the ages of 25 and 30. Women are twice as likely as men to develop panic disorder and it occurs far more often in people with above average intelligence.
Panic disorder can continue for months or years, depending on how and when treatment is sought. If left untreated, it may worsen to the point where one’s life is seriously affected by panic attacks and by attempts to avoid or conceal the condition. In fact, many people have had problems with personal relationships, education and employment while struggling to cope with panic disorder. Some people with panic disorder may conceal their condition because of the stigma of mental illness. In some individuals, symptoms may occur frequently for a period of months or years, then many years may pass with little or no symptoms. In some cases, the symptoms persist at the same level indefinitely. There is also some evidence that many individuals (especially those who develop symptoms at an early age) may experience symptom cessation later in life (e.g. past age 50).
In 2000, the World Health Organisation found prevalence and incidence rates for panic disorder to be very similar across the globe. Age-standardised prevalence per 100,000 ranged from 309 in Africa to 330 in East Asia for men and from 613 in Africa to 649 in North America, Oceania, and Europe for women.
A retrospective study has shown that 40% of adult panic disorder patients reported that their disorder began before the age of 20. In an article examining the phenomenon of panic disorder in youth, Diler et al. (2004) found that only a few past studies have examined the occurrence of juvenile panic disorder. They report that these studies have found that the symptoms of juvenile panic disorder almost replicate those found in adults (e.g. heart palpitations, sweating, trembling, hot flashes, nausea, abdominal distress, and chills). The anxiety disorders co-exist with staggeringly high numbers of other mental disorders in adults. The same comorbid disorders that are seen in adults are also reported in children with juvenile panic disorder. Last and Strauss (1989) examined a sample of 17 adolescents with panic disorder and found high rates of comorbid anxiety disorders, major depressive disorder, and conduct disorders. Eassau et al. (1999) also found a high number of comorbid disorders in a community-based sample of adolescents with panic attacks or juvenile panic disorder. Within the sample, adolescents were found to have the following comorbid disorders: major depressive disorder (80%), dysthymic disorder (40%), generalised anxiety disorder (40%), somatoform disorders (40%), substance abuse (40%), and specific phobia (20%). Consistent with this previous work, Diler et al. (2004) found similar results in their study in which 42 youths with juvenile panic disorder were examined. Compared to non-panic anxiety disordered youths, children with panic disorder had higher rates of comorbid major depressive disorder and bipolar disorder.
Children differ from adolescents and adults in their interpretation and ability to express their experience. Like adults, children experience physical symptoms including accelerated heart rate, sweating, trembling or shaking, shortness of breath, nausea or stomach pain, dizziness or light-headedness. In addition, children also experience cognitive symptoms like fear of dying, feelings of being detached from oneself, feelings of losing control or going crazy, but they are unable to vocalize these higher-order manifestations of fear. They simply know that something is going wrong and that they are very afraid. Children can only describe physical symptoms. They have not yet developed the constructs to put these symptoms together and label them as fear. Parents often feel helpless when they watch a child suffer. They can help children give a name to their experience, and empower them to overcome the fear they are experiencing.
The role of the parent in treatment and intervention for children diagnosed with panic disorder is discussed by McKay & Starch (2011). They point out that there are several levels at which parental involvement should be considered. The first involves the initial assessment. Parents, as well as the child, should be screened for attitudes and treatment goals, as well as for levels of anxiety or conflict in the home. The second involves the treatment process in which the therapist should meet with the family as a unit as frequently as possible. Ideally, all family members should be aware and trained in the process of CBT in order to encourage the child to rationalize and face fears rather than employ avoidant safety behaviours. McKay & Storch (2011) suggest training/modelling of therapeutic techniques and in-session involvement of the parents in the treatment of children to enhance treatment efficacy.
Despite the evidence pointing to the existence of early-onset panic disorder, the DSM-IV-TR currently only recognizes six anxiety disorders in children: separation anxiety disorder, generalised anxiety disorder, specific phobia, obsessive-compulsive disorder, social anxiety disorder (a.k.a. social phobia), and post-traumatic stress disorder. Panic disorder is notably excluded from this list.
What is a Panic Attack?
Panic attacks are sudden periods of intense fear that may include palpitations, sweating, shaking, shortness of breath, numbness, or a feeling of impending doom. The maximum degree of symptoms occurs within minutes. Typically they last for about 30 minutes but the duration can vary from seconds to hours. There may be a fear of losing control or chest pain. Panic attacks themselves are not dangerous physically.
Panic attacks can occur due to several disorders including panic disorder, social anxiety disorder, post-traumatic stress disorder, drug use disorder, depression, and medical problems. They can either be triggered or occur unexpectedly. Smoking, caffeine, and psychological stress increase the risk of having a panic attack. Before diagnosis, conditions that produce similar symptoms should be ruled out, such as hyperthyroidism, hyperparathyroidism, heart disease, lung disease, drug use, and dysautonomia.
Treatment of panic attacks should be directed at the underlying cause. In those with frequent attacks, counselling or medications may be used. Breathing training and muscle relaxation techniques may also help. Those affected are at a higher risk of suicide.
In Europe, about 3% of the population has a panic attack in a given year while in the United States they affect about 11%. They are more common in females than in males. They often begin during puberty or early adulthood. Children and older people are less commonly affected.
Signs and Symptoms
People with panic attacks often report a fear of dying or heart attack, flashing vision, faintness or nausea, numbness throughout the body, heavy breathing and hyperventilation, or loss of body control. Some people also suffer from tunnel vision, mostly due to blood flow leaving the head to more critical parts of the body in defence. These feelings may provoke a strong urge to escape or flee the place where the attack began (a consequence of the “fight-or-flight response”, in which the hormone causing this response is released in significant amounts). This response floods the body with hormones, particularly epinephrine (adrenaline), which aid it in defending against harm.
A panic attack can result when up-regulation by the sympathetic nervous system (SNS) is not moderated by the parasympathetic nervous system (PNS). The most common symptoms include trembling, dyspnoea (shortness of breath), heart palpitations, chest pain (or chest tightness), hot flashes, cold flashes, burning sensations (particularly in the facial or neck area), sweating, nausea, dizziness (or slight vertigo), light-headedness, heavy-headedness, hyperventilation, paraesthesia’s’ (tingling sensations), sensations of choking or smothering, difficulty moving, depersonalisation and/or derealization. These physical symptoms are interpreted with alarm in people prone to panic attacks. This results in increased anxiety and forms a positive feedback loop.
Shortness of breath and chest pain are the predominant symptoms. People experiencing a panic attack may incorrectly attribute them to a heart attack and thus seek treatment in an emergency room. Because chest pain and shortness of breath are hallmark symptoms of cardiovascular illnesses, including unstable angina and myocardial infarction (heart attack), a diagnosis of exclusion (ruling out other conditions) must be performed before diagnosing a panic attack. It is especially important to do this for people whose mental health and heart health statuses are unknown. This can be done using an electrocardiogram and mental health assessments.
Panic attacks are distinguished from other forms of anxiety by their intensity and their sudden, episodic nature. They are often experienced in conjunction with anxiety disorders and other psychological conditions, although panic attacks are not generally indicative of a mental disorder.
There are long-term, biological, environmental, and social causes of panic attacks. In 1993, Fava et al. proposed a staging method of understanding the origins of disorders. The first stage in developing a disorder involves predisposing factors, such as genetics, personality, and a lack of well-being. Panic disorder often occurs in early adulthood, although it may appear at any age. It occurs more frequently in women and more often in people with above-average intelligence. Various twin studies where one identical twin has an anxiety disorder have reported a high incidence of the other twin also having an anxiety disorder diagnosis.
Biological causes may include obsessive-compulsive disorder, postural orthostatic tachycardia syndrome, post-traumatic stress disorder, hypoglycaemia, hyperthyroidism, Wilson’s disease, mitral valve prolapse, pheochromocytoma, and inner ear disturbances (labyrinthitis). Dysregulation of the norepinephrine system in the locus coeruleus, an area of the brain stem, has been linked to panic attacks.
Panic attacks may also occur due to short-term stressors. Significant personal loss, including an emotional attachment to a romantic partner, life transitions, and significant life changes may all trigger a panic attack to occur. A person with an anxious temperament, excessive need for reassurance, hypochondriacal fears, overcautious view of the world, and cumulative stress have been correlated with panic attacks. In adolescents, social transitions may also be a cause.
People will often experience panic attacks as a direct result of exposure to an object/situation that they have a phobia for. Panic attacks may also become situationally-bound when certain situations are associated with panic due to previously experiencing an attack in that particular situation. People may also have a cognitive or behavioural predisposition to having panic attacks in certain situations.
Some maintaining causes include avoidance of panic-provoking situations or environments, anxious/negative self-talk (“what-if” thinking), mistaken beliefs (“these symptoms are harmful and/or dangerous”), and withheld feelings.
Hyperventilation syndrome may occur when a person breathes from the chest, which can lead to over-breathing (exhaling excessive carbon dioxide related to the amount of oxygen in one’s bloodstream). Hyperventilation syndrome can cause respiratory alkalosis and hypocapnia. This syndrome often involves prominent mouth breathing as well. This causes a cluster of symptoms, including rapid heartbeat, dizziness, and lightheadedness, which can trigger panic attacks.
Panic attacks may also be caused by substances. Discontinuation or marked reduction in the dose of a substance such as a drug (drug withdrawal), for example, an antidepressant (antidepressant discontinuation syndrome), can cause a panic attack. According to the Harvard Mental Health Letter, “the most commonly reported side effects of smoking marijuana are anxiety and panic attacks. Studies report that about 20% to 30% of recreational users experience such problems after smoking marijuana.” Cigarette smoking is another substance that has been linked to panic attacks.
A common denominator of current psychiatric approaches to panic disorder is that no real danger exists, and the person’s anxiety is inappropriate.
Panic Disorder
Refer to Panic Disorder.
People who have repeated, persistent attacks or feel severe anxiety about having another attack are said to have panic disorder. Panic disorder is strikingly different from other types of anxiety disorders in that panic attacks are often sudden and unprovoked. However, panic attacks experienced by those with panic disorder may also be linked to or heightened by certain places or situations, making daily life difficult.
Refer to Agoraphobia and Hikikomori.
Agoraphobia is an anxiety disorder that primarily consists of the fear of experiencing a difficult or embarrassing situation from which the sufferer cannot escape. Panic attacks are commonly linked to agoraphobia and the fear of not being able to escape a bad situation. As the result, severe sufferers of agoraphobia may become confined to their homes, experiencing difficulty traveling from this “safe place”. The word “agoraphobia” is an English adoption of the Greek words agora (αγορά) and Phobos (φόβος). The term “agora” refers to the place where ancient Greeks used to gather and talk about issues of the city, so it applies to any or all public places; however, the essence of agoraphobia is a fear of panic attacks especially if they occur in public as the victim may feel like he or she has no escape. In the case of agoraphobia caused by a social phobia or social anxiety, sufferers may be very embarrassed by having a panic attack publicly in the first place. This translation is the reason for the common misconception that agoraphobia is a fear of open spaces, and is not clinically accurate. Agoraphobia, as described in this manner, is a symptom professionals check for when making a diagnosis of panic disorder. In Japan, people who exhibit extreme agoraphobia to the point of becoming unwilling or unable to leave their homes are referred to as Hikikomori. The phenomena in general is known by the same name, and it is estimated that roughly half a million Japanese youths are Hikikomori.
Experimentally Induced
Panic attack symptoms can be experimentally induced in the laboratory by various means. Among them, for research purposes, by administering a bolus injection of the neuropeptide cholecystokinin-tetrapeptide (CCK-4). Various animal models of panic attacks have been experimentally studied.
Neurotransmitter Imbalances
Many neurotransmitters are affected when the body is under the increased stress and anxiety that accompany a panic attack. Some include serotonin, GABA (gamma-aminobutyric acid), dopamine, norepinephrine, and glutamate. More research into how these neurotransmitters interact with one another during a panic attack is needed to make any solid conclusions, however.
An increase of serotonin in certain pathways of the brain seems to be correlated with reduced anxiety. More evidence that suggests serotonin plays a role in anxiety is that people who take SSRIs tend to feel a reduction of anxiety when their brain has more serotonin available to use.
The main inhibitory neurotransmitter in the central nervous system (CNS) is GABA. Most of the pathways that use GABA tend to reduce anxiety immediately.
Dopamine’s role in anxiety is not well understood. Some antipsychotic medications that affect dopamine production have been proven to treat anxiety. However, this may be attributed to dopamine’s tendency to increase feelings of self-efficacy and confidence, which indirectly reduces anxiety.
Many physical symptoms of anxiety, such as rapid heart rate and hand tremors, are regulated by norepinephrine. Drugs that counteract norepinephrine’s effect may be effective in reducing the physical symptoms of a panic attack. Nevertheless, some drugs that increase ‘background’ norepinephrine levels such as tricyclics and SNRIs are effective for the long-term treatment of panic attacks, possibly by blunting the norepinephrine spikes associated with panic attacks.
Because glutamate is the primary excitatory neurotransmitter involved in the central nervous system (CNS), it can be found in almost every neural pathway in the body. Glutamate is likely involved in conditioning, which is the process by which certain fears are formed, and extinction, which is the elimination of those fears.
The symptoms of a panic attack may cause the person to feel that their body is failing. The symptoms can be understood as follows. First, there is frequently the sudden onset of fear with little provoking stimulus. This leads to a release of adrenaline (epinephrine) which brings about the fight-or-flight response when the body prepares for strenuous physical activity. This leads to an increased heart rate (tachycardia), rapid breathing (hyperventilation) which may be perceived as shortness of breath (dyspnoea), and sweating. Because strenuous activity rarely ensues, the hyperventilation leads to a drop in carbon dioxide levels in the lungs and then in the blood. This leads to shifts in blood pH (respiratory alkalosis or hypocapnia), causing compensatory metabolic acidosis activating chemosensing mechanisms that translate this pH shift into autonomic and respiratory responses.
Moreover, this hypocapnia and release of adrenaline during a panic attack cause vasoconstriction resulting in slightly less blood flow to the head which causes dizziness and lightheadedness. A panic attack can cause blood sugar to be drawn away from the brain and toward the major muscles. Neuroimaging suggests heightened activity in the amygdala, thalamus, hypothalamus, and brainstem regions including the periaqueductal gray, parabrachial nucleus, and Locus coeruleus. In particular, the amygdala has been suggested to have a critical role. The combination of increased activity in the amygdala (fear centre) and brainstem along with decreased blood flow and blood sugar in the brain can lead to decreased activity in the prefrontal cortex (PFC) region of the brain. There is evidence that having an anxiety disorder increases the risk of cardiovascular disease (CVD). Those affected also have a reduction in heart rate variability.
Cardiovascular Disease
People who have been diagnosed with panic disorder have approximately double the risk of coronary heart disease. Certain stress responses to depression also have been shown to increase the risk and those diagnosed with both depression and panic disorder are nearly three times more at risk.
• Palpitations, and/or accelerated heart rate.
• Sweating.
• Trembling or shaking.
• Sensations of shortness of breath or being smothered.
• Feeling of choking.
• Chest pain or discomfort.
• Nausea or abdominal distress.
• Feeling dizzy, unsteady, lightheaded, or faint.
• Derealization (feelings of unreality) or depersonalisation (being detached from oneself).
• Fear of losing control or going insane.
• Sense of impending doom.
• Paraesthesia’s (numbness or tingling sensations).
• Chills or hot flashes..
Some or all of these symptoms can be found in the presence of a pheochromocytoma.
Panic disorder can be effectively treated with a variety of interventions, including psychological therapies and medication. Cognitive-behavioural therapy (CBT) has the most complete and longest duration of effect, followed by specific selective serotonin reuptake inhibitors (SSRIs). A 2009 review found positive results from therapy and medication and a much better result when the two were combined.
Lifestyle Changes
Caffeine may cause or exacerbate panic anxiety. Anxiety can temporarily increase during withdrawal from caffeine and various other drugs.
Increased and regimented aerobic exercise such as running has been shown to have a positive effect on combating panic anxiety. There is evidence that suggests that this effect is correlated to the release of exercise-induced endorphins and the subsequent reduction of the stress hormone cortisol.
There remains a chance of panic symptoms becoming triggered or being made worse due to increased respiration rate that occurs during aerobic exercise. This increased respiration rate can lead to hyperventilation and hyperventilation syndrome, which mimics symptoms of a heart attack, thus inducing a panic attack. The benefits of incorporating an exercise regimen have shown the best results when paced accordingly.
Muscle relaxation techniques are useful to some individuals. These can be learned using recordings, videos, or books. While muscle relaxation has proved to be less effective than CBT in controlled trials, many people still find at least temporary relief from muscle relaxation.
Breathing Exercises
In the great majority of cases, hyperventilation is involved, exacerbating the effects of the panic attack. Breathing retraining exercise helps to rebalance the oxygen and CO2 levels in the blood.
David D. Burns recommends breathing exercises for those suffering from anxiety. One such breathing exercise is a 5-2-5 count. Using the stomach (or diaphragm) – and not the chest – inhale (feel the stomach come out, as opposed to the chest expanding) for 5 seconds. As the maximal point at inhalation is reached, hold the breath for 2 seconds. Then slowly exhale, over 5 seconds. Repeat this cycle twice and then breathe ‘normally’ for 5 cycles (1 cycle = 1 inhale + 1 exhale). The point is to focus on breathing and relax the heart rate. Regular diaphragmatic breathing may be achieved by extending the out-breath by counting or humming.
Although breathing into a paper bag was a common recommendation for short-term treatment of symptoms of an acute panic attack, it has been criticised as inferior to measured breathing, potentially worsening the panic attack and possibly reducing needed blood oxygen. While the paper bag technique increases needed carbon dioxide and so reduces symptoms, it may excessively lower oxygen levels in the bloodstream.
Capnometry, which provides exhaled CO2 levels, may help guide breathing.
According to the American Psychological Association, “most specialists agree that a combination of cognitive and behavioural therapies are the best treatment for panic disorder. Medication might also be appropriate in some cases.” The first part of therapy is largely informational; many people are greatly helped by simply understanding exactly what panic disorder is and how many others suffer from it. Many people who suffer from panic disorder are worried that their panic attacks mean they are “going crazy” or that the panic might induce a heart attack. Cognitive restructuring helps people replace those thoughts with more realistic, positive ways of viewing the attacks. Avoidance behaviour is one of the key aspects that prevent people with frequent panic attacks from functioning healthily. Exposure therapy, which includes repeated and prolonged confrontation with feared situations and body sensations, helps weaken anxiety responses to these external and internal stimuli and reinforce realistic ways of viewing panic symptoms.
Meditation may also be helpful in the treatment of panic disorders. There was a meta-analysis of the comorbidity of panic disorders and agoraphobia. It used exposure therapy to treat patients over a period. Hundreds of patients were used in these studies and they all met the DSM-IV criteria for both of these disorders. A result was that 32% of patients had a panic episode after treatment. They concluded that the use of exposure therapy has lasting efficacy for a client who is living with a panic disorder and agoraphobia.
The efficacy of group therapy treatment over conventional individual therapy for people with panic disorder with or without agoraphobia appears similar.
Medication options for panic attacks typically include benzodiazepines and antidepressants. Benzodiazepines are being prescribed less often because of their potential side effects, such as dependence, fatigue, slurred speech, and memory loss. Antidepressant treatments for panic attacks include selective serotonin reuptake inhibitors (SSRIs), serotonin noradrenaline reuptake inhibitors (SNRIs), tricyclic antidepressants (TCAs), and MAO inhibitors (MAOIs). SSRIs in particular tend to be the first drug treatment used to treat panic attacks. Selective serotonin reuptake inhibitors (SSRIs) and tricyclic antidepressants appear similar for short-term efficacy.
SSRIs carry a relatively low risk since they are not associated with much tolerance or dependence, and are difficult to overdose with. TCAs are similar to SSRIs in their many advantages but come with more common side effects such as weight gain and cognitive disturbances. They are also easier to overdose on. MAOIs are generally suggested for patients who have not responded to other forms of treatment.
While the use of drugs in treating panic attacks can be very successful, it is generally recommended that people also be in some form of therapy, such as CBT. Drug treatments are usually used throughout the duration of panic attack symptoms and discontinued after the patient has been free of symptoms for at least six months. It is usually safest to withdraw from these drugs gradually while undergoing therapy. While drug treatment seems promising for children and adolescents, they are at an increased risk of suicide while taking these medications and their well-being should be monitored closely.
Roughly one-third are treatment-resistant. These people continue to have panic attacks and various other panic disorder symptoms after receiving treatment.
It is not unusual to experience only one or two symptoms at a time, such as vibrations in their legs, shortness of breath, or an intense wave of heat traveling up their bodies, which is not similar to hot flashes due to oestrogen shortage. Some symptoms, such as vibrations in the legs, are sufficiently different from any normal sensation that they indicate a panic disorder. Other symptoms on the list can occur in people who may or may not have panic disorder. Panic disorder does not require four or more symptoms to all be present at the same time. Causeless panic and racing heartbeat are sufficient to indicate a panic attack.
In Europe, about 3% of the population has a panic attack in a given year while in the United States they affect about 11%. They are more common in females than in males. They often begin during puberty or early adulthood. Children and older people are less commonly affected. A meta-analysis was conducted on data collected about twin studies and family studies on the link between genes and panic disorder. The researchers also examined the possibility of a link to phobias, obsessive-compulsive disorder (OCD), and generalised anxiety disorder. The researchers used a database called MEDLINE to accumulate their data. The results concluded that the aforementioned disorders have a genetic component and are inherited or passed down through genes. For the non-phobias, the likelihood of inheriting is 30-40%, and for the phobias, it was 50-60%.
Mental Health in Japan: The Rise of Recluses
Did you know that the pressures from work and society are causing more people in Japan to shun the outside world.
In the attached article by The Economist we can read about “Mika Shibata’s youngest son”, aged 26, who has not emerged from his bedroom for a year! (The Economist, 2019, p.49).
In an article by Andrew McKirdy, for the JapanTimes.co.jp, he states that a Government survey suggested that 613,000 people, between the ages of 40 and 64, are believed to be hikikomori.
This is up from the estimated 541,000 people aged between 15 and 39 that a 2015 Cabinet Office survey found to be hikikomori.
McKirdy, A. (2019) The prison inside: Japan’s hikikomori lack relationships, not physical spaces. Available from World Wide Web: https://www.japantimes.co.jp/life/2019/06/01/lifestyle/prison-inside-japans-hikikomori-lack-relationships-not-physical-spaces/#.Xil8ymieSUk. [Accessed: 23 January, 2020].
The Economist. (2019) Mental Health in Japan: The Rise of Recluses. The Economist. 30 November 2019.
|
<urn:uuid:64257d7f-a6e8-4ad1-97c8-84c9239c0c7b>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.05562543869018555,
"language": "en",
"language_score": 0.9485039710998535,
"url": "https://mental-health-matters.org/tag/hikikomori/"
}
|
Sule Pagoda
The modern urban planning of Yangon was extended around Sule Pagoda which was seen as the heart of the city. At the same time, the pagoda has been a symbolic focal point of the Burmese democratic movement.
The gold-plated Sule Pagoda in octagonal shape is believed to be built 2,600 years ago. Before Buddhism was introduced to Myanmar, the country had its local belief with 37 nats which are spirits worshipped in Myanmar. The nats represent different elements in nature, like mountains, trees and rivers, and one of them is Sularata. The place where the Sule Pagoda stands used to enshrine Sularata. As Buddhism was introduced to the country, the site was changed into a pagoda where statues of Sularata are still housed.
Apart from its religious significance, Sule Pagoda served as a rally point in two important democratic movements. In the 8888 Uprising in 1988 and Saffron Revolution in 2007, the pagoda was a starting point for the march. During the latter movement, thousands of monks, who enjoy high status in Burmese society, gathered to pray around the pagoda, adding more impact on the revolution.
Bogyoke Aung San Market
You can spend half a day here at Bogyoke Aung San Market. There are more than 2,000 shops selling lacquerware, puppets, jewellery and so on. Of course, there are traditional Burmese style handkerchiefs, shoulder bags as well as “paso” and “htamein”, which are “longyi” the traditional long dress worn by Burmese males and females respectively.
Bogyoke Aung San Market is located in the Pabedan Township in central Yangon. In the township, which was part of the British city planning, there are many British colonial buildings, including the market. The white dome of the market’s main building, clock and inner cobblestone streets are the symbols of the colonial style. The market was opened in 1926, originally named after James George Scott, a British civil servant. After Burmese independence in 1948, it was renamed after Bogyoke Aung San.
Shwedagon Pagoda
Shwedagon Pagoda is the most sacred place in Yangon and where the Burmese people take pride the most. Legend has it that the pagoda enshrines the relics of four Buddhas, namely the staff of Kakusandha, the water filter of Koṇāgamana, a piece of the robe of Kassapa, and eight strands of hair from the head of Gautama.
The Shwedagon Pagoda today stands close to 110m, covering in hundreds of gold plates. The top of the stupa is encrusted with 4,531 diamonds. The largest of which is a 72 carat diamond. There are hundreds of colourful temples, stupas and statues in the pagoda for your exploration.
If you cannot walk barefoot on the hot ground, you are recommended to visit the pagoda at dusk or even at night because no shoes are allowed inside. Besides, short skirts, shorts, and vests are also prohibited. The scene of monks and Buddhist worshipping and tourists taking photos is very typical in Shwedagon Pagoda. Surrounding the pagoda, there are white statues of gods and elephants. Worshippers would get water with a cup and pour water over the statues, again and again. Finally, they would worship sincerely by pressing the palms of the hands together. At dusk, Buddhists would ignite the white candles in the candle area to lighten the golden pagoda.
Chauk Htat Kyi Pagoda
Chaukhtatgyi Buddha Temple was built in 1899. The giant Buddha statue at that time was half reclining and was worshipped outdoor. For the current Buddha statue, it was made in 1958 to show the reclining gesture of the Buddha with the head propped on the hand before his nirvana. The gesture symbolises luck. The new statue is arguably more relaxed and jovial than the previous one.
The reclining Buddha in Chaukhtatgyi Buddha Temple is about 67m long and 17m tall. It is the largest reclining Buddha in Myanmar. The construction of the statue was an immense challenge to the craftsmen at that time. There is even a short story about the production of the eyes of the Buddha.
The temple requested the eyes to be made of giant glass beads with the dimension of 1.77m by 0.5m. The craftsmen inquired glass factories in Germany, Japan and more but none of them was willing to produce. Eventually, the local Naga Glass Factory crafted the glass eyes successfully in 1973 with the help of every staff and after five failures. As the glass eyes were ready, they were delivered to the temple by an automobile in gold. Tens of thousands of believers were gathered along the way to witness the installation of the eyes which was filmed by Myanmar Radio and Television. It was a great event of the year.
Inya Lake
Inya Lake is the largest lake in Yangon. It is also an artificial lake built by the British colonial government. Now the lake is a leisurely place for citizens of Yangon during weekends and holidays. It is also a spot for romance in Myanmar’s popular culture. Strolling around Inya Lake takes about two hours. On the southwestern shore of the lake, there is a park belonging to the University of Yangon nearby. The rest of the lake area is an affluent residential area.
54 University Avenue in the southeast of the lake is the residence of Aung San Suu Kyi. From 1989 to 2010, Aung San Suu Kyi was under house arrest in her residence by the military government. Since Myanmar has implemented a democratic system recently and moved the capital city to Naypyidaw, many believe that Aung San Suu Kyi does not stay in her Inya Lake residence often.
Kandawgyi Lake
Located in the east of Shwedagon Pagoda, Kandawgyi Lake is more beautiful at dusk with the golden reflection of the pagoda. Kandawgyi Lake is an artificial lake built by the British colonial administration in order to supply the city with clean water. The water is channelled through a series of pipes from Inya Lake, the largest lake in Yangon.
Along the eastern shorelines of the lake is the famous landmark of Myanmar– the Karaweik Hall. The palace built in 1974 is a replica of a Burmese royal barge. The word “karaweik” comes from a mythical bird with a melodious cry called “karavika”. Viewing afar, it is like Shwedagon Pagoda is on the back of the mythical bird floating on Kandawgyi Lake. It represents luck and peace. The Karaweik Hall is now a buffet restaurant on the lake, providing traditional Burmese and international cuisines. Every night, the palace features performances of traditional music and dance as well as puppetry.
|
<urn:uuid:ae985fcd-39a1-42d4-b94d-3c3eda60c09c>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.03731369972229004,
"language": "en",
"language_score": 0.9586673378944397,
"url": "https://travelhk.com/en/travel--33-scenic.html"
}
|
× Visitors: Parts of Asia Trail are undergoing construction, but the Giant Panda House and viewing area are OPEN.
Share this page:
Primates and Peanuts: Testing Tool IQ
Two peanuts sit on a tray. One is beneath the curve of a tool; the other is beside a different tool, out of reach. Smithsonian’s National Zoo’s Allen’s swamp monkey Nub Armstrong is eyeing both. Will he pick the tool that brings the peanut toward him? To examine whether guenons understand how tools work, primate keeper Erin Stromberg and University of Michigan graduate student Missy Painter have teamed up to put these monkeys’ smarts to the test.
What sparked your interest in studying guenon tool use?
Painter: As humans, we use tools every day, and we understand what makes a tool useful—that it has a causal effect on something else in the environment. For example, we know that when we rake the yard, pulling the rake causes it to act on the leaves beneath it and move them toward us.
Some primates, like chimpanzees and capuchin monkeys—use tools in the wild to access food. But, do they understand the physics behind what allows their tools to work, like humans do? Might other primate species be able to learn these types of rules about the physical world, even if they do not use tools in the wild?
As guenons are not known to regularly use tools in the wild, testing them in tool-choice tasks helps us answer this second question. We do know that they are very dexterous, manipulating many things in their environment. There are reports of wild guenons using leaves to remove sticky substances from their fingers and laying leaves on top of the water to catch fish that are attracted to the leaves. They are clever monkeys, for sure!
How do you test their tool IQ?
Painter: We present the Allen’s swamp monkeys with a choice between two rake-like tools that are almost exactly the same. One of the tools is properly positioned to retrieve a piece of food when the monkey pulls the tool toward himself or herself; the other is not.
We keep track of how long it takes the monkeys to learn to choose the correct tool. While they are leaning which tools enable them to retrieve the rewards, we can get a sense of which aspects of the tools draw their attention.
Next, we present them with a different tool shape to see if they can transfer what they have learned to a new (but similar) problem. If they succeed, this means they learned something about what kinds of objects can act as tools, and how they should interact with these objects to achieve a goal. In this case, to get a treat!
Ultimately, we, we can assess whether they learn the casual relationship between pulling the tool and receiving the reward. Do the monkeys that have learned to choose the correct tools really understand how a tool works? Or, do they use some other cue to pick the correct tool?
Allen's swamp monkey Nub Armstrong uses a tool at the National Zoo.
Do guenons usually use tools at the Zoo?
Stromberg: Think Tank—the exhibit where the guenons live—focuses on three main themes: language, society and tool use. Our Allen’s swamp monkeys and Schmidt’s red-tailed monkeys have never shown keepers that they understand the concept of using a tool to get a reward. Involving them in this study, though, could help us learn more about their understanding of tool use.
Some of the enrichment items the monkeys receive require some aspect of problem-solving in order to obtain a reward. The information we learn from this study could shape the types of enrichment we provide them in the future.
All of the research projects that we do with our primates use operant conditioning. That means that the animals’ participation in the study is voluntary and, at any point, they have the choice and opportunity to walk away. If they do elect to participate, then they receive a reward, typically in the form of food. Most of our primates that qualify for these studies eagerly participate—especially when peanuts are offered as a reward!
How did the guenons react to the tools?
Stromberg: As with all primate cognitive studies, the individual personalities of each guenon really shines through.
Before one of our female Schmidt’s red-tailed monkeys, Chi Chi, moved to another Zoo, she participated in this study in the summer and fall of 2018. She seemed to enjoy the test but did not like the sound that the tools made when they came into contact with the exhibit mesh. We added a towel “bumper” to soften the sound.
Our male Allen’s swamp monkey, Nub Armstrong, will do just about anything for a peanut. He often gets very impatient and will push on the box that hides the tools in between trials, desperate to make the peanuts appear sooner!
Did their knack for using tools surprise you?
Painter: Considering that this is the guenons’ first cognitive study at the Zoo, they took to the task pretty quickly. The number of initial training sessions they needed in order to consistently choose the correct tool was within the same range as that of a group of capuchin monkeys at Bucknell University that have participated in cognitive tasks for years!
Stromberg: I was very impressed that each of the guenons eagerly separated from their group to participate in the study, even though the tools were foreign to them, both in material and color. They demonstrated a strong desire to participate and didn’t hesitate to sit in front of and interact with these strange-looking tools!
Allen's swamp monkey Nub Armstrong at the Think Tank exhibit.
What’s next for this study?
Painter: It has been exciting to see that this study was possible with monkeys that did not have prior experience participating in research and cognitive testing. This suggests that it would be possible to test a wide variety of primates—with varying degrees of experience with cognitive testing—to learn more about how different primate species understand tools and the physical environment around them.
What do you enjoy most about this research?
Stromberg: One of the coolest things about this study is that our guenons are among the first of their species to participate. Very little information is published about guenons’ cognitive skills. To them, this study is another opportunity to interact with enrichment and receive a reward for doing so—it is just a fun activity. But, for the scientific community, studies like this offer us greater insight into the guenons’ cognitive abilities as a whole. The subject of tool use still has many unanswered questions. But, with this research, we are steps closer to understanding why and how some animals use tools and others do not.
This story appears in the May 2019 issue of National Zoo News. Painter began this research as a Master’s student in the Animal Behavior Program at Bucknell University.
|
<urn:uuid:2e2bfdf9-ea40-44cf-8e61-ee5473d1ef56>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.625,
"fasttext_score": 0.12392336130142212,
"language": "en",
"language_score": 0.9569880962371826,
"url": "https://nationalzoo.si.edu/animals/news/primates-and-peanuts-testing-tool-iq"
}
|
Pagare il fio
Pagare il fio is Italian for ‘paying the penalty’. More literally, it means ‘paying the fee’. It is an expression the Italian language inherited from the Barbarians from the North when they toppled the Western Roman Empire. The English word fee originates from Old English feoh, which means ‘cattle’. The Mid-Frisian word for cattle still is fee. In Dutch and German it respectively is vee and Vieh. So, pagare il fio is, in fact, ‘paying the cattle’. When in AD 28 the Romans raised taxes in what is the Netherlands today, and demanded more cattle had to be paid, it led to an uprising of the Frisians. The fighting was won by the Frisians, and a staggering 1,300 legionnaires died in battle. Death and taxes. The two certainties in life.
The dainty Romans arrived two thousand years ago at the rough and mighty deltas of the rivers Rhine, Meuse and Scheldt, including massive impenetrable peatlands bordering the coastal zone from Flanders to Denmark. Combined, the three rivers are responsible for releasing, on average, circa 2,5 million liters of water per second into the North Sea. A wet and swampy environment and very difficult to conquer.
The Frisians, called Frisii or Fresones by the Romans, lived along the coast from the River IJ near modern Amsterdam, to more or less the River Ems, now the border between Germany and the Netherlands. Although, parts of this border in the Dollart Bay are still being disputed by the governments of Germany and the Netherlands. Disputable too, part of modern province Drenthe was the territory of the Frisians, and that of Chauci, as well. In our post The Killing Fields, of the Celts more about this area’s history.
The first record of the Frisians dates from BC 12 and recounts how the Frisian tribes became an ally during a battle against the Chauci. The Chauci were a tribe in the north of what is now the Wadden Sea coast of northwest Germany, roughly between the River Ems and the River Elbe. So, eastern neighbours of the Frisians, and their material culture was akin to them. Both tribes living on artificial dwelling mounds (i.e. terps) on the barren tidal marshlands. Read our post Shipwrecked people of the salt marshes for a better understanding of this common sea culture. Like the Frisians, the Chauci were not pacified either. Frisians, and especially Chauci, were notorious pirates. In our post It all began with piracy we shed some light on their excessive and violent entrepreneurship, ánd the impact this had on Western history.
It were the Romans Pliny (also Plinius) the Elder and Tacitus who wrote about the Frisians and these northern lands in the first century AD. Historian Tacitus described Germanica in general as follows: “The terrain is fierce, the climate is rough, life and landscape are bleak. You only come here if it’s your homeland.” This must have been especially true for the wet, swampy coastal zone along the Wadden Sea. His words and appreciation also had a long-lasting negative effect on tourism to the north of Germany and the Netherlands.
It is fair to assume the Romans gave the Frisians their tribe’s name Frisii in the first century. This name derives from the Vulgar Latin verb fresare, meaning ‘to cut/to dig’ and referred to how Frisians cut a myriad of ditches into the soil. A way to drain and cultivate the wet, tidal landscape. See for a more elaborate explanation our post A severe case of inattentional blindness: the Frisian tribe’s name.
Close to the North Sea coast, the Roman army tried to penetrate into the north and conquer the watery area of the Frisians and the Chauci, among other. In the area of present-day town Velsen, just northwest of the modern city of Amsterdam, the Romans established two pre-limes fortresses (limes means ‘border’), probably around the year AD 15. The Romans called the place Flevum. There was a naval base and a fortress of the type castra, roughly eleven hectares large. This implies a legion of about 5,000 to 6,000 men was deployed here between AD 15-47, which makes Velsen the most northern castra-type fortress of the Roman Empire.
Back then, the River IJ connected Velsen both with the North Sea near current Egmond aan Zee, and with lacus Flevo ‘lake Flevo’. Via this lake Velsen was connected with the hinterland. It explains the name Flevum given to the fortresses, after lake Flevo. So, a strategic spot to control and to tax the movement of goods and people. But also a strategic location for the military campaigns to the north, the Wadden Sea area. Archaeological research also has identified a place of cult of the Frisians at the modern village of Velserbroek, just south of Velsen.
Roman geographer Pomponius Mela described lacus Flevo and gave it its name in the first half of the first century AD. It was a lake with an island in it. Flevo is related to the modern Mid Frisian verb floeie meaning ‘to flow’. Later River Vlie is named after it, likewise Wadden Sea island Vlieland. The name Flanders might have the same etymological origin. See our post A Frontier known as Watery Mess: the Coast of Flanders. So, all of Frisia in the flow.
fortresses Flevum at present-day Velsen
Besides Flevum, small Roman outposts might (briefly) have been established near current villages Winsum-Bruggeburen in province Friesland, and at current Bentumersiel at the River Ems in region Ostfriesland in the first century. The latter in the land of the Chauci tribe. These outposts are indicated by the many Roman finds like terra sigillata, amphoras, coins and militaria. Possibly, both outposts had as function to collect taxes, and to facilitate trade. However, there is still discussion among scholars how to interpret the archaeological finds at Winsum and Bentumersiel. Perhaps it was not Roman presence at all but merely indicates intensive contacts with the Romans. Or were it farmsteads of Frisians who had served in the army before?
AD 16 was the year general Germanicus Julius Caesar made his final effort to conquer the tribes north of the River Rhine. Via the Wadden Sea his immense fleet of four legions reached the muddy mouth of the River Ems, as said being the border of the Frisians and the Chauci. Here, Gallic and Germanic auxiliary troops of the Roman army, who had marched over land from the south, joined the main army. The Frisians were that time friendly of the Romans. From the River Ems, Germanicus continued to the River Weser to confront the Germanic army led by commander Armenius of the Cherusci tribe.
Although the battles between Germanicus and Armenius took many lives, Germanicus was victorious in AD 16. A big set back, however, during Germanicus’ military campaign was, that on the way back from the River Ems the fleet ran into a storm on the Wadden Sea. Ships were wrecked, many drowned and the army was dispersed over a large area. Army officer praefectus Albinovanus Pedo wrote about this maritime disaster, which, by the way, is the oldest account describing the Wadden Sea area. Read our post Racing the Wadden Sea with a Silt Sled to find Pedo’s compelling account. Although Germanicus was successful over all, he was ordered by Rome, for unclear reasons, to settle behind the River Rhine nevertheless.
One year after John the Baptist was beheaded in Jerusalem by tetrarch ‘ruler’ Herod Antipas, it were the Frisians who revolted against the Romans this time. Immediate cause was the raise of taxes, which led to the great uprising in the year AD 28. At least, this is what historian Tacitus gave as reason. The Roman tax collector by the name Olennius was not satisfied with the small cattle pelts and demanded more and bigger ones. When the Frisians explained to Olennius the size of their cattle was the size of their cattle, Olennius wanted the Frisians to give their women and children as slaves. No reasoning with this antithesis of Zacchaeus. Hence, the Frisians were left no choice but to revolt. That was what they did.
The Frisians, men and probably women too since war was a family affair, attacked the fortresses at Flevum in a battle which has become known as the Battle of the Baduhenna Forest. No, not the Teutoburg Forest. Ba-du-hen-na Forest.
The Romans suffered significant losses against the Frisians in the Baduhenna Forest. Tacitus reports 900 Roman casualties in the forests, and yet another 400 Roman soldiers who killed each other just after their retreat at the villa or farmstead of a certain person named Cruptorix. Reason for the butchery at Cruptorix’ villa was fear of mutiny and betrayal, after the massacre in the forests, and the fear they would be slaughtered by the strong Frisians soon.
The reports of Tacitus are supported by archaeological finds. Archaeological research has found no less than 520 lead sling bullets at the former fortresses that were under siege by the Frisian men and women.
As a consequence of this fierce resistance, the Romans had to give up their pre-limes fortresses at the River IJ at modern Velsen too. Maybe this applies to the recently discovered fortifications at the town of Krommenie too, located circa twenty kilometers northwest of Amsterdam. The Romans were pushed back south by the Frisians, behind the River Rhine. And, as it was perceived in Rome those days, the imperial army had lost much of its honor in the north against the Germanic tribes above the River Rhine.
ever since the name of the Frisians has a bright sound
Despite all military efforts, the River Rhine turned out to be the most northern border of the empire on the Continent. Do not forget, no less than three Roman legions were slaughtered by Germanic tribes in the relatively nearby Teutoburg Forest at the present-day town Kalkriese in Germany not long before, in the year AD 9. An even more humiliating defeat. With the already mentioned disastrous battle in AD 28, the Romans adjusted their ambitions in expanding their territory northbound. For the time being, that was, because one famous Roman army commander would give it yet another try, as we shall see further below.
More resistance
From around the year 40 the Romans constructed the limes along the south banks of the River Rhine, being the northernmost border of their empire on the Continent. The limes was a series of fortresses, watch posts and, near the coast, a naval fleet, all connected with roads. The most western castellum was Lugdunum, built around the year 40, and locally known as Brittenburg. It was built at the mouth of the River Rhine near present town Katwijk, circa 900 meters from the coast. Since Roman times, the North Sea coastline has moved about a kilometre inland. Probably, two hors equitata ‘cavalry units’ of each about 480 men of the Cananefates tribe were stationed here. After the uprising of Cananefates, Batavians, Frisians and Chauci in the years 69 and 70 (see further below), these cavalry units have been replaced by other auxiliary forces from outside the region. Fortress Lugdunum remained exceptionally long in use, even after the Romans basically had left the limes and their military presence along the River Rhine halfway the third century. In the period 364-375, namely, castellum Lugdunum was reduced in size and received the function as a secured granary for the supply of Britannia (Wolfrat 2022).
Also on the south bank of the River Rhine, not far from Lugdunum, the Romans constructed a military complex consisting of a harbour, very big horrea ‘granaries’, a castrum ‘army camp’, and a castellum ‘fortress’ . The complex, built in the year 39, was named Praetorium Agrippinae and located at the modern town of Valkenburg, circa 15 kilometres north of The Hague. It supported about 6,000 military. Purpose of this huge military site was to serve as one of the bases for the invasion of Britannica. It was emperor Caligula who personally inspected the base in the year 40. In the following years the invasion of Britannica unfolded. Emperor Caligula was murdered a year after he visited Valkenburg. See featured image of this post the death of Caligula and his mother Agrippinae behind the drapes, painted by the Frisian artist Lourens Alma-Tadema (see nota III below). Caligula pagato il fio, indeed.
In the year 46, under the command of ‘pirate’ Gannascus and a member of the Cananefates tribe, the Chauci together with the Frisians started raiding the North Sea coasts south of the River Rhine all the way to Gaul. A year later, general Corbulo was appointed in the north to restore order. He started punitive expeditions against the Chauci and the Frisians, and managed to subdue the Frisians. The limes, part of the Limes Germanicus, were erected along the south banks of the lower River Rhine from AD 47 onward. Despite commander-in-chief Corbulo was quite successful in giving the Frisians and the Chauci a hard time, Rome ordered Corbulo to stop his campaigns and once again to settle with the River Rhine as the northern-most border of the empire. Army camp Flevum was given up. Corbulo left the area in the year 50. Probably feeling he could have achieved so much more if only the out-of-touch bureaucrats in the capital had listened to him.
Another massive uprising which must be mentioned, is the one in the years 69 and 70, known as the Revolt of the Batavi. The Batavians were under the command of Gaius Julius Civilus. The Cananefates, under command of king Brinno, the Chauci, and the Frisians also participated in the revolt. These latter tribes were considered the bravest forces by Civilus. The naval power of these allied forces was mainly supplied by the Cananefates and the Frisians, and their fleet laid waste to the mighty castellum Praetorium Agrippinae. Actually, with the destruction of Praetorium Agrippinae by the Cananefates and Frisians, the whole Batavian Revolt started in the first place. Read more in our post It all began with piracy. what the fleet of the Cananefates and Frisians did more.
Forum Hadriani also known as Municipium Aelium Cananefatium MAC by Glimmerveen
In AD 121, in the land of the civitas ‘tribe’ Cananefates who dwelled in the area between the mouths of the rivers Flevum (Rhine) and Helinium (Haringvliet), the Romans founded the most northern capital of the Roman Empire on the Continent, namely Forum Hadriani also known as Municipium Aelium Cananefatium. Commonly abbreviated, something the Romans loved to do, to MAC. MAC was located near the present-day city of The Hague, and had an estimated 5,000 inhabitants. The nearest other town was Noviomagus, modern Nijmegen in the Netherlands, with also an estimated 5,000 inhabitants.
Nota I – If you think the presence of the Roman Empire was merely a burden for the Frisians, this was not the case. It also meant more trade possibilities, like selling woolen cloth, salt and probably dairy products. But also Frisian warriors enrolled in the army as soldier. Read our post Frisian mercenaries in the Roman Army.
Nota II – Did you know that between 1504 and 1795, ancient Roman Law in its purest form was the applicable law in province Friesland? Check our post Medieval Migration Law for more about this anomaly in European law practice.
Nota III – Featured image is a painting of the Frisian painter Sir Lourens Alma-Tadema (1836-1912) from Dronrijp. It is the death of emperor Caligula in AD 41. On the wall a painting of the famous naval Battle at Actium in BC 31 . Alma-Tadema was one of the most famous painters of his time, and lived for a big part of his life in England. His paintings shaped for many generations how people envisioned Antique Rome, and maybe it does to this very day. Alma-Tadema was promoted to British nobility and is buried in the Saint Paul’s Cathedral, which all together a huge honour given to someone in Britain. In the Netherlands he was not even allowed to a Dutch art school.
Credit images Romans encountering Frisians: Stichting Oer-IJ and Rob van Eerden.
Further reading
• Berkel, van G. & Samplonius, K., Nederlandse plaatsnamen verklaard. Reeks Nederlandse plaatsnamen deel 12 (2018)
• Bunt, van de A., Wee de overwonnenen. Germanen, Kelten en Romeinen in de Lage Landen (2020)
• Diederik, F., Germania en de keizerlijke politiek (2011)
• Galestin, M.C., Frisii and Frisiavones (2016)
• Haywood, J., Dark Age Naval Power. A Reassessment of Frankish and Anglo-Saxon Seafaring Activity (1999)
• Heeren, S., Grensoverschrijdingen. Romeins-Germaanse interactie (2022)
• Lendering, J., Romeinen in Velsen (2016)
• Naber, M.J. & Smit, E., Romeinse veldtochten. 7 wandelingen langs de noordgrens van het Romeinse Rijk (2016)
• Nijdam, H., Law and Political Organization of the Early Medieval Frisians (c. AD 600-800) (2021)
• Wolfrat, E., De Brittenburg bij Katwijk. Een reconstructie op basis van schriftelijke bronnen (2022)
Leave a Reply
You are commenting using your account. Log Out / Change )
Twitter picture
Facebook photo
Connecting to %s
%d bloggers like this:
|
<urn:uuid:2be64480-0f44-4b3e-8f65-a6025c45e984>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.039948105812072754,
"language": "en",
"language_score": 0.9209562540054321,
"url": "https://frisiacoasttrail.blog/2021/12/10/pagare-il-fio/"
}
|
How Big is a Refugium?
How Big is a Refugium?
A refugium must be large enough to function properly. That is, not just keep a bed of macroalgae alive, but also provide enough space to allow for continuous growth. Without continuous growth, nitrate and phosphate removal ceases. Worse, if an overgrown mass starts to die back, you could actually experience a decline in water quality.
So, how large should a refugium be? As much as you might love a simple answer to that question, there really isn’t one (not one that is correct, anyway!). The answer to this depends upon many factors, and every aquarium system is unique. How much nitrate/phosphate is produced per gallon per day in this system? Is the refugium lighting supporting maximal photosynthetic rates? What is the rate of water flow through the refugium? What type(s) of the macro are you using? How much/often do you harvest from the standing crop?
If you want to operate a refugium primarily for efficient nutrient removal, you’ll need to use chlorophytes (green algae), as they exhibit the fastest growth rates. Some aquarists might opt for Ulva instead of Chaetomorpha, as the former is far more useful as a live veggie food than the latter. But you’ll additionally have to consider flow rates; to get maximum nutrient removal, you’ll need to turn over the total refugium water volume per some amount of time, right? Chaetomorpha can physically withstand significantly higher flow rates than Ulva, for example; this means that you’ll need a bigger grow space for Ulva (that is, to get proper turnover rates through the refugium without super high flow rates).
A small amount of macro is unable to fully process a high concentration of dissolved nutrients regardless of the turnover rate. This means the bed will have to be of a minimal size--and actively growing. A good target for a refugium size can be around one third of the display volume. That would certainly be ideal, but it's okay to have a smaller refugium. Most aquariums have sumps that are barely one third of the display volume let alone refugiums. Generally, a 50 gallon aquarium might have a refugium that is about 5 gallons and a 100 gallon aquarium might have a 10 gallon refugium. You could add a refugium to your filtration with a whole separate aquarium, which is what some would refer to as a "real" refugium. However, you can make a portion in your sump a refugium too. Some would argue that isn't a real refugium, but who cares? Some hobbyists also argue that refugiums aren't needed at all. It all depends what you want to do with your aquarium. If you just want to grow macroalgae to keep nutrients down, then you can certainly do that in an average sized sump chamber. If you can get a large refugium, certainly go for it. The bigger the better, but small five gallon refugiums are good too, depending on the tank size.
Honestly, there is no refugium that is too big. And that’s the only thing we can say for certain. That’s why when we hear “how big” for refugia, we say “way big.” As in, as large as possible!
• Related Articles
• Do I need a Refugium?
If you are new to the saltwater/reef aquarium hobby, you may or may not have heard the term "refugium". Chances are that you have heard of a refugium since you are here. However, that term can be confusing, especially because it means different ...
• What Does A Refugium Do?
What does a refugium do? Refugia continue to become more and more popular in the marine aquarium hobby. This is in large part because of a growing reliance on natural water filtration/treatment methodologies. But, mainly, this is because they ...
• Can I Put Fish in My Refugium?
So you’ve got a big, healthy refugium attached to your main tank. Just sitting there, without much movement in it (well, aside from thousands of little scurrying pods). Especially if your main tank is chock full of fish, you might start to wonder: ...
• What Can You Put in a Refugium?
Theoretically, a refugium can be set up like any kind of aquarium system. Thus, if it is large enough, you could put virtually any aquarium species in it. Of course, you might have to make some special, additional accommodations; for example, if ...
• How Does a Refugium Work?
A refugium is an auxiliary tank that is connected to the “main” tank. While the main tank is used mostly for display, the refugium serves mainly utilitarian purposes. In short, refugia naturally turn unwanted materials such as dissolved and ...
|
<urn:uuid:0aabe548-94ae-4543-800b-cc3a92c90396>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.4765496253967285,
"language": "en",
"language_score": 0.9535189270973206,
"url": "https://help.algaebarn.com/portal/en/kb/articles/how-big-is-a-refugium"
}
|
Lesson Three – For The Con, You Need A Suitcase
imedim suitcase
thi have
boó three
be he, she, it
th a morpheme that means “This is the direct object in this sentence.”
1. Bíi ril thi Athid imedimeth wa.
“Athid has a suitcase.”
2. Bíi ril thi Sha imedimeth wa.
“Sha has a suitcase.”
3. Bíi ril thi óowamid imedimeth boó wa.
“The dragon has three suitcases.”
4. Bíi ril thi be imedimeth wa.
“She [or he, or it] has a suitcase.”
5. Bíi ril thi be imedimeth boó wa.
“It [or she, or he] has three suitcases.”
Láadan Grammar Facts
1. Direct objects are the items in a sentence that things happen to; they answer “what” and “who” and “which” questions. In “Thad bought a book in the dealer’s room,” for example, buying is what happened and it was a book that the buying happened to. And “a book” is the answer to the question “What did Thad buy in the dealer’s room?”
In Láadan, you have to put the morpheme “-th” at the end of direct objects.
And — because “-th” is a consonant — if the last sound in the word or phrase for the direct object is a consonant, you have to put an “e” between the word and the “-th.” So, when you mark “imedim” as a direct object by adding “-th,” the result will be “imedimeth.”
2. If you need to specify exactly how many there are of something, you can do that in Láadan by putting a number right after the word for that something.
So “imedim boó” means “three suitcases.” “óowamid boó” would mean “three dragons.”
Pattern Practice
Complete the following sentences by adding the appropriate ending to the Láadan word that follows the sentence.
Bíi ril thi Athid imedimeth wa.
“Athid has a suitcase.”
1. Bíi ril thi Athid __________ wa. [a book; book — áabe]
2. Bíi ril thi Athid __________ wa. [a cup; cup — ni]
3. Bíi ril thi Athid __________ wa. [a bed; bed — dahan]
4. Bíi ril thi Athid __________ wa. [a beer; beer — webe]
< Lesson Two – Athid, Sha, Thad And The Dragon Are Going To The Con Table of Contents Lesson Four – Asking Questions >
|
<urn:uuid:d51bb939-ef74-49f2-8b50-3d058602c432>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.2561299800872803,
"language": "en",
"language_score": 0.8957270383834839,
"url": "https://laadanlanguage.com/lesson-books/laadan-lessons-for-beginners/beginner-lesson-three/"
}
|
What is the root word of confluence?
What is the word meaning of confluence?
1 : a coming or flowing together, meeting, or gathering at one point At the confluence of Native American, Hispanic, and Anglo cultures, Santa Fe is the symbolic heart of the Southwest.—
What is the root of the word define?
late 14c., deffinen, diffinen, “to specify; to fix or establish authoritatively;” of words, phrases, etc., “state the signification of, explain what is meant by, describe in detail,” from Old French defenir, definir “to finish, conclude, come to an end; bring to an end; define, determine with precision,” and directly …
What type of word is confluence?
a crowd or throng; assemblage.
What is the root word of origin?
The root, start, or birth of something is its origin. The origin of the word origin is the Latin word originem, meaning “rise, beginning, or source.”
What is the opposite of confluence?
Opposite of the act of meeting or coming together at the same point. divergence. division. separation. disconnection.
What is confluence in geography?
Confluence – the point at which two rivers or streams join. Tributary – a stream or smaller river which joins a larger stream or river.
What are examples of confluence?
The definition of confluence is the place where two or more things merge, or the act of merging. The location were two rivers merge is an example of a confluence.
THIS IS FUNNING: Are agile teams self organizing?
How do you use the word confluence?
Confluence sentence example
1. The confluence of the two companies allowed for both of them to be more successful. …
2. The marriage was a beautiful representation of the confluence of two families. …
3. The couple’s work was a confluence of their different musical styles, creating very unique songs.
|
<urn:uuid:6024284f-2320-4724-b346-06b5a2b5ef85>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5,
"fasttext_score": 0.9827107787132263,
"language": "en",
"language_score": 0.9027904868125916,
"url": "https://scdgroup.net/methodologies/what-is-the-root-word-of-confluence.html"
}
|
THE two boys started in surprise at the fresh muddy imprints of a pair of bare feet. What was a barefooted man doing on the steps of a house, in the middle of London? And where was the man?
As they gazed, a remarkable sight met their eyes. A fresh footmark appeared from nowhere!
Further footprints followed, one after another, descending the steps and progressing down the street. The boys followed, fascinated, until the muddy impressions became fainter and fainter, and at last disappeared altogether.
The lesson "Footprints Without Feet" is an interesting story written by H.G. Wells. The story is about a scientist named Griffin. He discovers the rare chemicals which can make a man invisible, but at the same time, the man can be felt and touched physically. Let's read and find out how he uses or misuses his powers for his own.
The story opens with the narrator stating that two boys started wondering after seeing the fresh muddy impressions of bare feet. On seeing that, they questioned each other as to what the barefoot man was doing on the stairs of a house in the middle of London. They began to wonder about the man, who was nowhere to be seen.
While the two boys were walking and looking down, they found an unbelievable sight. It was nothing but a fresh footprint. Even though there was a footmark, the boys couldn't see to whom the footmark belonged. The two boys then noticed several footprints. The imprints continued one after one down the steps and proceeded to the street. Even though the boys could see the imprints of a barefooted man, the man was still invisible to them. The boys thought the footprint belonged to a man because it might seem big. (One can assume that while comparing the female's feet, the man's feet would be bigger). The two boys then followed the invisible man's footsteps in excitement. They followed it until the footprints vanished.
Muddy footprint
Meanings of the difficult words:
Surprise An unexpected or astonishing event
ImprintA mark or outline made by pressing something onto a softer substance
Bare feetNot wearing any shoes or socks
GazeLook steadily and intently, especially in admiration, surprise, or thought
Remarkable Unusual and surprising
Sight The ability to see
Footmark A footprint
NowhereNot in or to any place; not anywhere
Disappear To no longer exist
National Council of Educational Research and Training (2007). Footprints without Feet - H.G. Wells(pp. 26-31). Published at the Publication Division by the Secretary, National Council of Educational Research and Training, Sri Aurobindo Marg, New Delhi.
|
<urn:uuid:49f2bc6e-64d1-480a-9ed9-979e200204f6>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.75,
"fasttext_score": 0.0424879789352417,
"language": "en",
"language_score": 0.949433445930481,
"url": "https://www.yaclass.in/p/english-language-cbse/class-10/supplementary-14340/footprints-without-feet-14601/re-67de36ad-8106-4f81-b37b-730e0c6941bf"
}
|
Knights' Revolt
Joshua J. Mark
published on 27 April 2022
Nanstein Castle (by gesoe62, CC BY-SA)
Nanstein Castle
gesoe62 (CC BY-SA)
The Knight’s Revolt (1522-1523) was a military action led by the German imperial knight Franz von Sickingen (l. 1481-1523) and encouraged by the knight and writer Ulrich von Hutten (l. 1488-1523) launched to restore the status of the imperial knights and advance the Protestant Reformation in Germany. The revolt failed to rally the peasants and was quickly crushed.
Hutten was a poet-knight and Humanist who had already taken a stand against the abuses and corruption of the Church through satires and who saw in Martin Luther (l. 1483-1546) a real hope of establishing a German Church and driving the Church of Rome from the land. Sickingen supported Luther, as a number of powerful nobles did, for several reasons which included the possibility of access to rich Church property, presently tax-free, that could benefit knights such as himself.
Remove Ads
The imperial knights, once a powerful demographic, had lost both power and prestige owing to the increased wealth of the higher nobility, the decline of the feudal system, and advances in military technology which threatened to make the mounted, armored, warrior obsolete. Further, the 10% tithe demanded by the Church, as well as other fees, drained their treasuries and, because the peasants they relied upon for taxes were taxed by the Church and the higher nobility as well, they no longer commanded the wealth and status they once enjoyed.
Sickingen launched the revolt in August 1522, while Hutten was in Switzerland trying to rally support, but failed to take the city of Trier when the peasants refused to support him. He retreated to Nanstein Castle at Landstuhl, pursued by the armies of Philip I of Hesse (l. 1504-1567), Elector Louis V, Count Palatine (l. 1478-1544), and the Archbishop of Trier, Richard von Greiffenklau (l. 1467-1532). Their superior firepower destroyed his defenses and he died of his wounds after surrendering on 7 May 1523. Hutten died a few months later in Switzerland from syphilis.
Remove Ads
Statue of Ulrich von Hutten and Franz von Sickingen
Statue of Ulrich von Hutten and Franz von Sickingen
Stefan Frerichs (CC BY-NC-SA)
The knights who had followed or supported Sickingen had their lands confiscated by the higher nobility and were reduced to working for them while taxing the peasants at higher rates than before. The Knights’ Revolt (also known as the Poor Barons’ Rebellion) is therefore sometimes cited as a contributing cause of the German Peasants’ War (1524-1525) which was a revolt of the lowest class against abuses by those above them. Both revolts are frequently cited in connection with Luther whose defiance of the Church inspired others to challenge secular authority.
Love History?
Sign up for our free weekly email newsletter!
Cultural & Political Background
The Germanic territories at this time were part of the Holy Roman Empire which, like all of Europe, maintained the social structure of the Middle Ages with the emperor at the top followed by the higher nobles, then the lesser nobles (which included the imperial knights), then the clergy (who were almost all from families of nobles or lesser nobles), then the merchant class and, at the bottom, the peasants who were required to pay taxes to all of those above.
Imperial knights answered directly to the emperor, and many were as powerful as any prince but they lacked political representation.
The Church provided the spiritual justification for this hierarchy through their claim that it was ordained by God. Challenging the social structure was therefore considered an affront to the Divine and biblical passages were cited to make sure everyone understood their place, such as Ephesians 6:5-9 which includes the line, “Servants, obey your earthly masters with respect and fear, and with sincerity of heart, just as you would obey Christ.” The nobles were clearly the masters and all who were below them were expected to bow to their authority.
Remove Ads
The imperial knights answered directly to the emperor, and many were as powerful as any prince or duke but, because they were not granted Imperial Estates (reserved for higher nobles), they lacked representation in the Imperial Diet (assembly) that passed the laws of the land. They answered directly to the emperor and were expected to raise and lead troops in his various causes. Knights were granted land, handed down within a family father-to-son, but these tracts were not as large or lucrative as the estates of nobles. Knights taxed their peasants but acquired real wealth by attacking nearby cities, carrying off important nobles, and holding them for ransom or even occupying the cities themselves until a ransom was paid.
Martin Luther
Martin Luther
Sergio Andres Segovia (Public Domain)
Since they were not represented in the Imperial Diet, there was no way they could change the laws to improve their finances and, as the 16th century began, their power began to decline as the nobility’s wealth translated into greater influence and reach while, at the same time, the political power of the merchant class was on the rise. The knights had always been well-respected as formidable, mounted warriors but the development of the arquebus (musket) in the 15th century, with its ability to fire a bullet through armor, as well as the creation of the Wagenburg (wagon fort) threatened to make them obsolete. During the Hussite Wars (1419-c. 1434), the general Jan Zizka (l.c. 1360-1424) used both to neutralize knights in battle and this trend had continued.
In 1495, the knights had petitioned for inclusion in the Imperial Diet and presented a list of grievances to the assembly at Worms. The nobility refused to enact any of their protests as law except one making private warfare illegal – but only for the knights, not the nobles. This act deprived the knights of their major source of wealth as they were now prohibited from ransoming cities or capturing and ransoming nobility.
Remove Ads
Luther & the Knights
Martin Luther’s 95 Theses, posted at Wittenberg in 1517 and popularized through 1519, presented an unimaginable opportunity for the knights to regain their former prestige. As the Reformation spread, the status quo of the traditional social hierarchy was challenged. Lesser nobles, including the knights, saw a chance to improve their fortunes by supporting Luther and seizing Catholic lands and assets for themselves. At the same time, however, this was a risky proposition not only because it was far from certain that Luther’s “new teachings” would actually result in any significant change but because the nobles had come to rely on the Church for their own gain. Supporting the Reformation was a gamble in which one might win more than one had or lose it all. Scholar Ronald G. Asch comments:
A certain reluctance to support the Reformation can partly be explained by the structure of the late medieval church. Many bishops and other high-ranking clerics were themselves nobles and the late medieval church has often been described as the “nobility’s almshouse.” After all, cathedral chapters, collegiate churches, monasteries, and convents offered a life of ease and prosperity to many younger sons and unmarried daughters of noble families. Higher positions at the head of a diocese or a rich abbey gave those who obtained them considerable secular power. In the Holy Roman Empire most bishops acted not only as spiritual shepherds of their flocks, a duty they normally used to take very lightly, but in addition, they also ruled vast secular dominions; three of them, The Archbishops of Cologne, Mainz, and Trier, were members of the exclusive college of prince electors who chose the new emperor when his predecessor had died. (Rublack, 566)
Ebernburg Castle
Ebernburg Castle
Traveler100 (CC BY-SA)
If Luther succeeded in dismantling the Church – and, in 1519/1520, this was not only far from Luther’s intentions but a seeming impossibility – then the nobility stood to lose power but, at the same time, by supporting his cause for reform, one might acquire more land through confiscation and therefore more wealth and greater power. This possibility appealed to a number of nobles and knights including, secretly, Philip I of Hesse, Frederick III (the Wise, l. 1463-1525, one of the electors), and, openly, Franz von Sickingen, and Ulrich von Hutten.
Sickingen defied the ban on private wars & relied on the old method of taking cities, lands, or people hostage & demanding a large ransom for their return.
Sickingen & Hutten
Sickingen inherited Ebernburg Castle, in the town of Bad Munster am Stein-Ebernburg, from his father and, as a knight, fought for the Holy Roman Emperor Maximilian I (r. 1508-1519) in his wars with Venice. He was rewarded with lands along the Rhine River and modernized the 12th-century castle of Nanstein at Landstuhl with better defenses, making it one of the strongest fortresses in the region. From here and Ebernburg, he launched raids throughout the Rhineland “liberating” wealth in the name of the people which he then kept for himself. Scholar Roland H. Bainton comments:
Remove Ads
Sickingen was trying to obviate the extinction of his class by giving to Germany a system of justice after the manner of Robin Hood. He announced himself as the vindicator of the oppressed and, since his troops lived off the land, he was always seeking more oppressed to vindicate. (125)
He defied the ban on private wars and relied on the old method of taking cities, lands, or people hostage and demanding a large ransom for their return, increasing his power steadily so that he was even able to compel a significant sum from Philip I of Hesse. In 1519, when Maximillian I died, Sickingen accepted bribes from France to support their candidate for Holy Roman Emperor then surrounded Frankfurt, where the election was taking place, and forced the election of the young Charles V instead; two years later, he invaded France.
He first met Hutten in c. 1517 when the latter appealed to the Swabian League for justice in the murder of his relative, Hans von Hutten, by Ulrich, Duke of Wurttemberg, and Sickingen saw an opportunity for booty. Hutten was a highly educated poet best known for his contributions to The Letters of Obscure Men, a collection of satirical works. He had been sent to a Benedictine monastery when he was ten years old by his father, where he learned Latin, but left after seven years for Cologne, immersing himself in the intellectual life of the city, before traveling on. He studied in Italy for the law, published poems, served in the military as a mercenary, and returned to Germany in 1517 where he was knighted for his literary works by Maximillian I.
Ruins of Nanstein Castle
Ruins of Nanstein Castle
Anne-Lise Heinrichs (CC BY)
During his travels, he had acquired an intense hatred for the Roman Catholic Church generally and the pope specifically. Hutten envisioned a united Germany without papal influence and the exorbitant tithes that drew wealth from Germanic peoples to be spent on lavish buildings in Rome. When Luther’s 95 Theses began attracting attention, Hutten dismissed them as more theological nonsense until he heard Luther defend his views at Augsburg in 1518. Hutten threw his support behind Luther, started printing anti-Catholic pamphlets, and then realized he could enlist Sickingen in the cause. Bainton comments:
Hutten established himself at Sickingen’s castle called the Ebernburg and there the poet Laureate of Germany read to the illiterate swordsman from the German works of the Wittenberg prophet. Sickingen’s foot and fist stamped assent, as he resolved to champion the poor and sufferers for the gospel. Popular pamphlets began to picture him as the vindicator of the peasants and of Martin Luther. (125)
Hutten corresponded with Luther, encouraging him, and Sickingen also openly sided with Luther’s cause. In 1519, Hutten wrote in defense of the Humanist scholar Johann Reuchlin (l. 1455-1522), great uncle of Luther’s right-hand man Philip Melanchthon (l. 1497-1560) when Reuchlin was threatened by the Dominican Inquisition for his defense of works in Hebrew. Sickingen supported Hutten and Reuchlin by threatening military intervention, quickly ending Reuchlin’s persecution. After Luther’s speech at the Diet of Worms in 1521, Sickingen offered him protection at Ebernburg Castle, but Luther had already accepted the offer of Frederick III and was taken to Wartburg Castle instead.
The Knights’ Revolt
Sickingen’s castles now became safe havens for those who supported the Reformation, including the future Reformer Martin Bucer (l. 1491-1551) who was invited to Ebernburg in early 1522. Sickingen and Hutten proposed a complete restructuring of society, after they had rid themselves of the Church, with the goal of creating a united and independent Germany. Sickingen encouraged his supporters to stop paying taxes to the nobility or tithes to the Church while Hutten continued publishing pamphlets and tracts popularizing Sickengen’s stand, appealing to the peasantry for support, defending Luther, and attacking the Church.
At some point in 1522, Hutten left to rally support in Switzerland among the followers of Reformer Huldrych Zwingli (l. 1484-1531) while Sickingen called for an assembly under the name of the Brotherly Convention of Knights to take military action. He announced that their first target would be Richard von Greiffenklau, Archbishop of Trier, who had publicly denounced Luther (though, unknown to Sickingen, was corresponding with Luther to try to resolve their differences). Sickingen had pamphlets distributed encouraging the peasants of Trier to rise up against Greiffenklau and his declaration of war on the city made clear that his was a holy cause of liberation.
Ulrich von Hutten
Ulrich von Hutten
Erhard Schön (Public Domain)
He justified the war by claiming the city had never paid a ransom due for two councilors captured but returned years before while, at the same time, announcing he was taking these measures in the name of the Emperor Charles V - who would never have actually supported a military action by a Reformed knight against a Catholic Archbishop. Sickingen counted on Luther’s support elsewhere in rallying a popular movement and that of the peasants of Trier who, he was sure, would open the gates upon his approach and so only brought enough gunpowder for his cannon for a week-long assault and does not seem to have thought he would even need that much.
The peasants of Trier, however, failed to mobilize as they knew Sickingen’s reputation of collecting ransoms in the name of the poor which no peasant ever saw and feeding his troops off crops they needed to pay taxes and tithes. Luther, while corresponding with Hutten and appreciative of the knights’ support, had already made clear to other correspondents that he was distancing himself from them as he did not want his movement involved in a military action that not only challenged secular authority but was not condoned by scripture.
Sickingen kept Trier under siege for a week before he ran out of gunpowder and, at the same time, received word that Elector Louis V, Count Palatine and Philip I of Hesse were coming to the aid of Greiffenklau and that the Imperial Council had condemned him for the attack. He withdrew to Ebernburg and then to Nanstein Castle in Landstuhl where he was confident his defenses would hold until Hutten could return from Switzerland with reinforcements, or his fellow knights could arrive.
When the armies of Greiffenklau, Louis V, and Philip I arrived at Nanstein in May 1523, however, they came armed with cannon which destroyed the castle’s defenses in a week of bombardment. Sickingen was mortally wounded, surrendered on 7 May, and died. Hutten, meanwhile, had met with Zwingli who had no more interest in supporting an armed uprising than Luther, and died of syphilis in Switzerland having failed to rally any support from anyone.
Trier Cathedral
Trier Cathedral
Berthold Werner (Public Domain)
The lesser nobles who had joined Sickingen’s Brotherly Convention of Knights were punished through the confiscation of their lands and family castles and were dominated by the higher nobility. To pay the various fees demanded, the lesser nobles raised taxes on the peasants who were already struggling, and, by the fall of 1524, tensions erupted in the German Peasants’ War which, by the time it concluded in 1525, had claimed at least 100,000 lives among the peasantry alone.
Luther had further distanced himself from Sickingen after Trier as he relied on the support of nobles like Philip I and Frederick III and, in 1525, called for the execution of any rebellious peasants, essentially placing Sickingen and Hutten in the same camp with the peasantry as rebels he had had nothing to do with even though both the peasants and the knights had been inspired by Luther’s movement. Sickingen and Hutten had been ardent supporters of his cause, the first nobles to openly advocate for him, as they had seen his efforts as coinciding with their own interests in social reform. Asch comments;
A strong anticlericalism and commitment to an overall reform of both church and empire importantly shaped Sickingen’s and Hutten’s allegiance in the debate about Luther. Yet both died before the impact of the Reformation became fully visible and their strong and outspoken support for Luther remained exceptional among members of the nobility during the early stages of the Reformation. (Rublack, 566)
Sickingen and Hutten believed that a German Church, founded on Luther’s vision, would encourage national unity but the Reformation in Germany splintered fairly quickly into sectarian divisions. Notable early supporters of Luther such as Andreas Karlstadt (l. 1486-1541) and Thomas Muntzer (l. c. 1489-1525) broke with Luther to establish their own reform movements. Muntzer even led peasant troops during the war, allying himself with the knight Florian Geyer (l. c. 1490-1525) and others who had also initially supported Luther’s cause. Even if the Knight’s Revolt had succeeded in taking Trier, therefore, it is unlikely Sickingen and Hutten would ever have been able to realize their goal of religious and social unity.
Did you like this definition?
Remove Ads
Questions & Answers
What was the Knights' Revolt?
The Knights' Revolt (1522-1523) was a military action taken in the Germanic region of the Holy Roman Empire to preserve the knightly class, unify Germany, and advance the cause of the Protestant Reformation.
Who were the leaders of the Knights' Revolt?
The Knights' Revolt was led by the imperial knight Franz von Sickingen and encouraged by the written works of the poet-knight Ulrich von Hutten.
Was the Knights' Revolt a success?
The Knights' Revolt was crushed in May 1523.
Why is the Knights' Revolt important?
The Knights' Revolt is important because it led to the German Peasants' War of 1524-1525 which killed at least 100,000 peasants. It was also the first military action encouraged by the Protestant Reformation.
Did Martin Luther support the Knights' Revolt?
Martin Luther did not support the Knights' Revolt. He distanced himself from its leaders and denounced rebellion against secular authorities as unbiblical.
What were the battles of the Knights' Revolt?
There were only two battles (engagements) during the Knights' Revolt: the siege of Trier in August 1522 and the siege of Nanstein Castle in May 1523.
About the Author
Joshua J. Mark
Free for the World, Supported by You
Become a Member
Recommended Books
Cite This Work
APA Style
Mark, J. J. (2022, April 27). Knights' Revolt. World History Encyclopedia. Retrieved from'_Revolt/
Chicago Style
Mark, Joshua J.. "Knights' Revolt." World History Encyclopedia. Last modified April 27, 2022.'_Revolt/.
MLA Style
Mark, Joshua J.. "Knights' Revolt." World History Encyclopedia. World History Encyclopedia, 27 Apr 2022. Web. 25 Sep 2022.
|
<urn:uuid:a03444be-9fa6-4b74-a703-44760943290c>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.02946460247039795,
"language": "en",
"language_score": 0.9750761985778809,
"url": "https://dev.worldhistory.org/Knights'_Revolt/"
}
|
Porosity in metals
Porosity is the formation of holes and channels in materials. Porosity is particularly found in castings. The small holes and channels are formed by gases which may evolve during the casting process. Porosity can affect the mechanical properties of the components. It can cause fractures and other defects.
Porosity is usually discovered when a casting is being machined. As layers of metal are removed, voids and channels will become obvious. Porosity can be classified into three main categories Gas Porosity caused by gas formation and trapped air during the casting process.
Flow Porosity caused by unequal pressure on the molten metal during the casting process which causes flow porosity Shrink Porosity caused by changes in volume as the metal solidifies. One technique of addressing porosity is by impregnating the pores with an inert material which can withstand high temperature and vibration.
|
<urn:uuid:699ee016-0f64-41ae-980d-3ae8510d3712>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.625,
"fasttext_score": 0.5919595956802368,
"language": "en",
"language_score": 0.9621583223342896,
"url": "https://www.electrotechnik.net/2017/10/porosity-in-metals_15.html"
}
|
Netsuke, Carved Bone, a Man Wearing a Hat Carrying a Flute, Japanese.
• $64.99 CAD
Netsuke did not originate as art but as a purely functional personal accessory. Until the 17th century, a netsuke, meaning “root which to attach,” was simply a small stone or piece of wood oriented over the obi, or belt, of a kimono with a cord attached from which hung a bag for carrying small possessions: usually tobacco and a pipe for men and medicine or coins for women. Netsuke emerged as an art form during the Edo era in Japan.
This era was ushered in by the victory of Tokugawa Ieyasu in the battle of Sekigahara in 1600, in which Ieyasu defeated his strongest rival warlords, and became Shogun over all Japan. Following his military success, Ieyasu consolidated power in Edo (modern Tokyo), and for 200 years no other faction seriously threatened this regime. The Edo era was a period of relative peace and prosperity in Japan after centuries of warfare and upheaval. This was a time of increasing commerce, literacy among the general populace, and the blossoming of theatre, music, dance, and many other art forms.
The Edo prosperity brought rapidly increasing wealth to merchants, long considered inferior to all other social classes in Japan. Confucian attitudes toward morality and relative social status as enforced by the shogunate, however, prohibited the outward display of wealth by merchants. Since the enforcers seldom paid much attention to netsuke, this inconspicuous device gradually became the object of increasingly elaborate decorations. Eventually, professional artisans took up the art of Netsuke carving from wood, ivory, and other materials.
Item Code - BON4B1800J1AHC
Width: 1 3/8" Height: 2 1/8" Depth: 1 1/8" Weight: 31 g
We Also Recommend
Sold Out
|
<urn:uuid:ed866468-9d2f-4bdb-b279-31b6bec74065>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.65625,
"fasttext_score": 0.018816769123077393,
"language": "en",
"language_score": 0.9582375884056091,
"url": "https://www.roadshowcollectibles.ca/products/netsuke-carved-bone-a-man-wearing-a-hat-carrying-a-flute-japanese"
}
|
How does a Linear Actuator work?
Linear actuators work by moving an object or piece of equipment in a straight line, moving an object extraordinarily accurately and repeatably if required. The first reason for designing a linear actuator into a system is for the necessity to move a payload in a linear fashion slightly than a rotary one. As most typical electric motors are rotary, a linear actuator is used to transform rotary motion to linear motion.
The electric motor is generally linked to the linear actuator by a versatile coupling or a belt, enabling the motor to be mounted either axially or perpendicular to the linear actuator. A wide range of motor sizes will be mounted to these actuators depending on requirements.
Linear actuators have incorporated linear bearings that help the moving payload, as well as rotary bearings that support either the lead screw, ball screw or belt pulleys. This then permits them to operate as ‘stand-alone’ units, making them simple to mount into present machines and eliminating the need to design/manufacture very costly custom parts. To extend the load capacity and stability of a linear actuator system, they can be paired up with the payload carried between them, equivalent to in an XY gantry model stage. In this case, a shaft or belt is often used to keep the two actuators in sync with every other.
Features of Linear Actuators
Linear Actuators have the next options:
High repeatability
Positioning accuracy
Easy operation
Lengthy life
Easy upkeep or upkeep free
Protection scores available for some models
Suitable for harsh environments
Compact design
Rugged and reliable
Safe operation
Industries and applications for Linear Actuators
Linear Actuators can be utilized in numerous applications that require a load to either be lifted, lowered, pushed, pulled, rotated or positioned. Linear Actuators are used in industries including:
Meals processing
Industrial vehicles
Factory automation
Materials handling
Clean energy
Machine instrument
Types of Linear Actuators
Picking the correct type of linear actuator on your motion application will help you achieve the perfect results. Lead Screw Actuators, Ball Screw Actuators and Belt Actuators are three types of linear actuators that can be used in numerous applications to produce motion.
A Lead Screw Actuator uses a plain screw/nut arrangement to translate the rotary motion from a motor to linear motion. A manually pushed screw or an AC induction motor are the most commonly used methods to provide the rotary motion, as they’re generally used in low price and low precision applications. The ability of the actuator to ‘back drive’ is reduced over ball screw actuators due to the low effectivity of the screw/nut. In some applications, this could be an advantage as it helps to keep the payload stationary whilst not in motion. Applications include agricultural equipment and handbook lift systems, where safety and reliability are more critical than precision and performance.
A Ball Screw Actuator makes use of a high precision nut with recirculating ball bearings that rotate round a ground screw thread. In precept this is similar to a standard ball race with the load being transmitted by the rolling balls. The significant advantages of this system are high-precision and low friction, giving a really efficient technique of changing rotary motion to linear motion. Stepper or servo motors are generally used to supply the rotary motion. Ball screw actuators are well suited to repeatable indexing and fast cyclic applications such as machine tools, scientific devices and medical systems.
Belt actuators work where a belt is carried between two pulleys and hooked up to the moving carriage, then because the belt rotates the carriage is pulled alongside the actuator. One of many pulleys is pushed by a motor which is generally mounted perpendicular to the actuator and coupled utilizing a flexible coupling. They provide a comparatively low-cost different, as they inherently have a decrease level of precision. Belt pushed linear actuators are excellent for lengthy travel and high linear velocity applications such as packaging and automated materials dealing with systems.
|
<urn:uuid:eb9655f8-920a-47a1-96f9-3428a7ef7f5a>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.65625,
"fasttext_score": 0.03343653678894043,
"language": "en",
"language_score": 0.9200359582901001,
"url": "https://www.africacorporationgroup.com/2022/08/03/how-does-a-linear-actuator-work-2/"
}
|
Primary Source: Account of the first contact of the Ho-Chunk (Winnebago)
European Exploration, Perception of the Other, and the Columbian Exchange
How did Europeans perceive the new people they encountered and how were they in turn perceived?
Jean Nicolet de Belleborne was an interpreter and explorer in French occupied Canada. In the early 1630s he was sent as a representative of French governor Samuel de Champlain to negotiate treaties and initiate fur trading with the Winnebago tribe in what is today the Green Bay area of Wisconsin.
Then the French landed their boats and came ashore and extended their hands to the Winnebago, and the Indians put tobacco in their hands. The French, of course, wanted to shake hands with the Indians. They did not know what tobacco was, and therefore did not know what to do with it. Some of the Winnebago poured tobacco on their heads, asking them for victory in war. The French tried to speak to them, but they could not, of course, make themselves understood. After a while they discovered that they were without tools, so they taught the Indians how to use an ax and chop a tree down. The Indians, however, were afraid of it, because they thought that the ax was holy. Then the French taught the Indians how to use guns, but they held aloof for a long time through fear, thinking that all these things were holy. Suddenly a Frenchman saw an old man smoking and poured water on him. They knew nothing about smoking or tobacco. After a while they got more accustomed to one another. The Indians learned how to shoot the guns and began trading objects for axes. They would give furs and things of that nature for the guns, knives, and axes of the whites. They still considered them holy, however. Finally they learned how to handle guns quite well and they liked them very much. They would even build fires at night so that they might try their guns, for they could not wait for the day, they were so impatient. When they were out of ammunition they would go to the traders and tell their people that they would soon return. By this time they had learned to make themselves understood by various signs.
Quiz Content
|
<urn:uuid:018d45a9-161c-4476-b6c8-8bed0d6e4d86>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.75,
"fasttext_score": 0.8623321056365967,
"language": "en",
"language_score": 0.990374743938446,
"url": "https://learninglink.oup.com/access/content/history-in-practice-western-civ/backman3e-student-resources-volume-1-chapter-14-section-2-primary-sources-3"
}
|
Oct 19, 2018
How your brain works when you're brave
A Human brain wearing a superhero cake.
Illustration: Sarah Grillo/Axios
Scientists have learned a lot about how our brains work in dangerous situations — and how they work in people who have learned to control their fears, the Wall Street Journal reports.
We might also be able to treat serious conditions like post-traumatic stress disorder.
How fear works, per the WSJ:
• A protein called stathmin — which works in the amygdala, an area deep the brain that produces fear and anxiety — seems to have an important role, since mice that were bred not to have it were more willing to explore their surroundings.
• There are also structures of the brain that help resist the cues from the amygdala.
• A hormone called oxytocin helps mothers overcome their fears when their children are in danger, according to a study of maternal instinct in mammals.
• People can be trained to control their fears, too. Military training helps, as the WSJ notes in the harrowing story of a British bomb disposal officer who stepped on an IED in Afghanistan and lost both of his legs.
One way the scientists can be so sure: They've scanned the brain of Alex Honnold, the guy who climbed El Capitan in Yosemite National Park without ropes. (He's featured in the documentary "Free Solo.") "When exposed to images that excite the amygdala in most people, his brain scans showed no response," per the WSJ.
The bottom line: There's no clear roadmap or timetable for when science will allow us to control these factors. But now that we're getting such a clear idea of how it works, it's probably just a matter of time.
Go deeper
|
<urn:uuid:f208f43e-32f6-4e72-bfee-ab8e716b8cec>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.06707358360290527,
"language": "en",
"language_score": 0.9610170125961304,
"url": "https://www.axios.com/2018/10/19/how-your-brain-works-when-youre-brave"
}
|
Depletion Region in the PN junction
When a P type material and a N type material are brought in contact with each other, some of the holes in the P material migrate to the N region and combine with electrons. Similarly, some of the electrons of N material migrate to the P region and combine with holes.
Thus, at the point of contact of the P and N materials, a layer is formed which has no majority charge carriers such as holes or electrons. This region is called the depletion region as the region has been depleted of its charge carriers.
The depletion region behaves almost like an insulator. When a voltage exceeding the barrier potential is applied across the PN junction, current starts to flow.
|
<urn:uuid:14f9f96e-90fd-4866-9606-c92bf19889a9>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.21361851692199707,
"language": "en",
"language_score": 0.9281144142150879,
"url": "https://www.electrotechnik.net/2015/09/depletion-region-in-pn-junction_29.html"
}
|
Key Stage
Type of Activity
Type of Session
When molten rock (magma) is underground it often has lots of gases dissolved in it, just like liquid coke is full of dissolved carbon dioxide gas. As magma rises closer to the surface the gas starts to escape (exsolves) from the magma, but what happens then?
In this experiment you can use coke to represent magma under a volcano and see what happens when all the dissolved gas is released!
Download the instructions and information sheet
|
<urn:uuid:a6ecc4f7-34ca-440e-a31d-18bb3e50980d>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.609375,
"fasttext_score": 0.9937475919723511,
"language": "en",
"language_score": 0.9058980941772461,
"url": "https://museums.cam.ac.uk/index.php/school-sessions/coke-volcano"
}
|
The world of economics is full of complex terms like monopoly, oligopoly, oligopsony and duopoly. In this article we are going to explain to you in an easy way what an oligopoly is, what its exact definition is and we will show you some examples so that you can see it in a practical way.
What is an oligopoly?
The term oligopoly is a very common concept in microeconomics . It derives from the Greek and its structure is divided into oligo- (few) and -polio (sell).
From this it follows that an oligopoly is an economic market that is under the control of a small number of sellers, regardless of the good to which they refer.
That is, we can be talking about amarket for material goods such as cars, or a market for services , such as hotels (although this difference is theoretical, since practically the services sector needs goods and vice versa).
The exact definition of what oligopoly means is obtained from the Royal Academy of Language: Concentration of the supply of an industrial or commercial sector in a small number of companies.
At an economic level, it is usually established that to be defined as an oligopoly, the companies that compose it must have control of at least 70% of the market.
Characteristics of an oligopoly
The most interesting thing about this concept are the repercussions that its establishment (as a mercantile system) has on society. Anyway, let’s see all the characteristics of oligopolies.
1. Knowledge of competitors
When a market is dominated by a small group of vendors (or people who offer services) they all know each other . Those involved know at all times against whom they compete, with whom they can ally and what is the exact situation of the rest of the companies.
2. Large capital
All companies in an oligopoly have a large amount of economic and material resources . Otherwise, it is almost impossible to remain and compete in a market system of these characteristics.
3. Greater influence
Since the oligopolistic market (national or international) is completely flooded by a small group of companies, the actions they carry out have a more direct impact . For example, if one lowers prices, automatically all the others must do something (lower prices in general).
This means that the market, if it is not well structured and consolidated, can wobble quite easily, as if it were a table with X number of legs. The fewer legs there are, the more that stability depends on the remaining legs.
4. Diminished competition
Since the oligopolistic system involves a small group of firms, and firms intrinsically tend to be in an equilibrium position, there comes a time (in fact, it is not long in coming) when a situation of non-rivalry is created. .
When the companies that make up the sector have shared “the cake” explicitly or implicitly, they make sure to maximize their profits but without harming each other with the aim that everyone continues to win and maintain their positions.
Negative effects
There are a series of negative effects (which could also be considered characteristics) that follow from oligopolies and that need to be commented on.
1. Impossibility of joining the oligopoly
As a consequence of the above, if a new seller tries to join the oligopoly system, the companies that are already in it will hinder or completely prevent their participation .
Existing companies do not want to have to incorporate new “competitors” with whom they can share “the cake” again and jeopardize the balance that had been achieved.
2. Non-competent companies
In reality, what hides non-competitiveness between companies is the absence of a good company capable of competing with the rest.
Simply stated, an economic system that is oligopolistic is a system where none of the sellers is good enough to appeal to all consumers.(or a majority). That is, there are no companies that offer high quality services or goods at competitive prices.
3. Higher prices
If there is no competition between companies, the immediate result is that prices rise on products that are not even of high quality .
4. Less quantity of production
In addition, the quantity of production in an oligopoly also suffers and companies produce the minimum necessary since they do not have a need to monopolize the market, offering in turn a smaller variety of products/services.
5. Low levels of quality
Finally, also the result of the low competitiveness of the companies that make up the oligopoly,There is no need to increase the quality of the products , so it ends up cutting production costs and thus quality.
Examples of oligopolies
These are the most famous oligopolies that you probably know.
1. Coca Cola and Pepsi
The best known example is undoubtedly the best. Two companies control the world market for soft drinks , specifically cola-flavored drinks.
2. Airlines
There are more than two airlines, but even so, they are not many. However, they move an immense amount of capital and choose the prices they offer with some freedom, regardless of the social demand there is.
Also, you should not get confused, although there are airlines with different names,many of them belong to the same owner.
3. P&G and Unilever
It is very possible that you do not know either of them, but you buy their products almost daily since between them they have the “monopoly” of the brands on home, personal and animal care, beverages and food .
Both companies, as if that were not enough, belong to the group of so-called “billion dollar brands”. That is, companies that have brands with which they invoice more than 1,000,000,000 dollars a year.
The first, P&G , owns brands (it has more than 75 brands) such as Gillette, Tampax, Fairy, Ariel, Oral-B, Gucci or Lacoste (perfumes), Duracell, Max Factor and endless other products.
Second, Unilever, owns brands (more than 30 in total) such as Mimosin, Frigo, Calve, Tulipan, Ben & Jerry’s, TRESemme, Dove, Rexona, Lipton…
Difference between oligopoly and monopoly
We have already understood what an oligopoly is and it is likely that The first thing that comes to mind is another similar concept: monopoly.
The difference between monopoly and oligopoly is simple, while in an oligopoly system there is a small group of companies that handle a large part of the market, in a monopoly system, there is only one company .
Bayer, RC (2010). Intertemporal price discrimination and competition. Journal of economic behavior & organization.
Vives, X. (1999). Oligopoly pricing, MIT Press, Cambridge MA. (A comprehensive work on oligopoly theory).
Dixon, H. (2001). Surfing Economics. Essays for the inquiring economist.
|
<urn:uuid:f0a8e97e-275b-4764-99d5-92d57fb36640>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.0625,
"fasttext_score": 0.6754449009895325,
"language": "en",
"language_score": 0.9539497494697571,
"url": "https://www.wooinfo.com/%E2%96%B7-oligopoly-what-is-it-definition-and-examples/"
}
|
Skip to main content
The Works Progress Administration (WPA) was an ambitious employment and infrastructure program created by President Franklin Roosevelt in 1935, during the bleakest days of the Great Depression. Over its eight years of existence, the WPA put roughly 8.5 million Americans to work building schools, hospitals, roads and other public works. Perhaps best known for its public works projects, the WPA also sponsored projects in the arts—the agency employed tens of thousands of actors, musicians, writers and other artists.
WATCH: America: The Story of Us on HISTORY Vault
What Was the WPA?
President Franklin D. Roosevelt created the WPA with an executive order on May 6, 1935. It was part of his New Deal plan to lift the country out of the Great Depression by reforming the financial system and restoring the economy to pre-Depression levels.
The unemployment rate in 1935 was at a staggering 20 percent. The WPA was designed to provide relief for the unemployed by providing jobs and income for millions of Americans. At its height in late 1938, more than 3.3 million Americans worked for the WPA.
The WPA—which in 1939 was renamed the Work Projects Administration—employed mostly unskilled men to carry out public works infrastructure projects. They built more than 4,000 new school buildings, erected 130 new hospitals, laid roughly 9,000 miles of storm drains and sewer lines, built 29,000 new bridges, constructed 150 new airfields, paved or repaired 280,000 miles of roads and planted 24 million trees to alleviate loss of topsoil during the Dust Bowl.
WATCH: How the Great Depression Brought on Social Security
Federal Project Number One
In addition to its well-known building and infrastructure projects, the WPA also oversaw a group of programs collectively known as Federal Project Number One. These programs employed artists, musicians, actors and writers.
Roosevelt intended Federal One (as it was known) to put artists back to work while entertaining and inspiring the larger population by creating a hopeful view of life amidst the economic turmoil.
Artists created motivational posters and painted murals of U.S. national parks and “American scenes” in public buildings. Sculptors created monuments, and actors and musicians were paid to perform.
Federal One also established more than 100 community art centers throughout the country.
First Lady Eleanor Roosevelt lobbied FDR to sign the executive order establishing Federal One. She later praised the project in columns and speeches and defended it against critics who saw the arts as a waste of money.
But Federal One comprised a small part of WPA expenditures: Roughly $27 million of the nearly $5 billion that had been earmarked for WPA work programs went to the arts. The WPA arts programs led to the later creation of the National Foundation of the Arts.
Notable WPA Artists
At its height, Federal One employed 5,300 visual artists and related professionals. Some of them later became world-renowned.
Before his art could earn him income, American painter Jackson Pollock worked for the WPA’s Federal Arts Project, a component of Federal One. He worked as a mural assistant and later an easel painter between 1938 and 1942. After World War II, Pollock became a major figure in the abstract expressionism movement.
In addition to Pollock, the WPA employed a number of other abstract and experimental artists that would go on to form the New York School, an avant-garde art movement of the 1950s and 1960s. That group included renowned artists such as Mark Rothko, Willem de Kooning and Lee Krasner.
Scroll to Continue
Recommended for you
Holger Cahill, a former director of the Museum of Modern Art in New York City, was the national director of the Federal Arts Project throughout its duration.
WATCH: How Artists Helped End the Great Depression
WPA Architecture
The architecture of many U.S. buildings constructed as part of Great Depression relief projects is often referred to as “PWA Moderne” (for Public Works Administration, another New Deal program) or “Depression Moderne.” The style blended neoclassical and Art Deco elements.
Notable examples include the Hoover Dam, the John Adams Building of the Library of Congress in Washington, D.C. and the San Francisco Mint.
African Americans and Women in the WPA
When FDR took office in 1933, he promised a “New Deal” for everyone. That included women, African Americans and other groups.
While inequities existed under the programs, many women, African Americans and other marginalized groups found employment with the WPA. In 1935, the WPA employed approximately 350,000 Black Americans, about 15 percent of its total workforce. The Federal Music and Theatre projects also supported Black musicians and actors.
The WPA made significant contributions to the preservation of Black culture and history with the Federal Writers’ Project. The program collected interviews, articles and notes on Black American life in the South, including oral histories from people who were formerly enslaved.
The WPA put women to work in clerical jobs, gardening, canning and as librarians and seamstresses. Women engaged in sewing projects made up about seven percent of the national WPA workforce.
Criticism of the WPA
A Gallup poll in 1939 asked Americans what they liked best and worst about FDR’s New Deal. The answer to both questions was “the WPA.”
Some politicians criticized the WPA for its inefficiencies. WPA construction projects sometimes ran three to four times the cost of private work. Some of this was intentional. The WPA avoided cost-saving technologies and machinery in order to hire more workers.
Nonetheless, unions protested the WPA for its refusal to pay wages as high as those in the private sector.
WPA arts programs drew frequent criticism from Congress and the lay public. “Boondoggling” entered the American lexicon as a term to describe these and other government projects that critics deemed wasteful or pointless.
WPA Legacy
Despite these attacks, the WPA is celebrated today for the employment it offered to millions during the darkest days of the Great Depression, and for its lasting legacy of smartly designed, well-built schools, dams, roads, bridges and other buildings and structures—many of which are still in active use across the United States.
As weapons production for World War II began ramping up and unemployment dropped, the federal government decided a national relief program was no longer needed. The WPA shut down in June of 1943. By that time, unemployment was less than two percent as many Americans transitioned to work in the armed services and defense industries.
The Lasting Values of the WPA: The Social Welfare History Project, Virginia Commonwealth University Libraries.
TAG Archives: WPA Women: The Living New Deal.
1934: The Art of the New Deal:
Federal Cultural Programs of the 1930’s: Webster’s World of Cultural Democracy.
Great Depression program still benefiting Americans today: Pittsburgh Post-Gazette.
|
<urn:uuid:e36e6e48-696d-4945-96cd-27105b2d0f6e>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.734375,
"fasttext_score": 0.021473348140716553,
"language": "en",
"language_score": 0.9588515162467957,
"url": "https://history.com/topics/great-depression/works-progress-administration"
}
|
As soon as it was shown that thunderstorms were due to electricity, it became obvious for many physicists that earthquakes, which, as Pliny said, were subterranean thunderstorms, must be electrical phenomena. Despite some opposition, the ‘system of electricity’ became the fashionable theory of earthquakes, in the second half of the 18th century. Its proponents insisted on the idea that only electrical discharges could explain that earthquake shocks propagated instantaneously over large distances. A majority of the Italian philosophers attributed the disastrous 1783 Calabrian earthquake to electricity. When electrostatic machines and Leiden jars gave way to Voltaic piles, in the beginning of the 19th century, the ‘system of electricity’ rapidly disappeared.
This content is only available as a PDF.
You do not currently have access to this content.
|
<urn:uuid:027bd86e-da4e-4509-9cf5-2da0f2011048>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.84375,
"fasttext_score": 0.7772704362869263,
"language": "en",
"language_score": 0.9746198058128357,
"url": "https://meridian.allenpress.com/esh/article-abstract/35/2/283/205050/Electrical-earthquakes-A-short-lived-theory-in-the"
}
|
--> Skip to main content
Mudradhyaksha – Official In Ancient India
Mudradhyaksha was a state official in ancient Indian polity. He is the superintendent of the department authorized to issue licenses to travel for trade and grant permission for foreigners to enter and live in a city. The word mudra means seal, stamp or coin for fiscal exchange. The term is first mentioned in Arthashastra of Kautilya.
In Arthasastra, the function of a mudradhyaksha is to examine goods that come and go from the palace and to stamp them with a seal. The caravan of merchants who bring goods from outside have to see permission for trade, have an identity pass and a seal on the goods from him. The stamp was used on the collection of duties, to identify authorized traders and the quality of goods.
The office of Mudradhyaksha was maintained at the gates of the fortified or walled cities, sanctuaries and temples, where valuables and money were safely kept in bags and sealed for visitors and monks. Mudradhyaksha accorded permission to people to move at night in an emergency, called by factors such as death, illness, childbirth, and outbreak of fire, or at the call of the authorities.
The Bagh Cave plate inscription indicates that the functions of a Mudradhyaksha, including the issuing of passports for egress or ingress, were performed by an officer called gamagamika in the 5th-6th centuries CE. Visakhadatta based the theme of his play Mudrarakshasa on the importance of the use of Rakshasa’s seal, who was the minister of a Nanda king. The play was written in the latter half of the 6th century CE.
|
<urn:uuid:e18fcca9-23c9-4e48-ac95-377ebeaef0ce>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.03975534439086914,
"language": "en",
"language_score": 0.980374276638031,
"url": "https://www.hindu-blog.com/2022/07/mudradhyaksha-official-in-ancient-india.html"
}
|
Scientists are striving to comprehend where the unique flavors of chocolate originate in order to more accurately reproduce them. A significant amount of the chocolate we eat is made from a combination of cacao from several farms, regions, or even countries. Luisa Vicinanza-Bedi, a Nottingham-based artisan chocolatier, claims that the flavor of the chocolate is unique due to the use of a single bean variety from a single farm. They conduct direct business with their farmers and inspect the beans. They do a pilot line test, a cut test, a weight test, a moisture analysis, and several other tests. To get the most out of each harvest and produce consistently high quality, Prof. Irene Chetschik, leader of the Research Group for Food Chemistry at Zurich University of Applied Sciences (ZHAW), is inventing new technical techniques that can affect the cocoa flavor at the molecular level.
At the University of Nottingham, Dr. David Goupaulchan, an international research fellow, has been studying the bacteria that are present during fermentation, how their development dynamics are influenced by their environment, and how they help flavors to emerge. He emphasized how important fermentation was to the taste and quality of chocolate. A better understanding of the procedure would lead to better quality chocolate for consumers and higher pricing for farmers.
|
<urn:uuid:53a705ee-aa94-4cb9-bb18-ec4efc722753>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.23989009857177734,
"language": "en",
"language_score": 0.9519627094268799,
"url": "https://news.weblioph.com/2022/07/27/science-makes-chocolate-taste-even-better-intermediate/"
}
|
What is relation? Explain equivalence relation with the help of an example?
Relation -Sometimes we need to establish relation s between two or more sets. For example, a software development company has a set of specialists in different technology domains, or a company gets some projects to develop. Here the company needs to establish a relation between professionals and the project in which they will participate. To solve this type of problem the following concepts are required.
Cartesian product
Very often we deal with several sets at a time, and we need to study their combined action. For instance, combinations of a set of teachers and a set of students. In such a situation we can take a product of these sets to handle them simultaneously. To
You may also like...
Leave a Reply
error: Content is protected !!
|
<urn:uuid:83d369b6-83d6-437e-8414-865471beff14>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.39995402097702026,
"language": "en",
"language_score": 0.9527283310890198,
"url": "https://www.guffo.in/relation/"
}
|
Selected Passages from Hungarian-Ottoman Wars
The Hussars ambush the fair of Hatvan in 1580
The “Small War” on the Borderland
Military actions between the Ottoman Empire and the Kingdom of Hungary have been going on since the first decades of the 15th century until at least 1699. The 1,000-mile-long and 10-100-mile-wide Borderland was a perfect place for ambushes, raids, and hit-and-run actions: it was the cradle where the Hussar cavalry was born.
Hungarian hussar, 16th century
As for the Ottomans, their military strategy was to “soften up” the enemy’s lands as far as they could: they destroyed the villages that were supporting the Hungarian and Croatian castles with food and spread terror deep behind the Borderland, too. It was the way of life between the “official wars” and this “small war” was considered normal unless artillery and siege engines were applied.
a high-ranking Ottoman officer
However, the quick Ottoman units were received by Hungarian warriors who had once been horse-archers themselves and hadn’t forgotten all of their horsemanship just yet. The Hungarians’ military success in Central Europe derived from the flexible use of both Western and Eastern warfare. They were faster than western cavalry but heavier than eastern riders. Read more about these horses here:
The Borderland was made up of a chain of castles and fortified places where the rate of Hussar cavalry and infantry was 1:1. The Turks could be beaten only by endless counter-raids and ambushes, long patrols deep behind the “Turk” lines, plundering lands that were actually inhabited still by Christian Hungarians or Slavs. As the contemporary saying went, “the castle can be defended only in the field” which meant aggressive warfare.
Red line: the Borderland after 1541
The problem was always the money, of course. While the Imperial western mercenaries were more or less regularly paid (and their pay was twice higher than the local soldiers’), the castle warriors and Hussars received their pay (or just a fragment of it) just months or even years later. They either starved and sold their weapons or took up jobs, cultivated a vinery or the lands. However, many decided not to work as it was “below them” and they were raiding the countryside, in better cases the enemy’s lands (which were inhabited by Christians, anyway).
The gold minted by King Louis II in 1517
The Borderland warriors considered themselves members of the Valiant Order and they had a certain unwritten code of honor that stopped them from selling their swords to the enemy, though. Ransoming high-ranking Ottoman officers was a major income, the source of survival in many cases. It was why there were so many duels, too. Capturing the Ottomans’ tax collectors who mainly belonged to the members of the Jewish community was also an effective way of making money.
Gold coin of Sultan Suleiman, 1520
However, perhaps the best business was the “hitting of a fair”. Fairs were regularly held in those Hungarian agricultural towns which were the centers of the surrounding areas. Plenty of animals were herded to these fairs and merchants arrived with hundreds of wagonloads of products. No wonder, that they were heavily guarded by the Turks. To them, a fair was an ideal place where they were able to collect their taxes. Hatvan was such a town like this; you can read more about this fortified Borderland town that happened to belong to the Ottomans in 1580:
The ambush of Hatvan on 21 April 1580
The endeavor seemed to have been organized well by the Hungarian Borderland warrior. It must have been kept in deep secret, unlike many similar actions. Also, the enemy’s attention had to be distracted. During the middle of April, the riders of Nádasdy Ferenc were raiding the area of Esztergom while the Hussars of Kanizsa castle were doing the same at Berzence castle. The cavalrymen of Upper Hungary were spreading havoc around Kékkő castle. Here is more about Kékkő castle, the ancient nest of the Balassi family:
Kékkő castle (Photo: Civertan)
The soldiers who attacked Hatvan were coming from the Hungarian Borderland castles of Eger, Diósgyőr, Tokaj, Cserépvár, and other castles in the area. We are lucky that the story of the case was written in the “Historia cladis Turcicae ad Nadudvar” which was a contemporary poetic work. Thus we know that Captain Karl Rueber of Tokaj castle (and not his elder brother, Captain Hans Rueber of Kassa castle) and the Hungarian warrior-poet, Balassi Bálint were involved, too. Balassi used to be a cavalry lieutenant from Eger castle at this time.
Balassi Bálint
The ambush was carried out just perfectly. The Hungarian cavalry and the yellow-coated German heavy cavalry managed to surprise the Ottomans who at first thought that it was just an attack of stray Hajdú soldiers. Well, it wasn’t. However, the Ottomans soon recovered from the initial shock and sallied from the town. When they were all out, they realized that the peril was even greater because many thousands of Borderland soldiers were facing them. They turned tail but they couldn’t close the gates behind them. The Christian riders were intruding into Hatvan city literally on their back. The German and Hungarian riders made a huge slaughter among the Jannisaries, Beslias, and the irregular marauders.
a Hungarian Hussar
According to the poem “Great many Turk peasants were slain as if in piles / as much as the corpses were reaching each other”
The slaughter continued in the streets, then the attackers began to plunder. Even Lord Balassa’s role was mentioned who, unlike a poet: “Valiant Balassa, with his footmen and horsemen /, was breaking up houses and money-stores / capturing children, toddlers / and many Turks were tied by their necks”
Hajdú soldiers plunder the peasants
The Christians took lots of booties, including many captives, and lots of “chief Turks”. The ad-hoc market called “kótyavetye” where they sold their booty was held in Eger. This was mentioned in the Chronicles of Szamosközy István, too. This raid was an unheard-of scandal for the Turks and it has brought about the fall of the Pasha of Buda, Kara Üvejsz who protested against the “breaking of the Truce” in vain. He was removed in May 1580. His successor, Ali Kalajlikosz could not arrive at Buda before the summer, though. It was when Bey Sásvár of Szolnok castle appeared on the scene, a renegade: read more about his outstanding life here:
Bey Sásvár had a big role in removing Pasha Üvejsz and it was Sásvár who acted as a caimacam, the substitute of the pasha, who was directing the Vilayet of Buda until Ali has arrived. Sásvár had been aspiring for the position of the pasha in secret, though.
Bey Sásvár wanted to take revenge for the raid of Hatvan so he set out with a combined army of several Ottoman Sanjak districts and he was pillaging the area of Eger. He took lots of locals to the slave market. We know that he raided the village of Maklár where they killed the Reformed pastor and the schoolmaster on 20 June 1580. However, his revenge was stopped on 16 July by the Hungarian Hussars who severely defeated him at Nádudvar. It is not known whether his captives were freed or not.
Ottoman Sipahies
Source: Szibler Gábor
|
<urn:uuid:85af555b-9245-4118-8b09-065f6c564ea0>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.16076964139938354,
"language": "en",
"language_score": 0.986653208732605,
"url": "https://www.hungarianottomanwars.com/1541-1699/the-hussars-ambush-the-fair-of-hatvan-in-1580/"
}
|
Horned Lizard
Scientific Classification
Kingdom: Animalia
Phylum: Chordata
Subphylum: Vertebrata
Class: Reptilia
Order: Squamata
Suborder: Lacertilia
Family: Phrynosomatide
Genus: Phrynosoma
The horned lizard, belonging to the lizard family Phrynosomatidae, genus Phrynosoma is a well known lizard known by the names “horned frog”, “horny toad”, or “horned toad”, but it is neither a frog nor a toad. The well known names are a derivation from the blunt snout and the rounded body of the lizard, by which it resembles a frog or toad. (“Phrynosoma” actually means “toad-bodied”).
Horned Lizards
The various varieties of the horned lizards belonging to the genus Phrynosoma have flattened and a very broad body similar to a toad. It has a short tail that broadens at the base. In most of them, the temples and head have a crown with an outstanding row of sharp and pointed horns. The sides and the tail have fringes of sharp spines and some varieties sport decorated with double fringed spines. On their back they have, laterally arranged short spines in a conical shape. The pointed horns jutting out over their prominent eyes gives an awfully frightful appearance.
READ MORE: Skink Lizard
Camouflaging comes easily to these horned lizards. When attacked, their initial defense measure is to remain motionless to avoid attention. When you reach close to them, they normally run in small bursts, thus deviating the attention of the predator. In case they fail, they will bloat up their bodies to look larger with more horn, making it difficult for the predator to swallow. There are four species which squirt and shoots a stream of blood from the corner of their eyes up to a distance of five feet. This is done by stopping the flow of blood to the head and increasing the blood pressure, thus bursting tiny blood vessels around the eyelid.
Horned lizards occur specifically in Mexico and the western provinces of the United States. 14 varieties of them exist. Their habitat ranges from the British Columbia south of Guatemala and from the Arkansas to the coasts of the Pacific Ocean. You find these lizards in places where it is sandy, dry and hot. A few of the desert horned lizard species dwell in the desert regions where the heat of the sun strikes on the dry site producing heat from the ground that is nearly intolerable to human beings. The remaining go into the mountainous regions and you can see them at a height of 10,000 feet.
READ MORE: Red Ackie Monitor
As a pet
Horned Lizard
Horned Lizard
Simulating the home climate in outdoor cages is in many ways better for the horned lizards. For many reasons, the natural geographical environment is insufficient with respect to the climate and intensity of sunlight, whereas, in an enclosed environment, this is possible with a UV or you can offer basking temperature by artificial heating or lighting arrangement in the terrarium. Otherwise, a complete interior structural arrangement is necessary.
The normal size of an aquarium placed indoors is 40 gallons. Do not place more than two lizards in the enclosure of a size less than 40 gallons; a 40 gallon tank is ideal only for a pair. The bigger the tank better the comfort and the environment for the horned lizard. Horned lizards require enough space to run about and replicate their natural dwelling.
Horned lizards burrow. The lizards dig their way through the powdered walnut shells to their satisfaction and this substrate is cheaper than sand.
READ MORE: Small Lizards
Harvester ants are the favorite food of these horned lizards. They also consume crickets that unsuspectingly walk towards them. By all means provide calcium/vitamin supplements. In case you come across an ant hill attempt giving them a few local ants. Make certain that in case you feed them insects like mealworms, crickets, etc. they are the tiniest in size. The jaws of the horned lizards are not strong enough and they habituate to predate on small prey which they raise with their tongue, like ants. When you offer harvester ants give them only a little at a time. If the numbers of the ants are many, they may become violent and hurt the lizard.
Handling horned lizards develops stress in them. Even though they dislike handling, they just tolerate it. When you touch them you see them raising the horns on their head as a protectionist reaction. Most of the people take a fancy to stroking the head of the lizard and enjoy the sight of them closing their eyes and ducking their heads, as how a dog reacts when you pet it.. But this is a different case, it is a posture of defense to evade a known predator.
Leave a Comment
|
<urn:uuid:f9a3f14a-c897-4168-b420-99fbdb5d9a7f>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.1467408537864685,
"language": "en",
"language_score": 0.9255883097648621,
"url": "https://www.learnaboutnature.com/reptiles/lizards/horned-lizard/"
}
|
The adjective homogeneous means a group or thing which has members or parts that are all the same.
Synonyms are similar, alike, comparable, or equal.
The word origins from Medieval Latin (1640s) homogeneus, from Greek homogenes meaning “of the same kind”. It comes from homos meaning “same” plus genos meaning “kind, gender, race, stock”.
Typically, the company workers feel more comfortable working with a homogeneous group.
Those young people are not a homogeneous group.
Don’t treat women as homogeneous.
|
<urn:uuid:59bb17af-d7d5-4771-b8a5-87bb884ae1d3>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.11638903617858887,
"language": "en",
"language_score": 0.9141784906387329,
"url": "https://newwordday.com/homogeneous/"
}
|
Korean History: The Han River Bridge
han river bridge blown up
Words by Robert Neff
Two days after the Korean War began, a disastrous decision to blow up the Han River Bridge resulted in the loss of hundreds of lives.
For many people, June 25th, 1950, started out as a dreary Sunday morning, a time for relaxation and worship, but before the morning was over Korea was at war. This war would eventually involve people from twenty nations (including North and South Koreans) and would result in civilian and military casualties numbering in the millions.
Many of the casualties were caused by desperate measures—perhaps one of the most notorious of these was the destruction of the Han River Bridge. The North Korean attack had completely surprised the unprepared South Korean military, and the Communist forces quickly advanced toward Seoul. The South Korean government evacuated Seoul on June 27th and on the following day ordered the Han River Bridge to be destroyed so as to hamper the North Korean advance.
Blowing up the Han River Bridge
Except for small ferries, the bridge had provided the only means of crossing the Han River. Thousands of people—men, women and children—crowded the bridge with all their worldly belongings in carts or in bags on their backs in a desperate attempt to escape the fighting. Hundreds of them were killed when the bridge, without warning, was destroyed.
An American war correspondent who survived the explosion described what it was like:
Lit only by the glow of the burning truck and occasional headlights, [it] was apocalyptic in frightfulness. All of the soldiers in the truck ahead of us had been killed. Bodies of the dead and dying were strewn over the bridge, civilians as well as soldiers. Confusion was complete. With the cries of the wounded and the dying forming the background, scores of refugees were running pell-mell off the bridge and disappearing into the night beyond.
Digital Marketing Agency
It was a horrible tragedy and one that someone had to be held responsible for. Col. Choe Jang-sik, the engineer in charge of the bridge, was executed by firing squad two months later for his role in the debacle. Unfortunately, Choe was nothing more than a scapegoat and had actually been responsible for saving lives by trying to clear the bridge before it was destroyed.
And while the destruction of the bridge may have hampered the North Korean advance, it did not stop it. The North Korean tanks were able to use the adjacent railroad bridge that had somehow been overlooked. It was one of the few things that escaped destruction.
A country destroyed by the Korean War
Photographs from this period demonstrate just how much of the country was destroyed. Not only the infrastructure, buildings and farms were destroyed, but so too were families. Children lost their parents either through death or separation and were forced to fend for themselves on the streets. Some were lucky enough to be taken in and adopted, but many were not. Starvation ruled, and if not for the efforts of the UN many people would have perished for want of food. Even after the war, it was not uncommon to see people digging through the trash.
It wasn’t until July 27th, 1953, that the Armistice Agreement was signed, ending the fighting, but not the war. As no peace treaty has been signed, the two Koreas are still technically at war, and the recent sinking of the South Korean warship Cheonan (2010) and the unprovoked attacks on Yeonpyeong Island (2010) only serve to reinforce this point.
To read more about the Han River throughout history, check this out.
|
<urn:uuid:1552faec-2e7e-42f0-b5b0-e135211167db>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.640625,
"fasttext_score": 0.09478789567947388,
"language": "en",
"language_score": 0.986553966999054,
"url": "https://10mag.com/history-han-river-bridge/"
}
|
Posada’s creation is icon of modern Mexico
Mexicans have a different understanding of death than is found in the US
With Christian religions, there’s an emphasis on what one does in life to deserve the reward of an afterlife.
In Mexico, death is just another part of existence — the next step. Therefore, skulls and skeletons are not scary. They are a symbol of death, but death is not something to fear.
Posada used the calaveras to symbolize the entirety of Mexican society, no matter if one was indigenous or mestizo (mixed race). The skeleton has no skin tone; therefore, one cannot be judged on the surface appearance. Underneath, everyone is the same.
The rule of Mexican president Porfirio Diaz saw a concentration of wealth in the hands of a ruling elite which led to the 1910 rebellion that kicked off the Mexican Revolution. The wealthy few were obsessed with all things European, and this led to Posada’s most iconic illustration. “La Calavera Catrina” was first published in 1910 and satirized high-society with the skeleton wearing an extravagant European-style feathered hat. Posada’s original title was “La Calavera Garbancera,” a term for native Mexicans who rejected their Indian heritage by dressing and wearing light makeup to pass as European.
Posada was born in the central Mexican city of Aguascalientes on Feb. 2, 1852. At the age of 15, he was an apprentice at Jose Trinidad Pedroza’s print shop, where he learned lithography and engraving. Pedroza published El Jicote (The Wasp), a critical newspaper, and Posada contributed political cartoons.
Possibly fearing retribution, Pedroza moved to León, Guanajuato in 1872 and Posada joined him within the year with the pair running a print shop. In 1873, Pedroza returned to Aguascalientes, leaving Posada in charge. He remained in Leon for the next 16 years, producing art for advertising, posters, fliers, books and religious images. Some of his best work from that period is found in the book, “Moral Practica.”
Following a flood that damaged his workshop, Posada moved to Mexico City in 1888, where he opened a workshop on Calle Cerrada de Santa Teresa. In the next year Posada began working for publications produced by Antonio Vanegas Arroyo. Mexico City’s population was 350,000 with 80% of them illiterate, which meant Posada’s illustrations were key to communicating ideas.
Vanegas Arroyos hired Posada as his chief illustrator whose work could accompany the texts to communicate the ideas regardless of literacy. Posada’s images of folk heroes and politicians, crimes and disasters supported the stories and often stood alone.
Diego Rivera, arguably Mexico’s greatest artist, visited Posada’s workshop when he was a young boy and considered him a mentor.
In the book, “José Guadalupe Posada in the Eyes of Diego Rivera,” produced by Rivera’s daughter, Guadalupe Rivera Marín, Rivera states, “Posada had no place in the official art circles of Mexico, and he was not concerned about his immortality. He was sure he had found a place from which the most respected artists of his time had disappeared, and even been forgotten. He knew more about form and movement than any artist I have known. It was he who revealed to me the inherent beauty of the Mexican people, their struggle and their aspirations, and it was he who taught me the supreme lesson of all the arts: nothing can be expressed except through the force of feeling. Hence, the soul of all masterpieces is powerful emotion.”
Posada produced more than 15,000 illustrations during his lifetime but died, relatively unknown, of alcoholism and was buried in an unmarked grave in Mexico City’s Dolores Cemetery.
In 1948, Diego Rivera immortalized Posada in the mural “Dream of a Sunday Afternoon in Alameda Park,” which depicted 400 years of Mexican history.
The central figure is La Calaveras Catrina. Rivera has taken Posada’s image, which was originally just head and shoulders, and created a full figure in a long dress with the feathered serpent Quetzalcoatl, an Aztec deity, hung around her shoulders like a boa.
Rivera has painted himself as a young boy and he holds her right hand. Her left arm holds the arm of her creator, Posada.By putting La Catrina at the forefront of history, Rivera has elevated Posada’s position in the culture, ensuring his legacy.
Nowadays, La Catrina is ubiquitous and has been appropriated as a symbol of the spirit of Mexico, a turnaround from Posada’s original intent. But as she has taken her place at the forefront of Mexican culture, so Posada’s legacy as the first modern Mexican master is etched in history.
Leave a Reply
Your email address will not be published.
Back to top button
|
<urn:uuid:0d414b83-d53b-4fe6-89cc-8a121c56b3b3>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.703125,
"fasttext_score": 0.02441459894180298,
"language": "en",
"language_score": 0.9694311022758484,
"url": "https://homecomputer-service.com/posadas-creation-is-icon-of-modern-mexico/"
}
|
A parent's guide to stuttering
Updated: May 16, 2019
What is stuttering?
A fluency disorder, or stuttering, affects the smoothness and “flow” of one’s speech. Stuttering is a neurological disorder that can negatively impact the ability of an individual to communicate effectively. Stuttering includes repetitions of sounds, words or phrases, and blocked speech. There may also be unusual facial and body movements associated with the effort to speak.
Why do children stutter?
Stuttering is typically developmental in nature, meaning it first occurs during early childhood, by 3.5 years of age. Stuttering can be caused by hereditary, developmental or neurological issues. People who have family members who stutter are more likely to stutter. Additionally, boys are more likely to stutter than girls.
How do I know if my child stutters?
Many children who stutter recover naturally, so it can be hard to know if and when you should reach out to a speech language pathologist. Here are some signs of stuttering:
• Sound repetitions - “He w-w-w-wants to play.”
• Word repetitions - “He-he-he-he wants to play.”
• Prolonged sounds - “He wwwwwants to play.”
• Blocked speech - “He (pause) wants to play.”
When should I get professional help for my child’s stutter?
• Your child has been stuttering for 6-12 months
• Stuttering is getting worse
• Stuttering started after age 3 and a half
• Your child is frustrated or embarrassed
• You have a family history of stuttering
How do you treat stuttering?
Speech-language pathologists work with children who stutter in two ways, using indirect strategies and direct strategies. Indirect strategies may include working with the child’s family, reducing the pressure to answer questions and slowing down your rate of speech. Direct strategies provide compensations and strategies for the child to manage disfluency.
Will my child outgrow stuttering?
Interestingly, 5 percent of all children go through a period of stuttering that lasts six months or more. This usually occurs during the early preschool years, when language is developing rapidly. Three-quarters of those will recover by late childhood, leaving about 1% with a true stutter.
Other resources for stuttering:
Recent Posts
See All
|
<urn:uuid:9a45823c-7f87-4112-89df-caeafd45ae33>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.71875,
"fasttext_score": 0.08908951282501221,
"language": "en",
"language_score": 0.9484853148460388,
"url": "https://www.speechteammate.com/post/parent-guide-to-stuttering"
}
|
4000 Islands
By mid-1800s, the British already controlled foreign trade along China’s coast, and French merchants are seeking another way to tap the riches of China. Eager for glory, Napoleon III’s navy captured Saigon (Vietnam) in 1861.
Francis Garnier, a young naval officer, advocated exploring the Mekong as a potential route to China and in 1864 the “Mekong Expedition Commission” was soon approved.
A crew of 20 with Commander Ernest Doudart de Lagrée in charge set sail aboard two steamers on June 5th 1866.
De Lagrée knew about “Khone Falls,” but had assumed that the rapids will be passable. Garnier thought a strong steamer could overpower the torrent, but as the ride turned rougher, his journal entry states that navigating the Mekong to China seemed “gravely compromised.”
They arrived in Dali on March 1, 1868. Unfortunately, De Lagrée died from severe dysentery before they arrived in China. However, the locals refused the Garnier-led crew passage, leaving a boat ride down the Yangtze to Shanghai as their only way out.
During the 1870s, France wanted to continue the Mekong Expedition’s legacy by linking to inner China via the Mekong through Laos, which they needed to control.
In the 1880s, France also firmed up their Cambodian position by seizing power from King Norodom with a show of gunboat force, which piqued further interest in the Mekong and overcoming Khone Falls.
French Navy Lieutenant Campion first powered a small steamer up Cambodia’s Sambor rapids in 1884, and Captain Paul Reveillère guided a steamboat to Don Khone’s western shores, anchoring in what he named “Marguerite Bay” in 1887. Onboard was a representative of Messageries Fluviales de Cochinchine, which held the Mekong navigation concessions in Cambodia and Vietnam.
Meanwhile, the French continued negotiating with Siam over the disputed Mekong borders, the failure of which prompted a French blockade of the Chao Phraya River below Bangkok in July 1893. The Siamese relented and signed a treaty on 3 October renouncing any claims on the Mekong’s east bank. To hold the river, the French urgently needed gunboats above Khone Falls.
Primary source:
Don Khone Railway Pavillions Panels
|
<urn:uuid:980636ac-dbd1-4398-9a3f-bf58a1603b80>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.59375,
"fasttext_score": 0.0431172251701355,
"language": "en",
"language_score": 0.9462111592292786,
"url": "https://www.southern-laos.com/information/4000-islands/history-culture/"
}
|
Skip to ContentSkip to Navigation
University museumPart of University of Groningen
University museum
Collections Collection stories
Tinkering with dimensions
Boole Stott
These colourful orbs mee look like something a child made, but actually the are actually four-dimensional shapes, or polytopes. Sounds complicated? That’s because it is.
You can make a three-dimensional cube from flat squares. To do this, you sort of ‘push’ the squares up into the third dimension. A polytope comes about in the same way. However, we cannot see the shape that is then created. We can only argue it exists.
The woman that made these spheres however, the Irish Alicia Boole Stott, could. She had the unique ability to visualize these shapes and made detailed models of them. 3D cross sections of 4D shapes. And she didn’t even have a formal education.
So it’s not surprising that mathematician Pieter Schoute from Groningen had never heard of Boole Stott when a letter of hers landed in his mailbox in 1894. He too was engaged in four-dimensional math, but in a more theoretical way. Boole Stott had read an article of his and sent him a picture of her models.
He was so impressed that he not only travelled to London straight away, but also proposed to work together. For twenty years they combined her intuitive insights and his theoretical work.
Last modified:08 October 2021 3.09 p.m.
printView this page in: Nederlands
|
<urn:uuid:c4e3203e-dd7e-426c-ae5f-6b42c5af6e8b>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.625,
"fasttext_score": 0.039514899253845215,
"language": "en",
"language_score": 0.9604310393333435,
"url": "https://www.rug.nl/museum/collections/collection-stories/knutselen-met-dimensies"
}
|
Thunderstorms in Mountains
Earth Science Asked by Ryan Amalfitano on December 11, 2020
When you’re in the mountains for example like in the Appalachian Mountains, is thunder heard more easily from further away in the mountains rather than if you aren’t in the mountains?
One Answer
I presume you mean if one were a substantial distance away from a lightning strike in the mountains, would it be heard better or worse by another observer the same distance away in the plains and foothills? It depends whereabouts in the mountains this lightning strike occurs and where the observers or listeners are.
If it occurred between two rocky ridges forming a V shape with the open end directed toward the plain, it is likely that the observer on the plain would hear it more clearly than an observer or listener the same distance away in the mountains. The very mountain walls which reflected the sound toward the plain would act as barriers to listeners placed, let's say, 10 miles away in the mountains to either side. This is called acoustics.
One can also imagine an acoustic layout in which the mountain observer would hear the strike more clearly and loudly, but on balance the plains observer would be more often in a position to hear the thunder clearly. My own observations of thunder in the mountains and coastal areas of Brunei and Sarawak would seem to bear that out
Answered by Michael Walsby on December 11, 2020
Add your own answers!
Related Questions
Why does air pollution comes with cold weather in tropical areas?
3 Asked on April 20, 2021 by anukmenchitlarmen
Why does radioactive dating work on specific rocks?
3 Asked on April 10, 2021 by davidvgalbraith
Manually changing symmetry
0 Asked on April 10, 2021 by user99853
How many years does it take for rivers to form?
0 Asked on April 6, 2021 by bawddor
Find planetary temperature
1 Asked on April 4, 2021 by tysondennis
Do desalination plants affect the ground water table?
2 Asked on April 2, 2021 by mahesh-ram
How to cite LandSat 8?
1 Asked on March 25, 2021
How long does it take to form amber?
1 Asked on March 23, 2021 by danubian-sailor
Ask a Question
Get help from others!
|
<urn:uuid:37de6a61-564d-4b69-89dc-6f481b2de46b>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.734375,
"fasttext_score": 0.3692168593406677,
"language": "en",
"language_score": 0.9455429315567017,
"url": "https://answerbun.com/earth-science/thunderstorms-in-mountains/"
}
|
Mirror, Mythical beast design
Mirror, Mythical beast design
Archaeology / Kofun / Yamaguchi
Place excavated:Excavated from Yanai Chausuyama Tumulus, Oaza Yanai Mizuguchi, Yanai-shi, Yamaguchi
Kofun period, 4th century
This bronze mirror was made in Japan during the Kofun period (Ca. 3rd–7th c.) using Chinese-made mirrors as a model. It was unearthed from a tumulus, a mound of earth piled up to create a grave. The face you can see is the back of the mirror, not its reflective surface. The projection in its center is a knob for passing a cord through. Can you see the four outlines slightly resembling curled-up caterpillars around it? These are the tuolong from which the mirror gets its name. Tuolong are mythical Chinese beasts. Their heads actually overlap with depictions of the upper bodies of Chinese deities. The tuolong also have rod-like objects clutched in their mouths. All these details combine to make this an extremely complex design. Only the rulers of Yamato, based in the Kinki region, would have possessed the technology to create a mirror like this one.
This mirror, however, was found far from the Kinki region, in the Yanai Chausuyama Tumulus, which faces the Seto Inland Sea in southeastern Yamaguchi Prefecture. Two boys accidentally discovered this tumulus in 1892. Later, the site underwent extensive excavation, and a 90-meter-long keyhole-shaped tumulus was uncovered. Approximately 10 kilometers from the Chausuyama Tumulus is another gigantic tumulus known as the Shiratori Tumulus. In ancient times, there was a waterway for boat traffic on the line between these two tumuli. The tumuli were positioned at the entrance and exit of this waterway. The shipping route to the Korean Peninsula via the Seto Inland Sea was vital to the Yamato authorities in terms of trading with mainland Asia. The Yamato authorities made alliances with the rulers of these two areas to ensure safe passage for ships and gave them bronze mirrors and other gifts as symbols of those alliances. This bronze mirror is 45 centimeters in diameter and weighs nearly 9 kilograms. It is the largest Kofun-period Japanese mirror. The size of a mirror is thought to be an indication of its class, so the size of this one highlights the importance of the region in the eyes of the Yamato authorities.
Related Works
Search items related to work chosen
|
<urn:uuid:7a1a39e3-3078-47bb-8fe9-8d078f8125f2>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.06195938587188721,
"language": "en",
"language_score": 0.9494770169258118,
"url": "https://bunka.nii.ac.jp/heritages/detail/579520"
}
|
The UN General Assembly declared November 6 as the International Day for Preventing the Exploitation of the Environment in War and Armed Conflict.
Society has counted its war casualties in terms of dead and wounded soldiers and civilians, destroyed cities and livelihoods, the environment has often remained the unpublicized victim of war.Water wells have been polluted, crops torched, forests cut down, soils poisoned, and animals killed to gain military advantage.
Furthermore, the United Nations Environment Programme (UNEP) has found that over the last 60 years, at least 40 percent of all internal conflicts have been linked to the exploitation of natural resources, whether high-value resources such as timber, diamonds, gold and oil, or scarce resources such as fertile land and water. Conflicts involving natural resources have also been found to be twice as likely to relapse.
The United Nations attaches great importance to ensuring that action on the environment is part of conflict prevention, peacekeeping and peacebuilding strategies – because there can be no durable peace if the natural resources that sustain livelihoods and ecosystems are destroyed.
Education for Justice Resources:
|
<urn:uuid:6f76c273-6519-4342-a4c4-0212c974dccb>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.921875,
"fasttext_score": 0.04894441366195679,
"language": "en",
"language_score": 0.9440209269523621,
"url": "https://educationforjustice.org/events/international-day-for-preventing-the-exploitation-of-environment-in-war-and-armed-conflict/"
}
|
Baobabs are an iconic part of the sub-Saharan landscape in Africa. Wielding gnarled branches that can spiral up to nearly 100 feet into the air, and with bloated trunks that send out branches spanning an average of 65 feet all together, the baobab is a vital part of the region’s ecology and a celebrated staple Africa’s culture. And like most celebrated parts of the natural world, the baobab suddenly finds itself threatened in modern times.
The oldest African baobabs (between 1,100 and 2,500 years old) are dying abruptly, according to a new survey of the species published Monday in Nature Plants. The numbers are grim: 8 of the 13 oldest and 5 of the 6 largest trees on record have died or experienced deterioration over the past 12 years.
The culprit is still unknown—and at large.
“Baobabs are peculiar trees, with unique architectures, remarkable regeneration properties and high cultural and historic value,” says lead author Adrian Patrut, a chemist Babes-Bolyai University in Romania. “They’re the oldest and largest angiosperms. The impact of their loss would have profound consequences on many levels.”
Baobab age has always been a difficult thing to tabulate, since the trunks produce only faint growth rings. Recent breakthroughs in radiocarbon dating suggests they can live about 3,000 years. The Panke Baobab in Zimbabwe was estimated to be around 2,500 years old—the oldest on record—before it died in during 2010 and 2011. Nothing lives forever, but the latest spate of deterioration and death among the species’ oldest members is unprecedented.
Between 2005 and 2017, the research team identified and dated more than 60 of the oldest and largest known individual baobab trees throughout southern Africa, initially in a quest to understand how and why they grow so big. The team probed each tree and assessed girth, height, volume, age, and relative health. That’s when they noticed the oldest were dying off surprisingly quickly during the survey’s run, sans any sign of disease.
The biggest suspect, of course, is climate change. “Paleoclimate evidence suggests that baobabs are adapted to wetter, drier, and colder conditions, but possibly not to hotter conditions,” says Patrut. Large trees need more water, and when that water isn’t available, the wood gets weaker, especially in larger and older specimens. “We suspect that an unprecedented combination of temperature increase and extreme drought stress were responsible for these demises.” And in other cases climate change may have induced extreme weather events. For instance, Botswana’s Chapman’s Baobab, which died in 2016, flushed leaves and produced flowers well before the rainy season started. “Having depleted its water resources, it was no longer able to stay erect, and collapsed,” he says. “That year, the rainy season was several months late and many animals died. Witnesses claim that birds even dropped dead out of the sky.”
The new findings, troubling as they are, are unsurprising. “Southern Africa is one of the fastest warming places on the planet,” says Patrut. “Since our article was published, we have received feedback from other parts of the world where monumental trees are dying.”
However, he is quick to note there’s still not enough proof to indict climate change outright. “Since there are relatively few millennial baobabs throughout southern Africa,” he says, “it is impossible to make a statistical analysis. Also there aren’t any climate records in some areas where the demises were recorded.”
It’s easy to understand the ecological value of the baobab tree. “These trees keep soil conditions humid and stymie soil erosion, which is very important in the dry savanna,” says Aida Cuni-Sanchez, a tropical forest ecologist at the University of York in the UK, who has previously studied climate change effects on baobab trees. “They also act as an important source of food, water, and shelter for a wide range of animals, including birds, monkeys, and even elephants, which eat their bark.”
But baobabs are also incredibly useful to humans. “These trees have more than 300 uses,” says Cuni-Sanchez. The seeds, leaves, and fruit are all edible, and can also be used for medicines, dyes, and rope materials. Humans have sometimes even turned the trees into makeshift homes and shops. The Sunland Baobab, located in the Limpopo Province of South Africa, had a gargantuan tree trunk circumference stretching out to 150 feet, with a cavern-like hollow center that was home to an entire cocktail bar before the collapse of several major stems in 2016 and 2017.
Ghislain Vieilledent, an ecologist at the CIRAD French research center who has previously studied tropical forest loss and baobab mortality on Madagascar, thinks the new findings show “concretely that something abnormal is happening regarding baobab tree mortality. Using an emblematic species, it alerts once again on the potential negative effects of climate change on tree species and forests in general. Other types of disturbances, like insect attacks, fires, or storms are less likely in this case.”
“Nonetheless,” he emphasizes, “it does not mean that the African baobab is threatened with extinction. Mature but younger and more vigorous individuals of the same species might not be as vulnerable to climate change as old individuals.”
More research is needed to properly figure out how grave the situation is and what conservationists ought to do, but if climate change really is to blame, the clock is ticking fast. “The baobabs are a natural wonder, like the Giant Sequoias or the Grand Canyon,” says Cuni-Sanchez. “It is a sad to think that the next generations won’t be able to admire them.”
Correction: A previous version of this article mentioned the diameter of a baobab’s “trunk” when the measurement in fact referred to the span of the tree’s canopy. This has been corrected.
|
<urn:uuid:3dcc295c-894f-415d-9bb0-1a404c2305fe>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4.125,
"fasttext_score": 0.05787456035614014,
"language": "en",
"language_score": 0.9622879028320312,
"url": "https://www.popsci.com/baobab-tree-climate-change/"
}
|
St John's C of E Primary School
Peace in Europe
In this Collective Worship for KS2, we will be thinking about what brings us Hope- how do we comfort ourselves when we feel afraid?
The country of Ukraine is in Europe. The people that live there are peace-loving and happy in their own country. They are very much like you and I. On February 24th, Vladamir Putin, President of Russia, made the decision to invade Ukraine, against the wishes of the Ukrainian leaders and people. There has been fighting as Ukraine has resisted being taken over by Russia.
The Ukrainian people are scared, sad and in pain. The world watches and tries to help. It is a sad situation and it is okay if you are feeling worried or sad about it today. Many of the people in this room feel very similarly.
It is important to remember not all the people of Russia want a war with Ukraine. Just like the people of Ukraine, many Russians are peace-loving and want to live in generosity and kindness towards people from other countries. They do not want to invade Ukraine and cause heartache and tragedy for the people there, but they are unable to control the decisions of their country’s leader. Many Russian people have risked harsh punishment to make their feelings known and have been protesting the war in Russia’s cities. They are sad and hurting about the conflict their country is now in.
How can we be Peacemakers?
Reconciliation is the coming together after conflict. It requires listening to each other, telling the story of our hurt and making it right. We can have hope that the countries of Europe will be able to do this again as they have done in the past.
This happens with countries after conflict, but also with each other after arguments. When we have done something wrong at school, we sit down and talk about it, and how to put things right. We listen to others, we are honest about the harm we might have caused, and we make it right and repair the damage,
Peace in Europe
|
<urn:uuid:151e4d7f-4928-4557-8edd-33e5c182c22e>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.25614869594573975,
"language": "en",
"language_score": 0.9721640944480896,
"url": "https://www.st-johns-pri.bham.sch.uk/peace-in-europe/"
}
|
Why is it so important that Hannah and her family remember?
Why is it so important that Hannah and her family remember?
Passover Seder is important to Hannah’s family because it is about remembering people they lost during the Holocaust. The novel opens with Passover Seder, and this is an important Jewish holiday. The holiday is about remembering family members and friends that were lost during the Holocaust in World War II.
What did Hannah’s mother want her to remember?
Instead, as Hannah’s mother reminds her daughter, Passover is about remembering the past. Specifically, Passover tells the story of the Jewish people’s exodus from Egypt. During the seder, the Passover story is retold. Jews are commanded to tell the story in order to remember their past.
What is happening to Chaya’s memory?
What does the title The Devil’s Arithmetic mean?
Amanda Hill The Devil’s Arithmetic is about the Holocaust. The “Devil” could literally be considered Hitler, but in this book it refers more to the general horror of the Holocaust. During the Holocaust, numbers were tattooed on the arms of Jews for identification.
What do you think the modern Hannah learned from her experience?
At the same time, the novel suggests that Hannah learns that to be Jewish is something that must be lived with pride and zeal because the modern generation is the benefactor of the sacrifices made by the past generations. Hannah benefits because of Chaya and with this, both have a newly validated voice.
Why does Hannah write on herself in The Devil’s Arithmetic?
Expert Answers Hannah writes on herself because she wants to copy the prominent tattoo that her grandfather has on the inside of his lower arm. When the story opens, Hannah is too young to understand the significance of the blue numbers on the inside of her grandfather’s wrist.
|
<urn:uuid:4b83a754-9ab1-43dc-bb33-cddfda049f28>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.6875,
"fasttext_score": 0.9708455204963684,
"language": "en",
"language_score": 0.9713588953018188,
"url": "https://teacherscollegesj.org/why-is-it-so-important-that-hannah-and-her-family-remember/"
}
|
The Sick Society
The Yellow Fever in the South—Scenes and Incidents at Vicksburg and Memphis, September 16, 1878. The Historic New Orleans Collection.
When historian Kathryn Olivarius published her 2019 article, “Immunity, Capital, and Power in Antebellum New Orleans” in the American Historical Review, she didn’t know just how pertinent her study of the social ramifications of epidemic disease in class society would be. By the time she published her book-length account of the same topic, Necropolis: Disease, Power, and Capitalism in the Cotton Kingdom, three years later, Olivarius needed a quick preface to address the elephant in the poorly ventilated room.
Necropolis tells the story of a regional ruling class that struck a devil’s bargain with disease, going beyond negligence to cultivate semi-annual yellow fever epidemics. As a commercial capital for the 19th century’s new world system, New Orleans could count on a constant flow of newcomers — free and enslaved — to feed the sickness personified as “Yellow Jack.” Rather than modernizing to tame death, the city’s “immunocapitalists,” as Olivarius calls them, crafted elaborate ideological justifications and social customs around the disease, using it to prop up the moribund slave-labor regime. With her necrotic New Orleans, Olivarius presents a portrait of a sick society, a picture that looks eerily familiar in the present-day light. —Malcolm Harris
Malcolm Harris: Can you tell me about the unusual role that New Orleans plays in the national and global economies during the period your book covers?
Kathryn Olivarius: New Orleans is really the city of the 19th-century United States, especially before the Civil War. It’s founded in 1718 by the French, and it alternated between French and Spanish control during the 18th century. It was always a city that kind of shouldn’t be there, in that it’s in a swamp. But it’s at the very base of the Mississippi River, which is the artery of the North American continent, and you have to have a city there to process all the goods flowing out of the Mississippi Valley. New Orleans was founded on this large riverbend, and most of the city sits about one foot above sea level. It’s very, very close to the water table.
By the 1790s, New Orleans was rapidly changing because of two commodities: cotton and sugar. These were sources of immense wealth to various empires in the Atlantic world. Sugar was successfully granulated for the first time in Louisiana in 1795, and the cotton gin rapidly increased cotton production. So this place, on the brink of a commodity revolution, was what America inherited with the Louisiana Purchase in 1803. New Orleans became the leading cotton export city during the antebellum period. And as these products were grown on a much larger scale—cotton was spreading into the Mississippi Valley—New Orleans became the primary supplier of cotton to the European market by about the 1840s.
With each decade, more and more cotton is flowing through New Orleans to ports around the world. This is in turn bringing lots of wealth and capital into New Orleans—as well as people who want to invest in the cotton and sugar industries. And of course there’s the slave industry, too. With the banning of the transatlantic trade, New Orleans becomes the biggest slave market in the United States and the center of the exclusive domestic slave trade.
MH: Being a hub of global commerce, the city also becomes a center of disease and disease spread. We traditionally think about disease waves as public problems to be dealt with, or at least we used to. But you depict a situation in New Orleans where yellow fever becomes not only epidemiologically endemic, but socially endemic, too. How does this society become based around disease?
KO: Yellow fever radically transformed the lives of millions of Americans before the 20th century. The disease needs three things: a hot, humid climate; a sizable population of female Ae. aegypti mosquitoes; and a large population of non-immune people living close together. In New Orleans in this period, epidemics appear every two or three years in the summer.
After the Louisiana Purchase, thousands of people are pouring into the region because they want to get on the ground floor of this commodity revolution, or they want one of these good government jobs that they see as a springboard to slave- and land-ownership. And as more people are coming in, more ships are coming in too, carrying these mosquitoes from the Caribbean.
By the 1810s, the epidemic outbreaks were so frequent that they shaped the city’s calendar. The epidemics would generally be from June or July to November, when the first mosquito-killing frost came. That’s three or four months of fever season, so it obviously impacted people’s lives then but it really impacted their lives the whole year round. It greatly influenced the timing of the cotton market. Come January, the cotton and sugar and slavery industries were absolutely abuzz—but what would happen is suddenly one day in late June or early July a case of yellow fever would be reported or rumored, and eventually there would be a tipping point, where enough cases were reported and the entire life of the city would switch.
People who were rich and white—many of whom owned slaves and country plantations—were able to leave. You would get onto a carriage with your family, or perhaps with enslaved people whom you owned, and you would go to your country plantation. Or you would go to the north and you would take in theater and do business in New York. Some went to London or Paris to do their summer tours there. But that’s only for the very richest people, and many had no choice but to remain in town during epidemics because they did not have the funds or freedom to leave. And if you stuck in town, life would be very miserable. You would spend three months in utter fear that you were going to die. You would steel yourself to keep working because you would be fired if you didn’t, if you gave up your post in your grocery or wholesaler or merchant house. If you did get sick, you would spend all the money you had in the world and then some on doctors and nurses to try to safely take you through the acclimating process. If you survived, you would be known as an acclimated citizen; if you died, you were a poor and unfortunate unacclimated stranger. And you had about a 50% chance of living or dying of this disease in the 19th century.
And then, when the frost comes—so many people describe this in their letters and diaries—New Orleans bounced back to its former self overnight. Suddenly the street was filled with people, stores reopen, schools reopen. If you lived through this for many years, you became used to this kind of danse macabre, this semi-yearly pattern dictating the pace but also the emotions of your life.
MH: Sounds familiar. It struck me that the New Orleans economy looked more like the Caribbean slave-labor sugar plantations than the slave-breeding plantations of the Upper South.
KO: Even today New Orleans doesn’t feel especially American. People two centuries ago agreed that it looked much more like Havana than it did Philadelphia or Richmond, and that became a part of the justification for slavery. Theorists at the time said that black people could better withstand the climate and diseases of the tropical world and that this was a sign ultimately from God—but also from the environment—that black slavery was natural, even humanitarian, because black slavery insulated white people from places and labor that would kill them. This idea had existed for hundreds of years in the Atlantic world, and was refined by doctors who are stationed with the British Army, or the British Navy, in these Caribbean campaigns. And you see this idea really takes hold in New Orleans—against, by the way, all sorts of actual evidence.
Very quickly after the Louisiana Purchase, this idea emerged that Louisiana was too hot and too sickly a place for white people to do the majority of the labor. Only black slavery, it was said, could transform the swamps into profitable sugar and cotton plantations. And so they claim very early on that black people showed, if not complete immunity to yellow fever, at least extreme resistance to the disease. This is not true, it’s just a story. Black people could and did die of yellow fever, and this is documented in all sorts of literature and all sorts of diaries and plantation management books. And yet this mythology remains. This story becomes a defining feature of the logic of slavery on the Gulf Coast.
MH: You write that the proportion of enslaved persons in the city dropped from 50 percent in 1806 to 8 percent by 1860.
KO: Yeah, New Orleans was a majority Black city during long parts of the 18th century and the early 19th century, but the enslaved population does drop off quite significantly. Part of this is because enslavers in New Orleans are thinking, “why risk my valuable property here? This person could be put to much better use on my plantation in Mississippi, which is much safer overall than New Orleans during epidemics.”
MH: Can you talk about the “immunocapital” concept—your term for the system by which yellow fever interacts with this variegated labor market?
KO: Immunocapitalism is a system of class rule in which elites in New Orleans used yellow fever and the destruction that it brought to essentially divide and subjugate the masses, both black and white. So the people who are controlling the commercial and civic sphere—the rich white planters, the merchants, the politicians (who by the way are very often all three of those things at the same time)—came to see disease not necessarily as a curse, but as a kind of blessing. Because disease did a lot of work for them.
In other American cities at the time, where there’s disease, people are trying to ameliorate it, or cure it. That’s not what the New Orleans elite did. Instead they seemed to encourage the propagation of yellow fever, making the most of the mass death to consolidate their power on top of the cotton market. Early on after the Louisiana Purchase, elites noticed: Well, there’s nothing we can do to stop yellow fever. There’s no cure. There’s no inoculation. We don’t know how it spreads. We have no way of telling who’s going to live or die. And quarantines and other public health measures, which might work in New York, aren’t going to work here because we’re in a swamp. The two “solutions” they came up with were the notions of enslaved Black immunity and white acclimation.
In time, the city’s white population became stratified according to who possessed immunity to yellow fever—the so-called acclimated citizens. Acclimated people lived in better places, they had better jobs, they were more readily promoted. They were able to socialize and mingle in superior circles. You could even marry better—many fathers would bar their daughters from even talking to unacclimated men.
MH: Because they were likely to die on you?
KO: Right. And acclimation correlated with wealth because it opened up the doors to better employment, better connections, better lines of credit, and so on. So these labels really matter, professionally and socially.
MH: It sounds like acclimation was, conceptually, sort of analogous to certain kinds of education or skills, like having a college degree or knowing how to code. I tried to imagine how people would relate to that kind of labor market situation.
KO: I use capital deliberately here because people at the time describe their immunity as a form of capital in the way that Pierre Bourdieu describes it. They thought about it as a credential that would give you access to other things, just like a college degree would. It can’t be passed down and it can’t be traded, but you put in time and you risked your life and this is your reward.
MH: You’re writing about a split labor regime, where a large percentage of the workers are enslaved—you call them “embodied capital.” You use capital in both the Bourdieu and the Marx traditions at the same time, fusing them into this immunocapital concept, which brings this disjuncture between free and enslaved labor to the fore. Did you run into trouble with that?
KO: When I talk about enslaved people, the capital is much more in the Marxian sense. It’s much less metaphorical.
MH: You can measure it.
KO: You can measure it and you can value it in prices.
But this is one of the most frustrating parts of being a historian of the South, and a historian of slavery: there are so few sources that we have from the perspective of enslaved people that are unmediated by white people. Even slave narratives were written and rewritten and crafted for a white audience up north. So there are very few sources that speak to what I’m getting at here, which is, how did enslaved people feel about their immunity? How did their sense of self change if they became acclimated? Is it analogous to how white wage workers felt?
Some of this we can sort of discern—I think it’s fair to say that enslaved people were petrified of yellow fever like everybody else. And that they were obviously delighted to be acclimated, if they were, because first and foremost it would save your life and would prevent death in future epidemics. But I have found very, very few sources that speak to how acclimation changed how enslaved people thought about themselves and their position in the world relative to others.
The white immigrant workers shouted it from the rooftops when they were acclimated. They saw it as a springboard to a desk job. You’d no longer have to canals, you’d no longer have to compress cotton to load into steamboats. You could become a clerk or a bookkeeper or an accountant. And one day own your own cotton factory, purchase land, purchase people. It was like getting your college degree, where suddenly the world is your oyster.
MH: It seems like a bridge to modernity in some ways for some people, for the free workers who become acclimated. It’s a bridge to a different historical period than the one they’re coming from.
KO: Yeah, New Orleans was the country’s second-most-popular immigration destination, after New York City, during the antebellum period. And a lot of these people came through there because it didn’t have a health check.
MH: I don’t want to conflate immunity with class position because they are distinct in the Bourdieuian sense. But immunocapitalism produces this sort of immune overclass that develops a set of policy positions which include an antipathy toward public health measures. Does a lackadaisical attitude toward yellow fever become a conservative litmus test for pro-slavery politics?
KO: In this period, New Orleans spends far, far less on public health than does any other comparable American city. I’m talking about 2 cents on public health per person per year, compared with 69 cents in Boston. It’s the deadliest city in America by far, it has triple the average national mortality rate. And everyone derides it as a Necropolis or The Seat of Pestilence or The Great Charnel House or The City of Death
MH: Jesus.
KO: One of the most interesting parts of my research was that I came to see the official indifference to the public’s health as not a bug but a feature of this society. You see the elites routinely rejecting quarantine, and they spent very, very little money on sanitation—which was a big deal, especially because many people at this time thought that the disease is spread by miasma. People in New Orleans came to suspect that their city fathers were literally willing them to die.
So the question is, why did elites here act so differently than elites in other cities? Partly it’s that they took the conservative anti-tax position to the extreme. They genuinely thought that any kind of public health intervention would be ineffectual, a waste of money.
But they did get pushback, especially after big epidemics. In 1853 there was a devastating epidemic, still one of the worst natural disasters in American history, when 12,000 people died in the course of two and a half, three months. That’s a tenth of the city’s population overall and fully a fifth of its Irish-born population. Huge amounts of death, more than the city can process. The city council has a meeting in June, they briefly talk about yellow fever, they appropriate new funds for dealing with it, and then they all go off to their plantations and stay there until October. And this does create pushback.
But they counter the pushback by essentially denying disease, both as an epidemiological reality and as a social reality too. Increasingly by the 1850s, you see people saying, well, yellow fever is not that big of a problem. It’s not that serious of an illness, and anybody who’s temperate and well-mannered and courageous and manly will survive. It only kills the immoral, the drunk, the unfortunate. Your cousin in Philadelphia or your niece in Sligo who thinks of New Orleans as a “necropolis,” they don’t know what they’re talking about, these northern critiques of New Orleans’s health situation are a proxy for abolitionists attacking slavery.
MH: What happened when New Orleans is under military occupation? What were the expectations, and what was the reality?
KO: New Orleans, obviously, was a major city in the Confederacy, and when Louisiana seceded, New Orleans did too. But it was retaken fairly early on in the war. When the Union army occupied New Orleans, the expectation among town people was, “Just wait until August.” Because then, all these unacclimated Union soldiers are gonna die, and they’ll see that yellow fever is on the side of the South. When all these boys die it will vindicate us and our system.
Benjamin Butler, who was the occupying general, was really worried about disease, and like everyone in America he had heard the tales of New Orleans. He was acutely aware that most of the men in his army had never been this far south before, that they were decidedly unacclimated and vulnerable to this disease. So he installed a strict quarantine. He didn’t let ships come in or out without a thorough inspection. He doubled the salary of the quarantine officer, he cleaned the streets, he fired people who seemed to be the lackeys of the bureaucrats in New Orleans. He did a whole program of sanitation.
And it worked. There were only a few cases of yellow fever reported during the war years, even though hundreds of thousands of people came in and out of the city each year. It’s actually a miraculous demonstration of just how effective martial law can be in stopping diseases, I guess, and how effective quarantine could be when properly instituted and rigorously upheld.
But right after the war, when the Union army receded, the same people who had been in control of New Orleans before the war took up their former positions and went back to their old ways. The said, whatever happened during the war, let’s forget about that. Benjamin Butler was very much hated as a tyrant in New Orleans by whites, who associated the quarantine with him but not improved health. And right away health problems came back. There was a serious epidemic again in 1867, and periodic epidemics throughout the ‘60s and ‘70s, culminating in the epidemic of 1878, just after the end of Reconstruction. That was the worst in a generation; 5,000 or 10,000 people died in New Orleans alone, 25,000 people died across the Gulf South. It went all the way up to Memphis, which had never had yellow fever before.
But once again, in the midst of this devastating epidemic, you had this prevailing attitude among the commercial-civic elite, who say “Quarantines just don’t work here.” They said this even though they had proof that it did work during the war. It was only when immigration dries up so precipitously after the war, and when cotton goes elsewhere, that New Orleans could sort of shake itself free from this attitude.
MH: It’s this very evocative index for the failures of Reconstruction. In the Civil War period you have this occupation that ends slavery and yellow fever at the same time—and then you watch the authorities relinquish that position to disastrous effect. When you started this project, there was not a pandemic . . .
KO: Yes, I do not recommend writing a book about disease during a global pandemic. It was a little too much art imitating life.
But it was interesting and shocking and kind of scary, especially in the opening months of the pandemic, just how many echoes there were of life in New Orleans two hundred years ago. Covid is a much less deadly disease than yellow fever was. But I think we’ve gotten a small taste of what it was like for people living whole years according to the rhythms of a virus. One of the things that really impressed me is how exhausting it is to be scared, and how boring it is too. It’s this really weird combination of intense anxiety and fear, and an extreme sort of boredom. To me that’s the definition of pandemic time. This gives me a lot of sympathy for how people in the past must have experienced things.
And there were politicians like Donald Trump and Greg Abbott and others who stuck to the old line, that we can’t lock down because it’s not the patriotic thing to do. “Go back to work because we have to keep the economy going.” There’s a picture, when Trump had Covid in 2020, of him taking his mask off on the balcony of the White House. And I always think of that picture as an image of the 21st century’s first immunocapitalist. Here’s a guy trying to display his manliness, his courage, his patriotism, his political affiliation, all in one very potent image. The symbolism was that it’s your patriotic duty to take on disease risk.
MH: By the end of the book, I couldn’t help thinking that contemporary America is like one big New Orleans—in terms of Covid, of course, but even more so when it comes to climate change. We’ve got this archaic production system based on carbon emissions and relentless growth, and an elite in whose immediate interests it is to keep things going the way they are.
KO: It’s an entrenched elite that’s limited in their imagination and wedded to a system of production that is fundamentally destroying us all. But it is seriously profitable for them in the short term, and it’s against their interests to change anything. And because it’s so large and scary, elites use the scope and scale and the complexity to distract us from the fact that they could cap carbon emissions. You see this with immunocapitalists in New Orleans, too. They are always saying, oh, this is too big of a problem, what do you expect of us? But they’re not fixing their sights on the people and the systems that are making our world hotter and less hospitable to life. We do know what to do, we do have some sense of how to start going about this.
MH: But no Union army.
KO: Yeah, but no Union army.
Related Articles
September 4, 2013
Issue 28 Half-Life
We’re still here 525 years later, waiting for different answers.
Issue 26 Dirty Work
March 1, 2017
Etched into Eternity
More by this Author
March 7, 2018
Did you know the CIA _____?
April 25, 2011
When you hire corporate managers, you get managed like a corporation.
|
<urn:uuid:1c1495e0-36fe-4d44-a0dc-67be07877058>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.578125,
"fasttext_score": 0.1215674877166748,
"language": "en",
"language_score": 0.9742664098739624,
"url": "https://www.nplusonemag.com/online-only/online-only/the-sick-society/"
}
|
Explore Ada Lovelace’s Bernoulli program with Wolfram
Ada LovelaceIn 1843, Ada Lovelace became the first person to publish what we would now call a computer program, a set of instructions to calculate Bernoulli’s Numbers, written for Charles Babbage’s unbuilt Analytical Engine. Lovelace had translated a paper about the Analytical Engine written in French by Italian mathematician Luigi Menabrea, and had at Babbage’s suggestion added her own notes explaining the potential of the Analytical Engine in depth.
You can now explore the Bernoulli program using the Wolfram Language, a symbolic language which “emphasizes symbolic computation, functional programming, and rule-based programming”.
The interactive notebook begins with the Gauss Schoolboy Problem:
As a young schoolboy, [German mathematician Carl Friedrich Gauss] was tasked with adding the first 100 integers, i.e. what is 1 + 2 + 3 + 4 + … + 98 + 99 + 100? (The answer is 5,050.) Gauss reportedly produced the correct answer within seconds. How did he do this?
The workbook demonstrates how to calculate these numbers, and thus then how to calculate Bernoulli Numbers, “a sequence of rational numbers with deep connections to number theory.” From the workbook:
Back in the 1600s, people spent their lives making tables of sums of powers of integers. But Jakob Bernoulli pointed out that all such sums can be expressed as polynomials, with the coefficients being related to what are now called Bernoulli numbers. And in 1713, Bernoulli was proud to say that he had computed the first 10 Bernoulli numbers ‘in a quarter of an hour’—reproducing years of other people’s work.
Ada Lovelace was calculating these numbers by hand!
You can also scans of Lovelace’s letter to Babbage discussing the Bernoulli numbers at the end of the workbook.
The workbookWolfram Language was created by Wolfram Research, makers of Mathematica and Wolfram|Alpha.
Posted in Educational Resources.
|
<urn:uuid:52372485-2972-46a2-9c42-866174c6b69d>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4,
"fasttext_score": 0.9637073874473572,
"language": "en",
"language_score": 0.9376256465911865,
"url": "https://findingada.com/blog/2016/10/09/explore-ada-lovelaces-bernoulli-program-with-wolfram/"
}
|
Black-tailed Antechinus |
Antechinus arktos
Status: Endangered on the EPBC Act list
The black-tailed antechinus is a small carnivorous marsupial with a robust body and small ears. The head, neck and shoulders are greyish-brown, merging markedly to an orange-brown rump. The upper and lower eyelid, cheek and the front of the ears are orangebrown. The fore- and hind-feet are black. The body is covered in long guard hairs, giving the species a shaggy appearance. The tail is evenly black and thick based with short, dense fur. The species is large for the genus and sexually dimorphic, with males heavier than females. Males weigh 60-120 g, while females weigh 44-59 g.
Government evidence of impact of climate change:
Expand all Close all
• Australian Government, Conservation Advice, Antechinus arktos
Baker et al. (2014) state that the events species range contraction may be a result of climate change.
The black tailed antechinus is additionally vulnerable to climate change as the synchrony between the breeding season (including female lactation) and peak insect availability may be altered (Hagger et al. 2013 Gray et al. 2016).
Climate change is suspected to be the driver behind the range contraction.
The black tailed antechinus occurs in an ecologically distinct area in which all subpopulations are threatened by climate change.
The altitudinal contraction is thought to be a result of climate change (A Baker pers. comm. 2017d).
In addition; the intensity; frequency and duration of extreme weather events are projected to increase with high confidence (CSIRO BoM 2017).
|
<urn:uuid:fa174bbf-3d66-4500-9952-7b603424bfc6>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.515625,
"fasttext_score": 0.01978445053100586,
"language": "en",
"language_score": 0.9135022759437561,
"url": "https://livingwonders.org.au/evidence/antechinus-arktos/"
}
|
Why did Jesus use a donkey instead of a horse?
Judges 12:13-14 And after him Abdon the son of Hillel, a Pirathonite, judged Israel. And he had forty sons and thirty nephews, that rode on threescore and ten ass colts: and he judged Israel eight years. Hence we see the use of a donkey as a saddle animal was not a mark of humility. It instead is a mark of prestige.
What does donkey symbolize in the Bible?
In contrast to Grecian works, donkeys were portrayed in Biblical works as symbols of service, suffering, peace and humility. They are also associated with the theme of wisdom in the Old Testament story of Balaam’s ass, and are seen in a positive light through the story of Jesus riding into Jerusalem on a donkey.
Did Jesus ride a donkey or a horse?
In the New Testament (Mark 11:1-11) it is told that as Jesus approached the Mount of Olives, he sent two of his disciples to a nearby village to fetch him a donkey, or exactly an Onager or wild donkey. Upon their return, Jesus then rode the donkey into Jerusalem where he was met by cheering crowds.
INTERESTING: Frequent question: What is fellowship according to Bible?
What is the significance of the donkey on Palm Sunday?
A king would have ridden a horse when he was bent on war and ridden a donkey to symbolize his arrival in peace. Jesus’ entry to Jerusalem would have thus symbolized his entry as the Prince of Peace, not as a war-waging king.
What does the palm tree symbolize in the Bible?
The palm branch is a symbol of victory, triumph, peace, and eternal life originating in the ancient Near East and Mediterranean world. … Additionally, the palm has meaning in Christian iconography, representing victory, i.e. the victory of the spirit over the flesh, Revelation 7:9.
What is a donkey crossed with?
Jack donkeys are often used to mate with female horses to produce mules; the biological “reciprocal” of a mule, from a stallion and jenny as its parents instead, is called a hinny.
Species: E. africanus
Subspecies: E. a. asinus
Trinomial name
Equus africanus asinus Linnaeus, 1758
Why did Jesus enter Jerusalem on a donkey and not a horse?
King of peace
Though Jesus had been to Jerusalem several times to celebrate the three pilgrimage festivals, his final entry into Jerusalem had a special meaning. … Traditionally, entering the city on a donkey symbolizes arrival in peace, rather than as a war-waging king arriving on a horse.
Who got the donkey for Jesus?
Matthew quoted Zechariah when he wrote about Palm Sunday in Matthew 21:1–7: “As they approached Jerusalem and came to Bethphage on the Mount of Olives, Jesus sent two Disciples, saying to them, “Go to the village ahead of you, and at once, you will find a donkey tied there with her colt by her.
INTERESTING: Frequent question: Is Methodist a branch of Catholic?
What was the name of the donkey that Jesus rode?
The Christian donkey or the Jerusalem Donkey. The cross on the donkey’s back is widely thought to be from the Easter story.
Why did Jesus go to Jerusalem when he was 12?
The Book of Luke records just two narratives about Jesus’ childhood: His dedication (Luke 2:21- 40) and His time at the temple when He was 12 years old (Luke 2:41-52). … They had dedicated the baby Jesus according to the law of Moses, and they traveled to Jerusalem each year to celebrate Passover.
What does donkey mean in Hebrew?
The name Shechem means shoulder and Hamor means donkey. Both men and their entire family were killed by Jacob and his sons.
Is the donkey a symbol of peace?
Whereas horses were symbols of war, donkeys were symbols of peace and often used to enact treaties. … This donkey was created for a purpose and was meant for Jesus.
What does an upside down palm tree mean?
The monument’s artist, Indianapolis-based Brian McCutcheon, said the upturned tree symbolizes the natural environment of the Inland Empire, coupled with the irreverence found in some of the area’s residents, with street art, punk music and artists like the late Frank Zappa, who recorded music in Rancho Cucamonga.
|
<urn:uuid:eef5217b-141a-40ae-86c9-837f038c3fa6>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.5625,
"fasttext_score": 0.7740488052368164,
"language": "en",
"language_score": 0.9632121324539185,
"url": "https://allsaintsvabeach.org/biblical-reading/why-did-jesus-use-a-donkey-instead-of-a-horse.html"
}
|
How does inheritance work?
Inheritance is a complex process. Depending on the situation when the testator passes away, it may consist of various partial proceedings and steps.
What is the basic procedure for an inheritance?
The simplest type of inheritance is one in which the testator does not leave any testamentary disposition (a will or contract of succession) behind. This also dictates the basic structure of every inheritance process.
Intestate succession (without a will)
If neither a will (last will and testament) nor any contract of succession exists, intestate succession applies. This means that the nearest living relatives inherit. This is typically the spouse/registered partner and descendants such as children, grandchildren, etc. If there are no descendants, a proportion of the inheritance falls to the parents’ line. If the parents are already deceased, their remaining descendants, i.e. the deceased person’s siblings and their children, are next in line to inherit. Which of them inherits what proportion of the assets depends on how many people share the inheritance. If the person has no surviving spouse/registered partner nor any relatives, the inheritance passes to the public authorities.
Two brief examples
Example 1
If a woman passes away with no testamentary disposition and is survived by her husband, a son and a daughter, the husband inherits half and the son and daughter each inherit one quarter of the inheritance.
Example 2
If a person passes away and is survived by his registered partner, his mother and his sister, the registered partner receives three quarters of the inheritance and the mother one quarter. The sister would not be in line for the inheritance until after the mother’s death; until that time, the law does not provide for her to inherit.
Statutory entitlement
Particularly close relatives have not only statutory inheritance shares but also a specially protected claim to a statutory inheritance entitlement. Currently, these are set at three quarters of the statutory inheritance share for descendants, and half each for parents and spouses/registered partners. With the revised law of succession that takes effect on 1 January 2023, the statutory inheritance entitlements for parents will be eliminated and those for descendants reduced to half. After that date, only descendants, spouses and registered partners will have statutory inheritance entitlements, which will uniformly amount to half of their statutory inheritance shares. That results in greater freedom for testators. They can avail themselves of this freedom using a will or contract of succession – see below for more information.
Starting the inheritance process and security measures
Upon a testator’s death, the inheritance process begins. This point in time determines how the estate is defined and the community of heirs as well as the legatees. The inheritance process occurs at the last place of residence of the testator. The authorities responsible at that location under cantonal law are responsible for conducting the inheritance process. The heirs’ residences are immaterial.
As soon as the authorities have become aware of the testator’s death, they take all necessary measures to secure the inheritance procedure automatically. Depending on the situation, this mainly includes the sealing of the inheritance, taking inventory, ordering the administration of the inheritance and opening testamentary dispositions. Swiss federal law and in some cases also cantonal law describe in more detail in what cases these “security measures” apply.
Acquisition of the inheritance: Universal succession
All assets and liabilities, i.e. the testator’s assets minus unpaid debts, form the inheritance (also known as the estate). They pass to the heirs in their entirety at the time of death. That means that the heirs (but not the legatees) are also liable for the testator’s debts. The assets are assessed based on their current market value and entered into the inventory.
Who inherits? – Community of heirs
An heir is any person who is alive at the time of the testator’s death and has a claim to the inheritance or a part thereof, whether statutorily or through a testamentary disposition, and has neither been deemed unworthy to inherit nor legally disinherited.
When there are multiple heirs, these heirs constitute a community of heirs until the division of the estate, which means that they exercise all rights and duties with respect to the estate as a group. As joint owners, they can only dispose of the estate unanimously. In addition, they must inform one another of any information that is material to the administration of the estate.
If there is only one heir, the community of heirs does not apply. The sole heir inherits the entire estate and can dispose of it immediately.
Acceptance, public inventory and waiver
No-one is forced to accept an inheritance against their will. Heirs have the option to accept the inheritance without reservation or under public inventory or to waive it. The third option is recommended especially in cases of well-founded concerns about excessive debt. With acceptance under public inventory, the heirs are only liable for the testator’s debts that are registered by the creditors in a timely manner and taken into the public inventory. Anyone who waives the inheritance is treated as if they had predeceased the testator and is not considered for the inheritance. If all the heirs waive the inheritance, or if none exist, the matter proceeds with legal liquidation under the normal procedures, or according to bankruptcy law in the case of over-indebtedness.
Division of the estate
The situation of the community of heirs is provisional. In order for each heir to be able to dispose of their share freely, the estate must be divided. Each heir can demand this at any time unless the law or a contract dictates otherwise. The division of the estate determines how much accrues to whom. Then comes the consideration of whose share is to be settled with which of the assets in the estate. The claim to a particular value and the claim to the assets themselves must be considered separately. This is because all the heirs have the same basic claim to the assets in the estate. There are three options for the division of the estate:
1. If the heirs are in agreement, they can enter into an inheritance division contract. This is a unanimous agreement regulating who receives which assets from the estate in order to satisfy his or her claims based on value.
2. If there is no agreement, the estate is divided by forming lots. The responsible authority takes care of this based on local norms, the circumstances of the people involved and the wishes of the majority.
3. If the formation of lots does not yield results, for example because the majority of the estate is tied up in individual assets (particularly property), sale as the last option is considered. The proceeds can then be divided among the heirs. In such cases, a loss in value cannot be precluded; therefore, division by agreement or forming lots is to be given preference. Family documents and items of sentimental value should not be sold if an heir objects.
After the division of the estate
Upon signing an inheritance division contract or accepting the assigned lots, the division of the inheritance is binding for the heirs. At that point, they are “separated” – each heir has received a part of the assets from the estate as their own (sole) property and can then freely – i.e. independently of the others – dispose of them.
For a certain amount of time, however, the liability of the heirs remains in effect. That means, firstly, that the heirs are liable to one another for the quality of the assets in the estate. If an asset in the estate exhibits legal or material defects, the heirs are liable under the principles of sales law. With respect to third-party claims, they are jointly and severally liable for a period of five years and with all their assets.
What changes when there are testamentary dispositions?
The principles we have looked at so far apply to every inheritance. In addition, however, inheritance law leaves not inconsiderable room to maneuver which is known as “free disposition”. This allows you to dispose of your estate freely within the limits of the law. If you exercise this option, individual aspects of the inheritance process change. Basically, however, the steps are based on the process as described above.
Requirements and limitations
The legal limitations regarding testamentary disposition (will and contract of succession) are of a personal, formal and content-related nature. If a testamentary disposition does not fulfil these requirements, it can be challenged.
In the personal regard, the testamentary capacity of the testator is required. This is fulfilled when he or she is of sound judgment and has attained the age of majority.
As a matter of form, the formal requirements for the testamentary disposition must be met. This chiefly means that a will must either be written by hand or officially notarised. A contract of succession must always be officially notarised.
In terms of content, the dispositions set forth may not contravene valid law nor be immoral. It is not permitted, for example, to withhold the statutory entitlement from one’s own children without cause.
Within these limitations, you have various options to dispose of your estate. Because the contract of succession also requires the consent of the other parties involved, it provides even more freedom than the will. But it is far more difficult to change. A contract of succession may be with or without payment and may contain gifts or the waiver of claims arising from inheritance law.
Types of disposition
Here are just a few examples of what a will or contract of succession may contain: You can use it to name heirs (“designated heirs”), determine legacies or even set up a foundation. Of course you may also change the shares in the inheritance, i.e. who receives how much of the estate, up to the statutory entitlement. With the provisions of law regarding division of the estate, you can define who should receive what assets, as long as they are calculated against their share of the inheritance. You can also pre-plan for various eventualities by determining preliminary heirs, subsequent heirs and substitute heirs as well as by setting out requirements or conditions. By appointing an executor, you can lend weight to your testamentary dispositions by naming a person of trust to implement the inheritance process.
Submitting, opening and reading the will to the heirs
When a testamentary disposition is found upon a testator’s death, it must be submitted to the authorities without delay. Anyone who keeps a will or finds one among the testator’s belongings is required to submit it. They are also required to submit it even if they consider it invalid. Should they neglect this duty, they can be held personally liable for any damage arising from their inaction. In addition, persons committing this misdeed face potential unworthiness to inherit and possibly even charges of concealing a legal document.
Within one month of submission, the responsible authority opens the proceedings for the heirs. In the process, it shares with them the contents of the disposition and gives them a copy of it. The heirs may also receive a certificate of inheritance provisionally identifying them as legal heirs. That makes it possible to access the testator’s frozen assets (such as those held in bank accounts or safes).
What are the main causes of complications?
Ideally, the inheritance procedure can be completed without major complications. This is especially true when the legal situation is clear, testamentary dispositions are clear and not subject to objections, and the heirs are in agreement among themselves. At the same time, however, there are points that often result in complications in practice. Inheritance disputes or lawsuits can consume a great deal of time, money and attention. That is why it is good to understand critical points so as to prevent problems before they happen.
One major source of problems is the vulnerability of testamentary dispositions to challenges. If such a document does not fulfil the requirements set forth above, people with an interest in declaring it invalid can challenge it with an invalidity claim. This is possible, for example, if formal requirements are not fulfilled, the testator was not of sound mind when the document was drafted, or if it contains impossible, illegal or immoral content.
If the invalidity claim is successful, the disposition that has been challenged is partially or fully voided. It is replaced by earlier dispositions or – if none exist – intestate succession (see introduction).
If statutory entitlements or the provisions of a contract of succession are contravened, these are also grounds for challenging a will. This is what the action in abatement and similar tools are used for. Should third parties be unjustly in possession of items that belong to the estate, heirs can demand that they be turned over by means of an inheritance recovery action.
If individual heirs have received assets during the testator’s lifetime that are calculated against their share in the inheritance, they may be liable to compensate the value under certain circumstances. That means that they must inform the other heirs of their inheritance advances and “throw them into the pot” of the estate. With these additions, the total estate grows so that there are more assets to distribute. But the testator can also dispense with the compensation.
Last but not least, there is a matter that affects the heirs amongst themselves and also the testator’s estate planning: If they are all in agreement and “pull together”, the inheritance process can be quick and straightforward to complete. That is in everyone’s interest. If, however, there is ambiguity and discord, inheritance disputes can stretch out over years and block the majority of the assets in the estate or even consume them. To prevent this, it makes sense to involve the people who are likely to be included in a future inheritance during the testator’s lifetime, while the testamentary disposition is being drawn up. In complex cases, it is also advisable to get advice from experts. They can help arrive at solutions that are satisfactory for all parties, which is the most effective way to prevent inheritance conflicts.
The most important facts at a glance
• The basis for any inheritance process is always intestate succession. Its rules determine whether there are heirs who must receive statutory entitlements and what proportion of the estate can be bequeathed freely. This is determined by the state of the assets and the relatives at the time of the testator’s death.
• The inheritance process begins upon the testator’s death. If necessary, the responsible cantonal authorities can take steps to secure it. They must takes steps including opening the will of the deceased person. Wills and contracts of succession allow for many different dispositions that deviate from intestate succession.
• The estate is transferred in its entirety to the heirs when there is more than one. In order for each of them to be able to dispose of his or her share, the estate must be divided. The heirs should work on this together in order to arrive at a solution that is agreed upon by and acceptable to all of them.
You might also be interested in
Leave a Reply
|
<urn:uuid:a14d5984-b4e8-4821-a6c9-c58427613a4d>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.609375,
"fasttext_score": 0.031583189964294434,
"language": "en",
"language_score": 0.9550370573997498,
"url": "https://www.deinadieu.ch/en/advisor/how-does-inheritance-work/"
}
|
Paolo Veronese
Paolo Veronese
Studies of Jupiter Astride the Eagle
Pen and brown ink, brown wash
Purchased by Pierpont Morgan, 1909
I, 90a
Exhibition label:
Exhibition section:
At the beginning of the sixteenth century, Venice's mainland possessions, called the terraferma, stretched westward from Udine nearly all the way to Milan and included Padua, Vicenza, Verona, Brescia, and Bergamo. These Venetian strongholds ensured a continuous food supply and safeguarded trading routes to the north. Even though Venice's enemies combined to form the League of Cambrai and defeated the city in 1509, much of the mainland territory was recovered within a decade.
Venice's political independence and unified territories allowed artists considerable mobility. Some preferred to return to their native cities in Lombardy, Friuli, or the Veneto, where they established flourishing workshops. Distinctive local traditions—such as the realism of the Lombard painters of Bergamo and Brescia—also endured. The Veneto area in particular served as a country retreat for Venice's patrician families, who erected idyllic villas in the classical tradition designed by Andrea Palladio.
|
<urn:uuid:126c8107-a415-4ef3-8a12-f829949846c4>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.796875,
"fasttext_score": 0.0533674955368042,
"language": "en",
"language_score": 0.9169459939002991,
"url": "http://www.themorgan.org/collection/drawings/141036?id=777"
}
|
From Wikipedia, the free encyclopedia
(Redirected from Far ultraviolet)
Jump to: navigation, search
For other uses, see Ultraviolet (disambiguation).
"UV" redirects here. For other uses, see UV (disambiguation).
Portable ultraviolet lamp
Ultraviolet (UV) light is electromagnetic radiation with a wavelength shorter than that of visible light but longer than X-rays (from 400 nm to 10 nm in wavelength). Though usually invisible, under some conditions children and young adults can see ultraviolet down to wavelengths of about 310 nm,[1][2] and people with aphakia (missing lens) can also see some UV wavelengths. Near-UV is visible to a number of insects and birds.
UV radiation is present in sunlight, and is produced by electric arcs and specialized lights such as mercury-vapor lamps, tanning lamps, and black lights. Although lacking the energy to ionize atoms, ultraviolet radiation can cause chemical reactions, and causes many substances to glow or fluoresce. Consequently, biological effects of UV are greater than simple heating effects, and many practical applications of UV radiation derive from its interactions with organic molecules.
Electric arcs produce UV light, and arc welders must wear eye protection to prevent welder's flash.
Suntan and sunburn are familiar effects of over-exposure. Living things on dry land would be severely damaged by ultraviolet radiation from the sun if most of it were not filtered out by the earth's atmosphere, particularly the ozone layer[3] More-energetic, shorter-wavelength "extreme" UV below 121 nm ionizes air so strongly that it is absorbed before it reaches the ground.[4] Ultraviolet is also responsible for the formation of bone-strengthening vitamin D in most land vertebrates, including humans. The UV spectrum thus has effects both beneficial and harmful to human health.
"Ultraviolet" means "beyond violet" (from Latin ultra, "beyond"), violet being the color of the highest frequencies of visible light. Ultraviolet light has a higher frequency than violet light.
The discovery of UV radiation was associated with the observation that silver salts darkened when exposed to sunlight. In 1801, the German physicist Johann Wilhelm Ritter made the hallmark observation that invisible rays just beyond the violet end of the visible spectrum darkened silver chloride-soaked paper more quickly than violet light itself. He called them "oxidizing rays" to emphasize chemical reactivity and to distinguish them from "heat rays", discovered the previous year at the other end of the visible spectrum. The simpler term "chemical rays" was adopted shortly thereafter, and it remained popular throughout the 19th century, although there were those who held that these were an entirely different sort of radiation from light (notably Professor J.W. Draper, M.D.), who named them "tithonic rays".[5][6] The terms chemical and heat rays were eventually dropped in favour of ultraviolet and infrared radiation, respectively.[7][8] In 1878 the effect of short-wavelength light on sterilizing bacteria was discovered. By 1903 it was known the most effective wavelengths were around 250 nm. In 1960, the effect of ultraviolet radiation on DNA was established. [9]
The electromagnetic spectrum of ultraviolet radiation, defined most broadly as 10–400 nm, can be subdivided into a number of ranges recommended by the ISO standard ISO-21348:[11]
Name Abbreviation Wavelength range
(in nanometres)
Energy per photon
(in electronvolts)
Notes / alternative names
Ultraviolet A UVA 400 – 315 nm 3.10 – 3.94 eV long wave, black light, not absorbed by the ozone layer
Ultraviolet B UVB 315 – 280 nm 3.94 – 4.43 eV medium wave, mostly absorbed by the ozone layer
Ultraviolet C UVC 280 – 100 nm 4.43 – 12.4 eV short wave, germicidal, completely absorbed by the ozone layer and atmosphere
Middle Ultraviolet MUV 300 – 200 nm 4.13 – 6.20 eV
Far Ultraviolet FUV 200 – 122 nm 6.20 – 10.16 eV
Hydrogen Lyman-alpha H Lyman-α 122 – 121 nm 10.16 – 10.25 eV spectral line at 121.6 nm, 10.20 eV
Vacuum Ultraviolet VUV 200 – 10 nm 6.20 – 124 eV strongly absorbed by atmospheric oxygen, though 150–200 nm wavelengths can propagate through nitrogen
Extreme Ultraviolet EUV 121 – 10 nm 10.25 – 124 eV ionizing radiation, completely absorbed by the atmosphere
A variety of solid-state and vacuum devices have been explored for use in different parts of the UV spectrum. Many approaches seek to adapt visible light-sensing devices, but these can suffer from unwanted response to visible light and various instabilities. Ultraviolet light can be detected by suitable photodiodes and photocathodes, which can be tailored to be sensitive to different parts of the UV spectrum. Sensitive ultraviolet photomultipliers are available. Spectrometers and radiometers are made for measurement of UV radiation. Silicon detectors are used across the spectrum. [12]
People cannot perceive UV light directly since the lens of the human eye blocks most light in the wavelength range of 300–400 nm; shorter wavelengths are blocked by the cornea.[13] Nevertheless, the photoreceptors of the retina are sensitive to near-UV light, and people lacking a lens (a condition known as aphakia) perceive near-UV light as whitish-blue or whitish-violet.[14]
Vacuum UV or VUV wavelengths (shorter than 200 nm) are strongly absorbed by molecular oxygen in the air, though the longer wavelengths of about 150–200 nm can propagate through nitrogen. Scientific instruments can therefore utilize this spectral range by operating in an oxygen-free atmosphere (commonly pure nitrogen), without the need for costly vacuum chambers. Significant examples include 193 nm photolithography equipment (for semiconductor manufacturing), and circular dichroism spectrometers.
Technology for VUV instrumentation was largely driven by solar astronomy for many decades. While optics can be used to remove unwanted visible light that contaminates the VUV, in general, detectors can be limited by their response to non-VUV radiation, and the development of "solar-blind" devices has been an important area of research. Wide-gap solid-state devices or vacuum devices with high-cutoff photocathodes can be attractive compared to silicon diodes.
Extreme UV (EUV or sometimes XUV) is characterized by a transition in the physics of interaction with matter. Wavelengths longer than about 30 nm interact mainly with the outer valence electrons of atoms, while wavelengths shorter than that interact mainly with inner shell electrons and nuclei. The long end of the EUV spectrum is set by a prominent He+ spectral line at 30.4 nm. EUV is strongly absorbed by most known materials, but it is possible to synthesize multilayer optics that reflect up to about 50% of EUV radiation at normal incidence. This technology pioneered by the NIXT and MSSTA sounding rockets in the 1990s, has been used to make telescopes for solar imaging.
Levels of ozone at various altitudes and blocking of different bands of ultraviolet radiation. In essence, all UVC is blocked by diatomic oxygen (from 100–200 nm) or by ozone (triatomic oxygen)(200–280 nm) in the atmosphere. The ozone layer then blocks most UVB. Meanwhile, UVA is hardly affected by ozone and most of it reaches the ground.
Solar ultraviolet[edit]
Very hot objects emit UV radiation (see Black-body radiation). The Sun emits ultraviolet radiation at all wavelengths, including the extreme ultraviolet where it crosses into X-rays at 10 nm. Extremely hot stars emit proportionally more UV radiation than the Sun. Sunlight in space at the top of Earth's atmosphere is composed of about 50% infrared light, 40% visible light, and 10% ultraviolet light, for a total ultraviolet power of about 140 W/m2 in vacuum.[15] However, at ground level sunlight is 44% visible light, 3% ultraviolet (with the Sun at its zenith), and the remainder infrared.[16][17]
The atmosphere blocks 77% of the Sun's UV, mostly in the shorter UV wavelengths, when the Sun is highest in the sky (zenith). The figure rises to 97–99% of the Sun's UV radiation at the average mixture of other Sun angles encountered through the day.[18]
The shorter bands of UVC, as well as even more-energetic radiation produced by the Sun, generate the ozone in the ozone layer when single oxygen atoms produced by UV photolysis of dioxygen react with more dioxygen. The ozone layer is especially important in blocking UVB and part of UVC, since the shorter wavelengths are blocked by ordinary air. Of the ultraviolet radiation that reaches the Earth's surface, up to 95% is the longer wavelengths of UVA,[19] depending on cloud cover and atmospheric conditions.
Blockers and absorbers[edit]
Ultraviolet light absorbers are molecules used in organic materials (polymers, paints, etc.) to absorb UV light to reduce the UV degradation (photo-oxidation) of a material. The absorbers can themselves degrade over time, so monitoring of absorber levels in weathered materials is necessary.
In sunscreen, ingredients that absorb UVA/UVB rays, such as avobenzone, oxybenzone[20] and octyl methoxycinnamate, are known as absorbers or chemical "blockers". They are contrasted with physical "blockers" of UV radiation such as titanium dioxide and zinc oxide.
Suspended nanoparticles in stained glass prevent UV light from causing chemical reactions that change image colors. A set of stained glass color reference chips is planned to be used to calibrate the color cameras for the 2019 ESA Mars rover mission, since they will remain unfaded by the high level of UV present at the surface of Mars.[21]
Ordinary glass is partially transparent to UVA but is opaque to shorter wavelengths, whereas silica or quartz glass, depending on quality, can be transparent even to vacuum UV wavelengths. Ordinary window glass passes about 90% of the light above 350 nm, but blocks over 90% of the light below 300 nm.[22][23][24]
Wood's glass is a nickel-bearing form of glass with a deep blue-purple color that blocks most visible light and passes ultraviolet light.
Artificial sources[edit]
"Black lights"[edit]
Lower image: Complete black light lamps, switched on
Main article: Black light
A black light lamp emits long-wave UVA radiation and little visible light. Fluorescent black light lamps use a phosphor on the inner tube surface, which emits UVA light instead of visible light. Some lamps use a deep-bluish-purple Wood's glass optical filter that blocks almost all visible light with wavelengths longer that 400 nanometres. [25] Others use plain glass instead of the more expensive Wood's glass, so they appear light-blue to the eye when operating. A black light may also be formed, very inefficiently, by using a layer of Wood's glass in the envelope for an incandescent bulb. Though cheaper than fluorescent UV lamps, only 0.1% of the input power is converted to usable ultraviolet radiation. Mercury-vapor black lights in ratings up to 1 kW with UV-emitting phosphor and an envelope of Wood's glass are used for theatrical and concert displays. UVA/UVB emitting bulbs are also sold for other special purposes, such as tanning lamps and reptile-keeping.
Short wave ultraviolet lamps[edit]
Commercial germicidal lamp in butcher shop
A shortwave UV lamp can be made using a fluorescent lamp tube with no phosphor coating. These lamps emit ultraviolet light with two peaks in the UVC band at 253.7 nm and 185 nm due to the mercury within the lamp. Eighty-five to 90% of the UV produced by these lamps is at 253.7 nm, whereas only five to ten percent is at 185 nm[citation needed]. The quartz tube passes the 253 nm radiation but blocks the 185 nm wavelength. Such tubes have two or three times the UVC power of a regular fluorescent lamp tube. These low-pressure lamps have a typical efficiency of approximately thirty to forty percent, meaning that for every 100 watts of electricity consumed by the lamp, they will produce approximately 30–40 watts of total UV output. These "germicidal" lamps are used extensively for disinfection of surfaces in laboratories and food processing industries, and for disinfecting water supplies.
Gas-discharge lamps[edit]
Main article: Gas-discharge lamp
Specialized UV gas-discharge lamps containing different gases produce UV light at particular spectral lines for scientific purposes. Argon and deuterium lamps are often used as stable sources, either windowless or with various windows such as magnesium fluoride.[26] These are often the light sources in UV spectroscopy equipment for chemical analysis.
The excimer lamp, a UV light source developed within the last two decades, is seeing increasing use in scientific fields. It has the advantages of high-intensity, high efficiency, and operation at a variety of wavelength bands into the vacuum ultraviolet.
Ultraviolet LEDs[edit]
A 380 nanometre UV LED makes some common household items fluoresce.
Ultraviolet lasers[edit]
Gas lasers, laser diodes and solid-state lasers can be manufactured to emit light in the ultraviolet range. The nitrogen gas laser uses electronic excitation of nitrogen molecules to emit a beam that is mostly UV. The strongest ultraviolet lines are at 337.1 nm and 357.6 nm,wavelength. Another type of high power gas laser is the excimer laser. They are widely-used lasers emitting in ultraviolet and vacuum ultraviolet wavelength ranges.
Direct UV-emitting laser diodes are available at 375 nm.[27] UV diode lasers have been demonstrated using Ce:LiSAF crystals (cerium doped with lithium strontium aluminum fluoride), a process developed in the 1990s at Lawrence Livermore National Laboratory.[28] Wavelengths shorter than 325 nm are commercially generated in Diode-pumped solid-state lasers. Ultraviolet lasers can also be made by applying frequency conversion to lower-frequency lasers.
Ultraviolet lasers have applications in industry (laser engraving), medicine (dermatology, and keratectomy), chemistry (MALDI), free air secure communications, computing (optical storage) and manufacture of integrated circuits.
Human health-related effects[edit]
Further information: Health effects of sun exposure
The impact of ultraviolet radiation on human health has implications for the risks and benefits of sun exposure, and is also implicated in issues such as fluorescent lamps and health.
UVB induces production of vitamin D in the skin at rates of up to 1,000 IUs per minute. The majority of UV's positive health effects are related to this vitamin, which helps to regulate calcium metabolism (vital for the nervous system and bone health), immunity, cell proliferation, insulin secretion, and blood pressure.[29]
The amount of the brown pigment melanin in the skin increases after exposure to UV radiation at moderate levels depending on skin type; this is commonly known as a sun tan. Melanin is an excellent photoprotectant that absorbs both UVB and UVA radiation and dissipates the energy as harmless heat, protecting the skin against both direct and indirect DNA damage.
Harmful effects[edit]
In humans, excessive exposure to UV radiation can result in acute and chronic harmful effects on the skin, eye, and immune system.[30] Overexposure to UVB radiation can cause sunburn and some forms of skin cancer. The World Health Organization (WHO) classified all categories and wavelengths of ultraviolet radiation as a Group 1 carcinogen. The WHO-standard Ultraviolet index is a widely publicized measurement of the strength of UV wavelengths that cause sunburn on human skin.
UVA, UVB, and UVC can all damage collagen fibers and, therefore, accelerate aging of the skin. Both UVA and UVB destroy vitamin A in skin, which may cause further damage.[31]
Sunburn effect (as measured by the UV Index) is the product of the sunlight spectrum (radiation intensity) and the erythemal action spectrum (skin sensitivity) across the range of UV wavelengths.
UVB light can cause direct DNA damage.[32] The mutagenicity of UV radiation can be observed in bacterial cultures. This cancer connection is one reason for concern about ozone depletion and the ozone hole.
Demonstration of the effect of sunscreen. The man's face has sunscreen on his right only. The left image is a regular photograph of the face; the right image shows UV light reflected off the face when illuminated only with UV light. Lighter areas represent more reflected light; the side of the face with sunscreen is darker because the sunscreen absorbs the UV light.
Medical organizations recommend that patients protect themselves from UV radiation by using sunscreen. Five sunscreen ingredients have been shown to protect mice against skin tumors. However, some sunscreen chemicals produce potentially harmful substances if they are illuminated while in contact with living cells.[33][34]
Aggravation of certain skin conditions[edit]
Ultraviolet radiation can aggravate several skin conditions and diseases, including:[35]
Eye damage[edit]
Unshielded exposure of the skin or eyes to mercury arc lamps that do not have a conversion phosphor is quite dangerous. High intensities of UVB light are hazardous to the eyes, and can cause welder's flash or arc eye (photokeratitis and lead to cataracts, pterygium,[36][37] and pinguecula formation.
UV light is absorbed by molecules known as chromophores, which are present in the eye cells and tissues. Chromophores absorb light energy from different wavelengths at different rates, a pattern known as the absorption spectrum. If too much UV light is absorbed, the cornea, the lens, and the retina can be damaged.
Protective eyewear is beneficial to those exposed to ultraviolet radiation, in particular short-wave UV. Since light can reach the eyes from the sides, full-coverage eye protection is usually warranted if there is an increased risk of exposure, as in high-altitude mountaineering. Mountaineers are exposed to higher-than-ordinary levels of UV radiation, both because there is less atmospheric filtering and because of reflection from snow and ice.
Ordinary, untreated eyeglasses give some protection. Most plastic lenses give more protection than glass lenses, because, as noted above, glass is transparent to UVA and the common acrylic plastic used for lenses is less so. Some plastic lens materials, such as polycarbonate, inherently block most UV. Protective coating is available for eyeglass lenses that need it, but even a coating that completely blocks UV will not protect the eye from light that arrives around the lens.
Degradation of polymers, pigments and dyes[edit]
Main article: UV degradation
Many polymers used in consumer products are degraded by UV light, and need addition of UV absorbers to inhibit attack, especially if the products are exposed to sunlight. The problem appears as discoloration or fading, cracking, and, sometimes, total product disintegration if cracking has proceeded sufficiently. The rate of attack increases with exposure time and sunlight intensity.
IR spectrum showing carbonyl absorption due to UV degradation of polyethylene
In addition, many pigments and dyes absorb UV and change colour, so paintings and textiles may need extra protection both from sunlight and fluorescent bulbs, two common sources of UV radiation. Old and antique paintings such as watercolour paintings, for example, usually must be placed away from direct sunlight. Common window glass provides some protection by absorbing some harmful UV, but valuable artifacts need extra shielding. Many museums place black curtains over watercolour paintings and ancient textiles, for example. Since watercolours can have very low pigment levels, they need extra protection from UV light. Tinted glasses, such as sunglasses also provide protection from UV rays.
Because of its ability to cause chemical reactions and excite fluorescence in materials, ultraviolet light has a huge number of useful applications. The following table[38] gives some uses of specific wavelength bands in the UV spectrum
Photographic film responds to ultraviolet radiation but the glass lenses of cameras usually block radiation shorter than 350 nm. Slightly yellow UV-blocking filters are often used for outdoor photography to prevent unwanted bluing and overexposure by UV light. For photography in the near UV, special filters may be used. Photography with wavelengths shorter than 350 nm requires special quartz lenses which do not absorb the radiation. Digital cameras sensors may have internal filters that block UV to improve color rendition accuracy. Sometimes these internal filters can be removed, or they may be absent, and an external visible-light filter prepares the camera for near-UV photography. A few cameras are designed for use in the UV.
Photography by reflected ultraviolet radiation is useful for medical, scientific, and forensic investigations, in applications as wide spread as detecting bruising of skin, alterations of documents, or restoration work on paintings. Photography of the fluorescence produced by ultraviolet illumination uses visible wavelengths of light.
Aurora at Jupiter's north pole as seen in ultraviolet light by the Hubble Space Telescope.
In ultraviolet astronomy, measurements are used to discern the chemical composition of the interstellar medium, and the temperature and composition of stars. Because the ozone layer blocks many UV frequencies from reaching telescopes on the surface of the Earth, most UV observations are made from space.
Electrical and electronics industry[edit]
Corona discharge on electrical apparatus can be detected by its ultraviolet emissions. Corona causes degradation of electrical insulation and emission of ozone and nitrogen oxide. [40]
Some EPROM (erasable programmable read-only memory) modules are erased by exposure to UV radiation. These modules have a transparent (quartz) window on the top of the chip that allows the UV radiation in.
Fluorescent dye uses[edit]
Colorless fluorescent dyes that emit blue light under UV are added as optical brighteners to paper and fabrics. The blue light emitted by these agents counteracts yellow tints that may be present, and causes the colors and whites to appear whiter or more brightly colored.
UV fluorescent dyes that glow in the primary colors are used in paints, papers and textiles either to enhance color under daylight illumination, or to provide special effects when lit with UV lamps. Blacklight paints that contain dyes that glow under UV are used in a number of art and esthetic applications.
To help prevent counterfeiting of currency or forgery of important documents such as credit cards driver's licenses, or passports, the paper may include a UV watermark or fluorescent multicolor fibers that are visible under ultraviolet light. Postage stamps are tagged with a phosphor that glows under UV light to permit automatic detection of the stamp and facing of the letter.
UV fluorescent dyes are used in many applications (for example, biochemistry and forensics). The Green Fluorescent Protein (GFP) is often used in genetics as a marker. Many substances, such as proteins, have significant light absorption bands in the ultraviolet that are of interest in biochemistry and related fields. UV-capable spectrophotometers are common in such laboratories.
Some brands of pepper spray will leave an invisible chemical (UV dye) that is not easily washed off on a pepper-sprayed attacker, which would help police identify the attacker later.[41]
In some types of nondestructive testing UV light stimulates fluorescent dyes to highlight defects in a broad range of materials. These dyes may be carried into surface-breaking defects by capillary action (liquid penetrant inspection) or they may be bound to ferrite particles caught in magnetic leakage fields in ferrous materials (magnetic particle inspection).
Analytic uses[edit]
UV is an investigative tool at the crime scene helpful in locating and identifying bodily fluids such as semen, blood, and saliva.[42] For example, ejaculated fluids or saliva can be detected by high-power UV light sources, irrespective of the structure or colour of the surface the fluid is deposited upon.[43] UV-Vis microspectroscopy is also used to analyze trace evidence, such as textile fibers and paint chips, as well as questioned documents.
Other applications include authentication of various collectibles and art, and detecting counterfeit currency. Even materials not specially marked with UV sensitive dyes may have distinctive fluorescence under UV light, or may fluoresce differently under short-wave versus long-wave ultraviolet.
Enhancing contrast of ink[edit]
Sanitary compliance[edit]
Ultraviolet light aids in the detection of organic material deposits that remain on surfaces where periodic cleaning and sanitizing may not have been properly accomplished. The phenyl and indole chemical moieties in proteins absorb UV, and are made visible by blocking the fluorescence of the material beneath them—often UV brighteners in fabrics. Detergents are easily detected using UV inspection. In "ABS" or alkylbenzenesulfonate detergents, the substituted benzine absorbs UV. Phosphate detergents with a phenyl moiety also absorb.
Pet urine deposits in carpeting or other hard surfaces can be detected for accurate treatment and removal of mineral traces and the odor-causing bacteria that feed on proteins in urine. Many hospitality industries use UV lamps to inspect for unsanitary bedding to determine life-cycle for mattress restoration, as well as general performance of the cleaning staff.[citation needed] A perennial news feature for many television news organizations involves an investigative reporter's using a similar device to reveal unsanitary conditions in hotels, public toilets, hand rails, and such.
UV/VIS spectroscopy is widely used as a technique in chemistry to analyze chemical structure, the most notable one being conjugated systems. UV radiation is often used to excite a given sample where the fluorescent emission is measured with a spectrofluorometer. In biological research, UV light is used for quantification of nucleic acids or proteins.
Ultraviolet lamps are also used in analyzing minerals and gems.
In pollution control applications, ultraviolet analyzers are used to detect emissions of nitrogen oxides, sulfur compounds, mercury and ammonia, for example in the flue gas of fossil fired power plants.[45] Ultraviolet light can detect thin sheens of spilled oil on water, either by the high reflectivity of oil films at UV wavelengths, fluorescence of compounds in oil, or by absorbing of UV light created by Raman scattering in water.[46]
Material science uses[edit]
Fire detection[edit]
See also: Flame detector
In general, ultraviolet detectors use either a solid-state device, such as one based on silicon carbide or aluminium nitride, or a gas-filled tube as the sensing element. UV detectors that are sensitive to UV light in any part of the spectrum respond to irradiation by sunlight and artificial light. A burning hydrogen flame, for instance, radiates strongly in the 185- to 260-nanometer range and only very weakly in the IR region, whereas a coal fire emits very weakly in the UV band yet very strongly at IR wavelengths; thus, a fire detector that operates using both UV and IR detectors is more reliable than one with a UV detector alone. Virtually all fires emit some radiation in the UVC band, whereas the Sun's radiation at this band is absorbed by the Earth's atmosphere. The result is that the UV detector is "solar blind", meaning it will not cause an alarm in response to radiation from the Sun, so it can easily be used both indoors and outdoors.
Ultraviolet radiation is used for very fine resolution photolithography, a procedure wherein a chemical called a photoresist is exposed to UV radiation that has passed through a mask. The light causes chemical reactions to occur in the photoresist. After removal of unwanted photoresist, a pattern determined by the mask remains on the sample. Steps may then be taken to "etch" away, deposit on or otherwise modify areas of the sample where no photoresist remains.
Photolithography is used in the manufacture of semiconductors, integrated circuit components,[47] and printed circuit boards. Photolithography processes used to fabricate electronic integrated circuits presently use 193 nm UV, and are experimentally using 13.5 nm UV for extreme ultraviolet lithography.
Effects of UV on finished surfaces in 0, 20 and 43 hours.
Certain inks, coatings, and adhesives are formulated with photoinitiators and resins. When exposed to the correct energy and irradiance in the required band of UV light, polymerization occurs, and so the adhesives harden or cure. Usually, this reaction is very quick, a matter of a few seconds. Applications include glass and plastic bonding, optical fiber coatings, the coating of flooring, UV Coating and paper finishes in offset printing, dental fillings, and decorative finger nail "gels".
An industry has developed around the manufacture of UV sources for UV curing applications. This includes UV lamps, UV LEDs, and Excimer flash lamps. Fast processes such as flexo or offset printing require high-intensity light focused via reflectors onto a moving substrate and medium; and high-pressure Hg (mercury) or Fe (iron, doped)-based bulbs are used, which can be energized with electric arc or microwaves. Lower-power sources (fluorescent lamps, LED) can be used for static applications, and, in some cases, small high-pressure lamps can have light focused and transmitted to the work area via liquid-filled or fiber-optic light guides.
The impact of UV on polymers is used for modification of the (roughness and hydrophobicity) of polymer surfaces. For example, a poly(methyl methacrylate) surface can be smoothed by vacuum ultraviolet.[48]
UV radiation is useful in preparing low-surface-energy polymers for adhesives. Polymers exposed to UV light will oxidize, thus raising the surface energy of the polymer. Once the surface energy of the polymer has been raised, the bond between the adhesive and the polymer is stronger.
Biology-related uses[edit]
Air purification[edit]
Using a catalytic reaction from titanium dioxide and UV light exposure, a strong oxidative effect occurs on any organic objects that pass through the media, converting otherwise-irritating pathogens, pollens, and mold spores into harmless inert byproducts.
UV light has also been shown (by KJ Scott et al.) as effective in reducing gaseous contaminants such as carbon monoxide and VOCs.[49][50][51] Scott and his colleagues demonstrated that the correct mixture of UV lamps radiating at 184 and 254 nm can remove low concentrations of hydrocarbons and carbon monoxide, if the lamps are held in a radiation chamber (a box or drum) and the air is recycled between the room and the reaction chamber. This arrangement prevents the introduction of ozone into the treated air. Likewise, air may be treated by passing by a single UV source operating at 184 nm and subsequent catalysis with iron pentaoxide. The iron oxides remove the ozone produced by the UV lamp.
A low-pressure mercury vapor discharge tube floods the inside of a hood with shortwave UV light when not in use, sterilizing microbiological contaminants from irradiated surfaces.
Ultraviolet lamps are used to sterilize workspaces and tools used in biology laboratories and medical facilities. Commercially available low-pressure mercury-vapor lamps emit about 86% of their light at 254 nanometers (nm), which coincides very well with one of the two peaks of the germicidal effectiveness curve (i.e., effectiveness for UV absorption by DNA). One of these peaks is at about 265 nm and the other is at about 185 nm. Although 185 nm is better absorbed by DNA, the quartz glass used in commercially available lamps, as well as environmental media such as water, are more opaque to 185 nm than 254 nm (C. von Sonntag et al., 1992). UV light at these germicidal wavelengths causes adjacent thymine molecules on DNA to dimerize; if enough of these defects accumulate on a microorganism's DNA, its replication is inhibited, thereby rendering it harmless (even though the organism may not be killed outright). However, since microorganisms can be shielded from ultraviolet light in small cracks and other shaded areas, these lamps are used only as a supplement to other sterilization techniques.
Ultraviolet radiation is used in several food processes to kill unwanted microorganisms. UV light can be used to pasteurize fruit juices by flowing the juice over a high-intensity ultraviolet light source.[53] The effectiveness of such a process depends on the UV absorbance of the juice.
Butterflies use ultraviolet as a communication system for sex recognition and mating behavior. For example, in the Colias eurytheme butterfly, males rely on visual cues to locate and identify females. Instead of using chemical stimuli to find mates, males are attracted to the ultraviolet-absorbing color of female hind wings.[54]
Entomologist using a UV light for collecting beetles in the Paraguayan Chaco.
Ultraviolet traps called bug zappers are used to eliminate various small flying insects. They are attracted to the UV light, and are killed using an electric shock, or trapped once they come into contact with the device. Different designs of ultraviolet light traps are also used by entomologists for collecting nocturnal insects during faunistic survey studies.
Ultraviolet radiation is helpful in the treatment of skin conditions such as psoriasis and vitiligo. Exposure to UVA light while the skin is hyper-photosensitive by taking psoralens is an effective treatment for psoriasis. Due to the potential of psoralens to cause damage to the liver, PUVA therapy may be used only a limited number of times over a patient's lifetime.
UVB phototherapy does not require additional medications or topical preparations for the therapeutic benefit; only the light exposure is needed. However, phototherapy can be effective when used in conjunction with certain topical treatments such as anthralin, coal tar, and Vitamin A and D derivatives, or systemic treatments such as methotrexate and soriatane.[55]
Reptiles need long-wave UVA light for synthesis of vitamin D, which in turn is needed to metabolize calcium for bone and egg production. Thus, in a typical reptile enclosure, a fluorescent UV lamp should be available for vitamin D synthesis. This should be combined with the provision of heat for basking, either by the same lamp or another. Certain reptiles such as Bearded Dragons need both UVA and UVB light.
Evolutionary significance[edit]
Evolution of early reproductive proteins and enzymes is attributed in modern models of evolutionary theory to ultraviolet light. UVB light causes thymine base pairs next to each other in genetic sequences to bond together into thymine dimers, a disruption in the strand that reproductive enzymes cannot copy. This leads to frameshifting during genetic replication and protein synthesis, usually killing the cell. Before formation of the UV-blocking ozone layer, when early prokaryotes approached the surface of the ocean, they almost invariably died out. The few that survived had developed enzymes that monitored the genetic material and removed thymine dimers by nucleotide excision repair enzymes. Many enzymes and proteins involved in modern mitosis and meiosis are similar to repair enzymes, and are believed to be evolved modifications of the enzymes originally used to overcome DNA damages caused by UV light.[56]
See also[edit]
1. ^ Lynch, David K.; Livingston, William Charles (2001). Color and Light in Nature (2nd ed.). Cambridge, UK: Cambridge University Press. p. 231. ISBN 978-0-521-77504-5. Retrieved 12 October 2013. "Limits of the eye's overall range of sensitivity extends from about 310 to 1050 nanometers"
2. ^ Dash, Madhab Chandra; Dash, Satya Prakash (2009). Fundamentals Of Ecology 3E. Tata McGraw-Hill Education. p. 213. ISBN 978-1-259-08109-5. Retrieved 18 October 2013. "Normally the human eye responds to light rays from 390 to 760 nm. This can be extended to a range of 310 to 1,050 nm under artificial conditions."
3. ^ "Reference Solar Spectral Irradiance: Air Mass 1.5". Retrieved 2009-11-12.
4. ^ Haigh, Joanna D. (2007). "The Sun and the Earth's Climate: Absorption of solar spectral radiation by the atmosphere". Living Reviews in Solar Physics 4 (2). Retrieved July 12, 2014.
5. ^ "On a new Imponderable Substance and on a Class of Chemical Rays analogous to the rays of Dark Heat", J.W. Draper, The London, Edinburgh, and Dublin Philosophical Magazine and Journal of Science, 1842, LXXX, pp.453-461
6. ^ "Description of the Tithonometer", J.W. Draper, The Practical Mechanic and Engineer's Magazine, January 1844, pp.122-127
7. ^ Beeson, Steven; Mayer, James W. "12.2.2 Discoveries beyond the visible". Patterns of light: chasing the spectrum from Aristotle to LEDs. New York: Springer. p. 149. ISBN 978-0-387-75107-8.
8. ^ Hockberger, P.E. (2002). "A history of ultraviolet photobiology for humans, animals and microorganisms". Photochem. Photobiol. 76 (6): 561–579. doi:10.1562/0031-8655(2002)076<0561:AHOUPF>2.0.CO;2. PMID 12511035.
9. ^ James Bolton, Christine Colton, The Ultraviolet Disinfection Handbook, American Water Works Association, 2008 ISBN 978 1 58321 584 5, pp. 3-4
10. ^ The ozone layer protects humans from this. Lyman, T. (1914). "Victor Schumann". Astrophysical Journal 38: 1–4. Bibcode:1914ApJ....39....1L. doi:10.1086/142050.
11. ^ "ISO 21348 Definitions of Solar Irradiance Spectral Categories".
12. ^ "Gullikson, Korde, Canfield, Vest, " Stable Silicon Photodiodes for absolute intensity measurements in the VU V and soft x-ray regions", Jrnl of Elec. Spect. and Related Phenomena 80(1996) 313–316". Ts.nist.gov. Archived from the original on 2009-01-09. Retrieved 2011-11-08.
13. ^ M A Mainster (2006). "Violet and blue light blocking intraocular lenses: photoprotection versus photoreception". British Journal of Ophthalmology 90 (6): 784–792. doi:10.1136/bjo.2005.086553. PMC 1860240. PMID 16714268.
14. ^ David Hambling (29 May 2002). "Let the light shine in". The Guardian.
15. ^ Solar radiation
16. ^ Solar constant at ground level
18. ^ Ozone layer, retrieved 2007-09-23
19. ^ Understanding UVA and UVB, retrieved 2012-04-30
20. ^ Burnett, M. E. and Wang, S. Q. (2011), Current sunscreen controversies: a critical review. Photodermatology, Photoimmunology & Photomedicine, 27: 58–67
22. ^ "Soda Lime Glass Transmission Curve".
23. ^ "B270-Superwite Glass Transmission Curve".
24. ^ "Selected Float Glass Transmission Curve".
25. ^ Insect-O-Cutor
26. ^ Klose, Jules Z.; Bridges, J. Mervin; Ott, William R. (June 1987). "NBS Measurement Services: Radiometric Standards in the VUV" (PDF). NBS Special publication (US Dept. of Commerce) (250-3).
27. ^ [1] UV laser diode, not module with DPSS technology.
28. ^ Marshall, Chris (1996). "A simple, reliable ultraviolet laser: the Ce:LiSAF". Lawrence Livermore National Laboratory. Retrieved 2008-01-11.
29. ^ "Vitamin D". Oregon State University. Retrieved 2011-11-08.
30. ^ "Health effects of UV radiation". World Health Organization.
31. ^ Torma, H; Berne, B; Vahlquist, A (1988). "UV irradiation and topical vitamin A modulate retinol esterification in hairless mouse epidermis". Acta Derm. Venereol. 68 (4): 291–299. PMID 2459873.
32. ^ Bernstein C, Bernstein H, Payne CM, Garewal H (June 2002). "DNA repair/pro-apoptotic dual-role proteins in five major DNA repair pathways: fail-safe protection against carcinogenesis". Mutat. Res. 511 (2): 145–78. doi:10.1016/S1383-5742(02)00009-1. PMID 12052432.
33. ^ Xu, C.; Green, Adele; Parisi, Alfio; Parsons, Peter G (2001). "Photosensitization of the Sunscreen Octyl p-Dimethylaminobenzoate b UVA in Human Melanocytes but not in Keratinocytes.". Photochemistry and Photobiology 73 (6): 600–604. doi:10.1562/0031-8655(2001)073<0600:POTSOP>2.0.CO;2. PMID 11421064.
34. ^ Knowland, John; McKenzie, Edward A.; McHugh, Peter J.; Cridland, Nigel A. (1993). "Sunlight-induced mutagenicity of a common sunscreen ingredient.". FEBS Letters 324 (3): 309–313. doi:10.1016/0014-5793(93)80141-G. PMID 8405372.
35. ^ European Guidelines for Photodermatoses > 2 Photoaggravated Disorders at European Dermatology Forum
36. ^ Nolan, T. M. et al. (2003). "The Role of Ultraviolet Irradiation and Heparin-Binding Epidermal Growth Factor-Like Growth Factor in the Pathogenesis of Pterygium". American Journal of Pathology (American Journal of Pathology) 162 (2): 567–574. doi:10.1016/S0002-9440(10)63850-3. PMC 1851157. PMID 12547714.
37. ^ Di Girolamo, N. et al. (1 August 2005). "Epidermal Growth Factor Receptor Signaling Is Partially Responsible for the Increased Matrix Metalloproteinase-1 Expression in Ocular Epithelial Cells after UVB Radiation". American Journal of Pathology 167 (2): 489–503. doi:10.1016/S0002-9440(10)62992-6. PMC 1603570. PMID 16049334.
38. ^ s-et.com at the Wayback Machine (archived August 20, 2008)
39. ^ "Ultraviolet Light, UV Rays, What is Ultraviolet, UV Light Bulbs, Fly Trap". Pestproducts.com. Retrieved 2011-11-08.
40. ^ "Corona – The Daytime UV Inspection Magazine".
41. ^ "Pepper Spray FAQ". [dead link]
42. ^ Springer, E; Almog, J; Frank, A; Ziv, Z; Bergman, P; Gui Quang, W (1994). "Detection of dry bodily fluids by inherent short wavelength UV luminescence: Preliminary results.". Forensic Sci Int 66 (2): 89–94. doi:10.1016/0379-0738(94)90332-8. Retrieved 2012-02-14.
44. ^ "Digital Photography of Documents". wells-geneaology.org.uk.
45. ^ N. E. Battikha (ed), The Condensed Handbook of Measurement and Control 3rd Ed. ISA 2007 ISBN 1-55617-995-2, pp. 65-66
46. ^ Mervin Fingas (ed.) Oil Spill Science and Technology Elsevier, 2011 ISBN 978-1-85617-943-0 pp. 123-124
47. ^ "Deep UV Photoresists". Archived from the original on 2006-03-12.
48. ^ R. V. Lapshin, A. P. Alekhin, A. G. Kirilenko, S. L. Odintsov, V. A. Krotkov (2010). "Vacuum ultraviolet smoothing of nanometer-scale asperities of poly(methyl methacrylate) surface" (PDF). Journal of Surface Investigation. X-ray, Synchrotron and Neutron Techniques (Russia: Pleiades Publishing) 4 (1): 1–11. doi:10.1134/S1027451010010015. ISSN 1027-4510. (Russian translation is available).
50. ^ Scott, KJ; Wills, RBH (1973). "Atmospheric pollutants destroyed in an ultra violet scrubber.". Laboratory Practice 22 (2): 103–6. PMID 4688707.
52. ^ "Solar Water Disinfection". Sodis.ch. 2 April 2011. Retrieved 2011-11-08.
53. ^ Rulfsorchard.com
54. ^ Silberglied, Robert E., and Orley R. Taylor. (1978) Ultraviolet Reflection and Its Behavioral Role in the Courtship of the Sulfur Butterflies Colias eurytheme and C. philodice (Lepidoptera, Pieridae). Behavioral Ecology and Sociobiology 3(3):203-43.
55. ^ "UVB Phototherapy" (php). National Psoriasis Foundation, USA. Archived from the original on 22 June 2007. Retrieved 2007-09-23.
56. ^ Margulis, Lynn and Sagan, Dorion (1986). Origins of Sex: Three Billion Years of Genetic Recombination (book). 1. Yale University Press. ISBN 978-0-300-04619-9.
Further reading[edit]
|
<urn:uuid:fa2b31e1-dca9-4dd2-89b3-375e1a079f28>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.6875,
"fasttext_score": 0.07298541069030762,
"language": "en",
"language_score": 0.8823590278625488,
"url": "http://en.wikipedia.org/wiki/Far_ultraviolet"
}
|
Wet Forest
High elevation and more than 100 inches of rainfall a year are the physical ingredients for the wet forest, or wao akua. These would have been the most common native plants in that ecosystem: Wet Forest uses plant photos courtesy of the UH Botany Dept. Descriptive text is taken from How to Plant a Native Hawaiian Garden - an on line handbook. It also relies on Feathered Gods and Fishhooks by Patrick V. Kirch.
Hame - endemic
'Ohi'a Lehua - `Ohi`a lehua wood is extremely hard, reddish, takes a fine polish but is difficult to cure. Hawaiians used the wood for tools, weapons and images. Endemic to all the main islands except Kaho`olawe and Ni`ihau.
Olapa -endemic. The leaves of the olapa move gracefully with the slightest breeze, like hula dancers. Ho'awa - eight different endemic species.
Loulu - A total of 19 loulu have been tentatively identified as endemic to the Hawaiian Islands.
'Ohe - one of five endemic species.
Hapu'u - the most common endemic tree fern in Hawai`i. Found on most islands in semi-dry to wet forests, it is most conspicuous on Hawai`i where it grows in close association with `Ohi`a lehua. During ancient times, pulu (tree-fern silk) was used for dressing wounds and for embalming. The starchy centers of hapu'u trunks, cooked in the imu (earth oven), are famine food.
The animals that successfully dispersed to the ahupua'a of Nawiliwili Bay began their adaptive radiation (changing to survive different ecosystems) in the kaha kai (coastal zone), the kula (lowland dry and mesic forest), and the wao akua (wet forest). They became the native animals of this area.
Created June 2001
|
<urn:uuid:27b3d689-7d44-4e2a-8df8-5e2e1ca2a6e6>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 4,
"fasttext_score": 0.04833179712295532,
"language": "en",
"language_score": 0.9262601733207703,
"url": "http://www.hawaii.edu/environment/ainakumuwai/html/ainakumuwaiwetforest.htm"
}
|
Drosophila melanogaster
From Wikipedia, the free encyclopedia
(Redirected from Common fruit fly)
Jump to: navigation, search
Drosophila melanogaster
Drosophila melanogaster - side (aka).jpg
Male Drosophila melanogaster
Scientific classification
Kingdom: Animalia
Phylum: Arthropoda
Class: Insecta
Order: Diptera
Family: Drosophilidae
Genus: Drosophila
Subgenus: Sophophora
Species group: melanogaster group
Species subgroup: melanogaster subgroup
Species complex: melanogaster complex
Species: D. melanogaster
Binomial name
Drosophila melanogaster
Meigen, 1830[1]
View from above
Front view
Drosophila melanogaster is a species of fly (the taxonomic order Diptera) in the family Drosophilidae. The species is known generally as the common fruit fly or vinegar fly. Starting with Charles W. Woodworth's proposal of the use of this species as a model organism, D. melanogaster continues to be widely used for biological research in studies of genetics, physiology, microbial pathogenesis, and life history evolution. It is typically used because it is an animal species that is easy to care for, has four pairs of chromosomes, breeds quickly, and lays many eggs.[2] D. melanogaster is a common pest in homes, restaurants, and other occupied places where food is served.[3]
Flies belonging to the family Tephritidae are also called "fruit flies". This can cause confusion, especially in Australia and South Africa, where the Mediterranean fruit fly Ceratitis capitata is an economic pest.
Physical appearance[edit]
Female (left) and male (right) D. melanogaster
Wildtype fruit flies are yellow-brown, with brick-red eyes and transverse black rings across the abdomen. They exhibit sexual dimorphism: females are about 2.5 millimeters (0.098 in) long; males are slightly smaller with darker backs. Males are easily distinguished from females based on colour differences, with a distinct black patch at the abdomen, less noticeable in recently emerged flies (see fig.), and the sexcombs (a row of dark bristles on the tarsus of the first leg). Furthermore, males have a cluster of spiky hairs (claspers) surrounding the reproducing parts used to attach to the female during mating. There are extensive images at FlyBase.[4]
Lifecycle and reproduction[edit]
Egg of D. melanogaster
The D. melanogaster lifespan is about 30 days at 29 °C (84 °F). It had been recorded that their lifespan can be increased to 3 months.[5][not in citation given]
The developmental period for D. melanogaster varies with temperature, as with many ectothermic species. The shortest development time (egg to adult), 7 days, is achieved at 28 °C (82 °F).[6][7] Development times increase at higher temperatures (11 days at 30 °C or 86 °F) due to heat stress. Under ideal conditions, the development time at 25 °C (77 °F) is 8.5 days,[6][7][8] at 18 °C (64 °F) it takes 19 days[6][7] and at 12 °C (54 °F) it takes over 50 days.[6][7] Under crowded conditions, development time increases,[9] while the emerging flies are smaller.[9][10] Females lay some 400 eggs (embryos), about five at a time, into rotting fruit or other suitable material such as decaying mushrooms and sap fluxes. The eggs, which are about 0.5 mm long, hatch after 12–15 hours (at 25 °C or 77 °F).[6][7] The resulting larvae grow for about 4 days (at 25 °C) while molting twice (into second- and third-instar larvae), at about 24 and 48 h after hatching.[6][7] During this time, they feed on the microorganisms that decompose the fruit, as well as on the sugar of the fruit itself. The mother puts feces on the egg sacs to establish the same microbial composition in the larvae's guts which has worked positively for herself.[11] Then the larvae encapsulate in the puparium and undergo a four-day-long metamorphosis (at 25 °C), after which the adults eclose (emerge).[6][7]
Mating fruit flies: Note the sex combs on the forelegs of the male (insert)
Females become receptive to courting males at about 8–12 hours after emergence.[12] Specific neuron groups in females have been found to affect copulation behavior and mate choice. One such group in the abdominal nerve cord allows the female fly to pause her body movements to copulate.[13] Activation of these neurons induces the female to cease movement and orient herself towards the male to allow for mounting. If the group is inactivated, the female remains in motion and does not copulate. Various chemical signals such as male pheromones often are able to activate the group.[13]
The female fruit fly prefers a shorter duration when it comes to sex. Males, on the other hand, prefer it to last longer.[14] Males perform a sequence of five behavioral patterns to court females. First, males orient themselves while playing a courtship song by horizontally extending and vibrating their wings. Soon after, the male positions itself at the rear of the female's abdomen in a low posture to tap and lick the female genitalia. Finally, the male curls its abdomen, and attempts copulation. Females can reject males by moving away, kicking, and extruding their ovipositor.[15] Copulation lasts around 15–20 minutes,[16] during which males transfer a few hundred, very long (1.76 mm) sperm cells in seminal fluid to the female.[17] Females store the sperm in a tubular receptacle and in two mushroom-shaped spermathecae; sperm from multiple matings compete for fertilization. A last male precedence is believed to exist in which the last male to mate with a female sires about 80% of her offspring. This precedence was found to occur through both displacement and incapacitation.[18] The displacement is attributed to sperm handling by the female fly as multiple matings are conducted and is most significant during the first 1–2 days after copulation. Displacement from the seminal receptacle is more significant than displacement from the spermathecae.[18] Incapacitation of first male sperm by second male sperm becomes significant 2–7 days after copulation. The seminal fluid of the second male is believed to be responsible for this incapacitation mechanism (without removal of first male sperm) which takes effect before fertilization occurs.[18] The delay in effectiveness of the incapacitation mechanism is believed to be a protective mechanism that prevents a male fly from incapacitating its own sperm should it mate with the same female fly repetitively. Sensory neurons in the uterus of female D. melanogaster respond to a male protein, sex peptide, which is found in sperm.[13] This protein makes the female reluctant to copulate for about 10 days after insemination. The signal pathway leading to this change in behavior has been determined. The signal is sent to a brain region that is a homolog of the hypothalamus and the hypothalamus then controls sexual behavior and desire[13]
D. melanogaster is often used for life extension studies, such as to identify genes purported to increase lifespan when mutated.[citation needed]
Male sexual behavior and learning[edit]
Behavior refers to the actions an organism might take in response to various internal or external inputs. Changes in behavior may indicate learning, which is when an organism adapts to a situation or phenomenon by changing a particular behavioral response. Learning is usually associated with an increase in fitness; this is especially true when the adapted behavior is an aspect of sexual behavior.
In addition, males with previous sexual experience will modify their courtship dance when attempting to mate with new females — the experienced males spend less time courting and therefore have lower mating latencies, meaning that they are able to reproduce more quickly. This decreased mating latency leads to a greater mating efficiency for experienced males over naïve males.[20] This modification also appears to have obvious evolutionary advantages, as increased mating efficiency is extremely important in the eyes of natural selection.
History of use in genetic analysis[edit]
Model organism in genetics[edit]
Thomas Hunt Morgan's Drosophila melanogaster genetic linkage map. This was the first successful gene mapping work and provides important evidence for the chromosome theory of inheritance. The map shows shows the relative positions of allelic characteristics on the second Drosophila chromosome. The distance between the genes (map units) are equal to the percentage of crossing-over events that occurs between different alleles.
D. melanogaster is one of the most studied organisms in biological research, particularly in genetics and developmental biology. The several reasons include:
• Its care and culture requires little equipment and uses little space even when using large cultures, and the overall cost is low.
• It is small and easy to grow in the laboratory and its morphology is easy to identify once anesthetized (usually with ether, carbon dioxide gas, by cooling, or with products like FlyNap).
• It has a short generation time (about 10 days at room temperature), so several generations can be studied within a few weeks.
• It has a high fecundity (females lay up to 100 eggs per day, and perhaps 2000 in a lifetime).[2]
• Males and females are readily distinguished and virgin females are easily isolated, facilitating genetic crossing.
• The mature larvae show giant chromosomes in the salivary glands called polytene chromosomes—"puffs" indicate regions of transcription and hence gene activity.
• Males do not show meiotic recombination, facilitating genetic studies.
• Recessive lethal "balancer chromosomes" carrying visible genetic markers can be used to keep stocks of lethal alleles in a heterozygous state without recombination due to multiple inversions in the balancer.
• Genetic transformation techniques have been available since 1987.
• Its complete genome was sequenced and first published in 2000.[22]
Genetic markers[edit]
• Cy1: Curly; the wings curve away from the body, flight may be somewhat impaired.
• e1: ebony; black body and wings (heterozygotes are also visibly darker than wild type).
• Sb1: stubble; bristles are shorter and thicker than wild type.
• w1: white; eyes lack pigmentation and appear white.
• y1: yellow; body pigmentation and wings appear yellow. This is the fly analog of albinism.
Drosophila genes are traditionally named after the phenotype they cause when mutated. For example, the absence of a particular gene in Drosophila will result in a mutant embryo that does not develop a heart. Scientists have thus called this gene tinman, named after the Oz character of the same name.[23] This system of nomenclature results in a wider range of gene names than in other organisms.
The genome of D. melanogaster (sequenced in 2000, and curated at the FlyBase database[22]) contains four pairs of chromosomes: an X/Y pair, and three autosomes labeled 2, 3, and 4. The fourth chromosome is so tiny, it is often ignored, aside from its important eyeless gene. The D. melanogaster sequenced genome of 139.5 million base pairs has been annotated[24] and contains around 15,682 genes according to Ensemble release 73. More than 60% of the genome appears to be functional non-protein-coding DNA[25] involved in gene expression control. Determination of sex in Drosophila occurs by the X:A ratio of X chromosomes to autosomes, not because of the presence of a Y chromosome as in human sex determination. Although the Y chromosome is entirely heterochromatic, it contains at least 16 genes, many of which are thought to have male-related functions.[26]
Similarity to humans[edit]
About 75% of known human disease genes have a recognizable match in the genome of fruit flies,[27] and 50% of fly protein sequences have mammalian homologs. An online database called Homophila is available to search for human disease gene homologues in flies and vice versa.[28] Drosophila is being used as a genetic model for several human diseases including the neurodegenerative disorders Parkinson's, Huntington's, spinocerebellar ataxia and Alzheimer's disease. The fly is also being used to study mechanisms underlying aging and oxidative stress, immunity, diabetes, and cancer, as well as drug abuse.
D. melanogaster oogenesis
Sex determination[edit]
X Chromosomes Autosomes Ratio of X:A Sex
XXXX AAAA 1 Normal Female
XXX AAA 1 Normal Female
XXY AA 1 Normal Female
XXYY AA 1 Normal Female
XX AA 1 Normal Female
X AA 0.50 Normal Male (sterile)
XXX AA 1.50 Metafemale
XXXX AAA 1.33 Metafemale
XX AAA 0.66 Intersex
X AAA 0.33 Metamale
Unlike mammals, Drosophila flies only have innate immunity and lack an adaptive immune response. The D. melanogaster immune system can be divided into two responses: humoral and cell-mediated. The former is a systemic response mediated through the Toll and imd pathways, which are parallel systems for detecting microbes. The Toll pathway in Drosophila is known as the homologue of Toll-like pathways in mammals. Spatzle, a known ligand for the Toll pathway in flies, is produced in response to Gram-positive bacteria, parasites, and fungal infection. Upon infection, pro-Spatzle will be cleaved by protease SPE (Spatzle processing enzyme) to become active Spatzle, which then binds to the Toll receptor located on the cell surface (Fat body, hemocytes) and dimerise for activation of downstream NF-κB signaling pathways. The imd pathway, though, is triggered by Gram-negative bacteria through soluble and surface receptors (PGRP-LE and LC, respectively). D. melanogaster has a "fat body", which is thought to be homologous to the human liver. It is the primary secretory organ and produces antimicrobial peptides. These peptides are secreted into the hemolymph and bind infectious bacteria, killing them by forming pores in their cell walls. Years ago[when?] many drug companies wanted to purify these peptides and use them as antibiotics. Other than the fat body, hemocytes, the blood cells in Drosophila, are known as the homologue of mammalian monocyte/macrophages, possessing a significant role in immune responses. It is known from the literature that in response to immune challenge, hemocytes are able to secrete cytokines, for example Spatzle, to activate downstream signaling pathways in the fat body. However, the mechanism still remains unclear.
Behavioral genetics and neuroscience[edit]
Furthermore, Drosophila has been used in neuropharmacological research, including studies of cocaine and alcohol consumption. Models for Parkinson's disease also exist for flies.[33]
Stereo images of the fly eye
Expression of rhodopsin1 (Rh1) in photoreceptors R1-R6
About two-thirds of the Drosophila brain is dedicated to visual processing.[38] Although the spatial resolution of their vision is significantly worse than that of humans, their temporal resolution is around 10 times better.
The wings of a fly are capable of beating up to 220 times per second.[citation needed] Flies fly via straight sequences of movement interspersed by rapid turns called saccades.[39] During these turns, a fly is able to rotate 90° in less than 50 milliseconds.[39]
Characteristics of Drosophila flight may be dominated by the viscosity of the air, rather than the inertia of the fly body, but the opposite case with inertia as the dominant force may occur.[39] However, subsequent work showed that while the viscous effects on the insect body during flight may be negligible, the aerodynamic forces on the wings themselves actually cause fruit flies' turns to be damped viscously.[40]
As a pest[edit]
Drosophila is commonly considered a pest due to its tendency to infest habitations and establishments where fruit is found; the flies may collect in homes, restaurants, stores, and other locations.[3] Removal of an infestation can be difficult, as larvae may continue to hatch in nearby fruit even as the adult population is eliminated.
See also[edit]
3. ^ a b http://ento.psu.edu/extension/factsheets/vinegar-flies
4. ^ "FlyBase: A database of Drosophila genes and genomes". Genetics Society of America. 2009. Retrieved August 11, 2009.
5. ^ http://rosemuellergreerlabs.com/portfolio/aging/gallery/research-interests/
6. ^ a b c d e f g Ashburner M, Thompson JN (1978). "The laboratory culture of Drosophila". In Ashburner M, Wright TRF. The genetics and biology of Drosophila 2A. Academic Press. 1–81.
7. ^ a b c d e f g Ashburner M, Golic KG, Hawley RS (2005). Drosophila: A Laboratory Handbook. (2nd ed.). Cold Spring Harbor Laboratory Press. pp. 162–4. ISBN 0-87969-706-7.
8. ^ Bloomington Drosophila Stock Center at Indiana University: Basic Methods of Culturing Drosophila
9. ^ a b Chiang HC, Hodson AC (1950). "An analytical study of population growth in Drosophila melanogaster". Ecological Monographs 20 (3): 173–206. doi:10.2307/1948580. JSTOR 1948580.
10. ^ Bakker K (1961). "An analysis of factors which determine success in competition for food among larvae of Drosophila melanogaster". Archives Neerlandaises de Zoologie 14 (2): 200–281. doi:10.1163/036551661X00061.
11. ^ Blum, J.E., Fischer, C.N., Miles, J. and Handelsman, J. (2013) Frequent replenishment sustains the beneficial microbiome of Drosophila melanogaster. mBio 4, e00860–13
12. ^ Pitnick S (1996). "Investment in testes and the cost of making long sperm in Drosophila". American Naturalist 148: 57–80. doi:10.1086/285911.
14. ^ Maggie Koerth-Baker (August 21, 2009). "Female Flies Put Up a Fight to Keep Sex Short". National Geographic News. Retrieved August 21, 2009.
15. ^ Connolly, Kevin; Cook, Robert (1973). "Rejection Responses by Female Drosophila melanogaster: Their Ontogeny, Causality and Effects upon the Behaviour of the Courting Male". Behaviour 44 (1/2): 142–166. doi:10.1163/156853973x00364. Retrieved October 23, 2014.
16. ^ Houot, B.; Svetec, N.; Godoy-Herrera, R.; Ferveur, J. -F. (2010). "Effect of laboratory acclimation on the variation of reproduction-related characters in Drosophila melanogaster". Journal of Experimental Biology 213 (Pt 13): 2322–2331. doi:10.1242/jeb.041566. PMID 20543131.
17. ^ Gilbert SF (2006). "9: Fertilization in Drosophila". In 8th. Developmental Biology. Sinauer Associates. ISBN 978-0-87893-250-4.
18. ^ a b c Price, Catherine; Dyer, Kelly; Coyne, Jerry (1999). "Sperm competition between Drosophila males involves both displacement and incapacitation". Nature 400 (6743): 449–452. Bibcode:1999Natur.400..449P. doi:10.1038/22755. PMID 10440373.
19. ^ Dukas, Reuven (2004). "Male fruit flies learn to avoid interspecific courtship". Behavioral Ecology 15 (4): 695–698. doi:10.1093/beheco/arh068.
20. ^ Saleem, S; Ruggles, PH; Abbott, WK; Carney, GE (2014). "Sexual Experience Enhances Drosophila melanogaster Male Mating Behavior and Success". PLoS ONE 9 (5). doi:10.1371/journal.pone.0096639.
21. ^ a b Pierce, Benjamin A (2004). Genetics: A Conceptual Approach (2nd ed.). W. H. Freeman. ISBN 978-0-7167-8881-2.
22. ^ a b Adams MD, Celniker SE, Holt RA et al. (2000). "The genome sequence of Drosophila melanogaster". Science 287 (5461): 2185–95. Bibcode:2000Sci...287.2185.. doi:10.1126/science.287.5461.2185. PMID 10731132. Retrieved 2007-05-25.
23. ^ Azpiazu N, Frasch M (1993). "tinman and bagpipe: two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila". Genes and Development 7 (7b): 1325–1340. doi:10.1101/gad.7.7b.1325. PMID 8101173.
25. ^ Halligan DL, Keightley PD (2006). "Ubiquitous selective constraints in the Drosophila genome revealed by a genome-wide interspecies comparison". Genome Research 16 (7): 875–84. doi:10.1101/gr.5022906. PMC 1484454. PMID 16751341.
26. ^ Carvalho, AB (2002). "Origin and evolution of the Drosophila Y chromosome". Current Opinion in Genetics & Development 12 (6852): 664–668. doi:10.1016/S0959-437X(02)00356-8.
27. ^ Reiter, LT; Potocki, L; Chien, S; Gribskov, M; Bier, E (2001). "A Systematic Analysis of Human Disease-Associated Gene Sequences In Drosophila melanogaster". Genome Research 11 (6): 1114–1125. doi:10.1101/gr.169101. PMC 311089. PMID 11381037.
28. ^ Chien, Samson; Reiter, Lawrence T.; Bier, Ethan; Gribskov, Michael (1 January 2002). "Homophila: human disease gene cognates in Drosophila". Nucleic Acids Research (National Library of Medicine (NLM)) 30 (1): 149–151. doi:10.1093/nar/30.1.149. PMC 99119. PMID 11752278. Retrieved August 24, 2013.
29. ^ a b Katrin Weigmann, Robert Klapper, Thomas Strasser, Christof Rickert, Gerd Technau, Herbert Jäckle, Wilfried Janning & Christian Klämbt (2003). "FlyMove – a new way to look at development of Drosophila". Trends in Genetics 19 (6): 310–311. doi:10.1016/S0168-9525(03)00050-7. PMID 12801722.
30. ^ Gilbert S.F. (2000). Developmental Biology. 6th edition. Sunderland (MA): Sinauer Associates; 2000.
31. ^ Lehnert, B. P.; Baker, A. E.; Gaudry, Q; Chiang, A. S.; Wilson, R. I. (2013). "Distinct roles of TRP channels in auditory transduction and amplification in Drosophila". Neuron 77 (1): 115–28. doi:10.1016/j.neuron.2012.11.030. PMC 3811118. PMID 23312520.
32. ^ Zhang, W; Yan, Z; Jan, L. Y.; Jan, Y. N. (2013). "Sound response mediated by the TRP channels NOMPC, NANCHUNG, and INACTIVE in chordotonal organs of Drosophila larvae". Proceedings of the National Academy of Sciences 110 (33): 13612–7. doi:10.1073/pnas.1312477110. PMC 3746866. PMID 23898199.
33. ^ Wiemerslage L, Schultz BJ, Ganguly A, Lee D (2013). "Selective degeneration of dopaminergic neurons by MPP(+) and its rescue by D2 autoreceptors in Drosophila primary culture.". J Neurochem 126 (4): 529–40. doi:10.1111/jnc.12228. PMID 23452092.
34. ^ Hardie RC, Raghu P (2001). "Visual transduction in Drosophila". Nature 413 (6852): 186–93. doi:10.1038/35093002. PMID 11557987.
35. ^ Nichols R, Pak WL (1985). "Characterization of Drosophila melanogaster rhodopsin". Journal of Biological Chemistry 260 (23): 12670–4. PMID 3930500.
36. ^ a b Raghu P, Colley NJ, Webel R et al. (2000). "Normal phototransduction in Drosophila photoreceptors lacking an InsP(3) receptor gene". Molecular and Cellular Neuroscience 15 (5): 429–45. doi:10.1006/mcne.2000.0846. PMID 10833300.
37. ^ Wang T, Xu H, Oberwinkler J, Gu Y, Hardie R, Montell C et al. (2005). "Light activation, adaptation, and cell survival Functions of the Na+/Ca2+ exchanger CalX". Neuron 45 (3): 367–378. doi:10.1016/j.neuron.2004.12.046. PMID 15694299.
38. ^ Rein, K. and Zockler, M. and Mader, M.T. and Grubel, C. and Heisenberg, M. (2002). "The Drosophila Standard Brain". Current Biology 12 (3): 227–231. doi:10.1016/S0960-9822(02)00656-5. PMID 11839276.
39. ^ a b c S. Fry and M. Dickinson (2003). "The aerodynamics of free-flight maneuvers in Drosophila" (PDF). Science 300 (5618): 495–8. Bibcode:2003Sci...300..495F. doi:10.1126/science.1081944. PMID 12702878.
40. ^ T. Hesselberg and F.-O. Lehmann (2007). "Turning behaviour depends on frictional damping in the fruit fly "Drosophila"". The Journal of Experimental Biology 210 (Pt 24): 4319–34. doi:10.1242/jeb.010389. PMID 18055621.
Further reading[edit]
Popular media[edit]
External links[edit]
|
<urn:uuid:6fb72e6b-538a-4c32-af57-efef92b857fb>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.546875,
"fasttext_score": 0.0421866774559021,
"language": "en",
"language_score": 0.870067298412323,
"url": "https://en.wikipedia.org/wiki/Common_fruit_fly"
}
|
View Full Document
Unformatted Document Excerpt
1. The following prokaryotic DNA sequence encodes an mRNA. a. Circle the promoter consensus sequences found on the coding strand of DNA 2 pts b. Write out the mRNA sequence encoded by this gene (indicate the 5 and 3 ends). 4 pts c. Translate that mRNA sequence into an amino acid sequence using the provided genetic code (indicate the N and C termini of the polypeptide). 4 pts 5 AACATTGACACCGTAACTGTACGCTCATATATTCGATCGGCTTAGATGCCT GCTTACCGGGAGTAAGCCATCGA 3 3 TTGTAACTGTGGCATTGACATGCGAGTATATAAGCTAGCCGAATCTACGGACGAATGGCCCTCATTCGGTAGCT 5 mRNA sequence: amino acid sequence: 2. The following table shows part of the sequence of a gene, with both DNA strands, the mRNA strand and the amino acid sequence indicated. Complete the table, including all of the nucleotides and amino acids. Label the 5 and 5 ends of each nucleotide strand. 2.5 pts 1 2 3 4 5 6 7 8 9 10 11 12 DNA double helix-- C G T C A T A T C AG G T T G A G A MRNA GC A U G G A Amino acids Trp Ser 3. The normal sequence of a particular protein is given here, along with several mutant versions of it. For each mutant, explain what mutation occurred in the coding sequence of the gene. Assume only a single mutational event explains each altered amino acid sequence. 4 pts () = multiple unspecified amino acids * On the final, you would only be asked about one mutant. Normal: Met-Gly-Glu-Thr-Lys-Val-Val-()-Pro Mutant 1: Met-Gly Mutant 2: Met-Gly-Glu-Asp Mutant 3: Met-Gly-Arg-Leu-Lys Mutant 4: Met-Arg-Glu-Thr-Lys-Val-Val-()-Pro 4. In the replication bubble below, label all ends of newly made DNA (in bold) with either 5 or 3 (as shown in one example below): 2 pts... View Full Document
End of Preview
Sign up now to access the rest of the document
|
<urn:uuid:c1da2589-5d56-4e93-84e1-2756350c35d2>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.6175979375839233,
"language": "en",
"language_score": 0.8195921182632446,
"url": "http://www.coursehero.com/file/6969395/202finalprac2/"
}
|
Breaking News
Researchers studying the various dialects of Japanese have concluded that all are descended from a founding language taken to the Japanese islands about 2,200 years ago. The finding sheds new light on the origin of the Japanese people, suggesting that their language is descended from that of the rice-growing farmers who arrived in Japan from the Korean Peninsula, and not from the hunter-gatherers who first inhabited the islands some 30,000 years ago.
The result provides support for a wider picture, controversial among linguists, that the distribution of many language families today reflects the spread of agriculture in the distant past when farming populations, carrying their languages with them, grew in numbers and expanded at the expense of hunter-gatherers. Under this theory, the Indo-European family of languages, which includes English, was spread by the first farmers who expanded into Europe from the Middle East some 8,000 years ago, largely replacing the existing population of hunter-gatherers.
comments powered by Disqus
|
<urn:uuid:e6129f79-94b6-4689-b28e-1133ea855552>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.765625,
"fasttext_score": 0.059960901737213135,
"language": "en",
"language_score": 0.9506289958953857,
"url": "http://historynewsnetwork.org/article/139008"
}
|
Why Does Cereal Get Soggy in Milk?
The atoms in milk move more quickly than the atoms in cereal, because liquids have faster atomic movement than solids, and the smashing of the milk atoms against the cereal atoms leads to diffusion. Diffusion is a scientific term for the breaking down of a solid.
Cereal initially floats on the milk because it has a lower density. As the milk diffuses into the cereal, the density of the cereal increases, which is why the soggy flakes make their way to the bottom of the bowl. Sugary cereals take longer to become soggy, because the milk has to work through the sugary film on the cereal before hitting the flakes themselves.
|
<urn:uuid:5ff59f63-5377-4b06-8be2-5f36cbfd5b7c>
|
{
"dataset": "HuggingFaceTB/dclm-edu",
"edu_int_score": 4,
"edu_score": 3.53125,
"fasttext_score": 0.9997720122337341,
"language": "en",
"language_score": 0.9531124234199524,
"url": "https://www.reference.com/food/cereal-soggy-milk-8194333ae29cfb0"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.