added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:26:58.000Z
|
rhb2z2udo7sgmc6rcuy57qi56cv63gjj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18927",
"uncompressed_offset": 613774248,
"url": "www.panarmenian.net/eng/news/115525/",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.panarmenian.net/eng/news/115525/"
}
|
cccc_CC-MAIN-2013-20
|
Afghan women march to protest Taliban public execution
PanARMENIAN.Net - Over 100 women and a handful of men took to the streets of the Afghan capital on Wednesday, July 11 to call on the government to do more to protect women's rights after the public execution of a young woman sparked an international outcry, Reuters reported.
Mothers cradling babies and schoolgirls in uniform chanted "Death to the men who killed our sister!", days after Reuters obtained a video of a 22-year-old woman being riddled with bullets to cheers of jubilation from a male crowd just over an hour's drive from Kabul.
Officials in Kabul blamed the Taliban for the killing last month of the woman named Najiba, who was accused of adultery, in a village in Parwan province.
The Islamist group denied it, saying if they had carried it out, "proper" sharia, Islamic law, would have been applied.
"We are grateful for the aid money, but we want it to be used to bring women justice and peace, the Afghan government needs to be held accountable," said Wazhma Frogh, a leading Afghan women's rights activist, at the protest.
Behind her, headscarved women under blazing sunshine held up a banner reading: "International community - where is the protection and justice for Afghan women?"
News of the public execution emerged as donors in Tokyo pledged $16 billion in development aid over the next four years for Afghanistan, as they try to prevent it from sliding back into chaos once most foreign troops have left by the end of 2014.
But war weariness and donor fatigue are taking their toll on the impoverished country, ranked by a major global poll last year the world's worst place to be a woman, and some Afghan women are beginning to feel left out of the equation.
Afghan women have won back basic rights in education, voting and work since the Taliban were ousted from power but fears are mounting both at home and abroad that such freedoms could be traded away as Kabul seeks peace talks with the group.
Violence against women has been steadily increasing in Afghanistan, according to the country's independent human rights commission, and activists blame this on what they say is waning interest in women's rights on the part of President Hamid Karzai's government.
"It's clear the government doesn't care about these matters, if they did there would have been justice for women all these past years," said Nilofar Haidary, from activist group Young Women For Change, who helped organize the protest.
Karzai strongly condemned the killing of Najiba, calling it a "heinous crime" reminiscent of Taliban rule, who were ousted in 2001 after five years in power.
A manhunt has been launched for the alleged Taliban members involved in her killing, police in Parwan's provincial capital Charikar said on Wednesday.
Partner news
Top stories
Jorge Rafael Videla, an austere former army commander, led Argentina during the bloodiest days of its Dirty War dictatorship.
According to the United Nations, April was Iraq's bloodiest month for almost five years, with 712 people killed.
Reports suggest the rebel fighters may have tried to blow up the walls of the prison, which holds some 4,000 inmates.
Moscow has condemned other nations for supporting rebel forces and failing to condemn what it describes as terrorist attacks on the Syrian regime.
Partner news
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:21:07.000Z
|
i7zdxbj3w3bm7ytzgmpp4tmcha4e7vgi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18932",
"uncompressed_offset": 667416151,
"url": "www.seroundtable.com/archives/002819.html",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.seroundtable.com/archives/002819.html"
}
|
cccc_CC-MAIN-2013-20
|
WebmasterWorld Pub Con 10 Session Wrap Up
Nov 17, 2005 • 9:11 am | (2) by | Filed Under WebmasterWorld 2005 Las Vegas
The WebmasterWorld Pub Conference 10 went very well, I am skipping out on the "pub" portion of the "pub con" but here is a run down of my coverage. Oh, don't forget, SES Chicago in about two weeks, we will have triple coverage of that event.
Tuesday, November 15, 2005
Wednesday, November 16, 2005
Previous story: Google Knows Link Networks Well
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:14:43.000Z
|
2oyvqhi3p4natzmopdee4jfyrstd2rl2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18933",
"uncompressed_offset": 667424770,
"url": "www.seroundtable.com/archives/020631.html",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.seroundtable.com/archives/020631.html"
}
|
cccc_CC-MAIN-2013-20
|
Daily Search Forum Recap: August 21, 2009
Aug 21, 2009 • 4:00 pm | (0) by | Filed Under Search Forum Recap
Here is a recap of what happened in the search forums today, through the eyes of the Search Engine Roundtable and other search forums on the web.
Search Engine Roundtable Stories:
• Should Google Place Advertiser's Info In AdWords Mouse Over Effect
A WebmasterWorld member thinks it would be a wise idea if Google added a new level of detail to the AdWords listings. I believe his idea is to display a mouse over control which would open up a more detailed box that shows advertiser details. This would allow the searcher to better know if he should click or not. I decided to draw up a proof of concept, using Bing's search preview option and adding
• Bing Search Results In Google
Google seems to be indexing Bing search results. Take a look at this query and you will see some of the Google search results leading to Bing search results. So I decided to check to see if Yahoo, Ask.com or even Bing themselves were doing the same. It seems like Ask.com is also doing this, but Yahoo and Bing are not indexing Bing results. Google doesn't like to see search results in search results so
• Can A/B Testing Cause An SEO Problem?
A/B testing is the process of setting up two or more styles for a page, for the same piece of content. For example, let's say you had a page where you sold blue widgets and you wanted to try using a blue button versus a red button to buy the widget. What you can do is A/B test the two types of buttons against each other. How would you accomplish this? Well, you can send
Other Great Search Forum Threads:
Previous story: Should Google Place Advertiser's Info In AdWords Mouse Over Effect
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:49:52.000Z
|
25zrskhy7w6utmn32myq3jbhbdqujkqu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18937",
"uncompressed_offset": 683551101,
"url": "www.sourcewatch.org/index.php/Barbara_T._Alexander",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.sourcewatch.org/index.php/Barbara_T._Alexander"
}
|
cccc_CC-MAIN-2013-20
|
CMD sent two reporters to track ALEC in Oklahoma
Click here to help support our future investigations.
Barbara T. Alexander
From SourceWatch
Jump to: navigation, search
Barbara T. Alexander became a Director of QUALCOMM in July 2006. "Ms. Alexander has been an independent consultant since February 2004. From October 1999 to January 2004 she was a Senior Advisor for UBS, and from January 1992 to September 1999 she was a Managing Director of Dillon Read & Co., Inc. In 1987, Salomon Brothers Inc. appointed Ms. Alexander the first female managing director in the company's history. She currently serves on the boards of Harrah's Entertainment, Centex Corporation and Freddie Mac. Ms. Alexander is a visiting fellow at the Joint Center for Housing Studies at Harvard University, has served on the boards of Habitat for Humanity International and Covenant House, and currently serves on the board of HomeAid America. She is a graduate of the University of Arkansas, Fayetteville, where she earned B.S and M.S. degrees in theoretical mathematics." [1]
Resources and articles
Related Sourcewatch articles
References
1. Directors, QUALCOMM, accessed January 29, 2009.
Personal tools
Namespaces
Variants
Actions
Navigation
How To
Other Info
Other Policies
Google AdSense
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:55:26.000Z
|
2qclaswp6e4xd36ky7mwa3lturoudzap
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18948",
"uncompressed_offset": 767052431,
"url": "www.werelate.org/wiki/Person:Isabel_of_France_%281%29",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.werelate.org/wiki/Person:Isabel_of_France_(1)"
}
|
cccc_CC-MAIN-2013-20
|
Person:Isabel of France (1)
Browse
Isabel of France
b.Mar 1225
d.23 Feb 1270
Facts and Events
Name Isabel of France
Gender Female
Birth[1] Mar 1225
Death[1] 23 Feb 1270
Other[1] House of Capet
the text in this section is copied from an article in Wikipedia
Isabelle of France (March 1225 – 23 February 1270) was the daughter of Louis VIII of France and Blanche of Castile. She was a younger sister of King Louis IX of France (Saint Louis) and of Alfonso, Count of Poitiers, and an older sister of King Charles I of Sicily. In 1256 she founded the Poor Clare Monastery of Longchamp in the part of the Forest of Rouvray now called the Bois de Boulogne, west of Paris. She is honored as a saint by the Franciscan Order.
This page uses content from the English Wikipedia. The original content was at Isabel of France. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
References
1. 1.0 1.1 1.2 Isabel of France, in Wikipedia: The Free Encyclopedia. (Online: Wikimedia Foundation, Inc.).
2. ISABELLE de France, in Cawley, Charles. Medieval Lands: A prosopography of medieval European noble and royal families.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:33:20.000Z
|
mz7qkucjo2pyvv4amxbtbwjehkoczwhs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18949",
"uncompressed_offset": 767070907,
"url": "www.werelate.org/wiki/Place:Falmouth,_Hants,_Nova_Scotia,_Canada",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.werelate.org/wiki/Place:Falmouth,_Hants,_Nova_Scotia,_Canada"
}
|
cccc_CC-MAIN-2013-20
|
Place:Falmouth, Hants, Nova Scotia, Canada
Watchers
NameFalmouth
TypeCommunity
Located inHants, Nova Scotia, Canada
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Falmouth is a Canadian village located along the Avon River in Hants County between Mount Denson and Windsor.
Research Tips
This page uses content from the English Wikipedia. The original content was at Falmouth, Nova Scotia. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:20:38.000Z
|
7qtdxqvnattt3saus7jpmhxxjrw7i7b7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18950",
"uncompressed_offset": 771039374,
"url": "www.wikidoc.org/index.php/Collagenopathy,_types_II_and_XI",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://www.wikidoc.org/index.php/Collagenopathy,_types_II_and_XI"
}
|
cccc_CC-MAIN-2013-20
|
Collagenopathy, types II and XI
Jump to: navigation, search
WikiDoc Resources for
Collagenopathy, types II and XI
Articles
Most recent articles on Collagenopathy, types II and XI
Most cited articles on Collagenopathy, types II and XI
Review articles on Collagenopathy, types II and XI
Articles on Collagenopathy, types II and XI in N Eng J Med, Lancet, BMJ
Media
Powerpoint slides on Collagenopathy, types II and XI
Images of Collagenopathy, types II and XI
Photos of Collagenopathy, types II and XI
Podcasts & MP3s on Collagenopathy, types II and XI
Videos on Collagenopathy, types II and XI
Evidence Based Medicine
Cochrane Collaboration on Collagenopathy, types II and XI
Bandolier on Collagenopathy, types II and XI
TRIP on Collagenopathy, types II and XI
Clinical Trials
Ongoing Trials on Collagenopathy, types II and XI at Clinical Trials.gov
Trial results on Collagenopathy, types II and XI
Clinical Trials on Collagenopathy, types II and XI at Google
Guidelines / Policies / Govt
US National Guidelines Clearinghouse on Collagenopathy, types II and XI
NICE Guidance on Collagenopathy, types II and XI
NHS PRODIGY Guidance
FDA on Collagenopathy, types II and XI
CDC on Collagenopathy, types II and XI
Books
Books on Collagenopathy, types II and XI
News
Collagenopathy, types II and XI in the news
Be alerted to news on Collagenopathy, types II and XI
News trends on Collagenopathy, types II and XI
Commentary
Blogs on Collagenopathy, types II and XI
Definitions
Definitions of Collagenopathy, types II and XI
Patient Resources / Community
Patient resources on Collagenopathy, types II and XI
Discussion groups on Collagenopathy, types II and XI
Patient Handouts on Collagenopathy, types II and XI
Directions to Hospitals Treating Collagenopathy, types II and XI
Risk calculators and risk factors for Collagenopathy, types II and XI
Healthcare Provider Resources
Symptoms of Collagenopathy, types II and XI
Causes & Risk Factors for Collagenopathy, types II and XI
Diagnostic studies for Collagenopathy, types II and XI
Treatment of Collagenopathy, types II and XI
Continuing Medical Education (CME)
CME Programs on Collagenopathy, types II and XI
International
Collagenopathy, types II and XI en Espanol
Collagenopathy, types II and XI en Francais
Business
Collagenopathy, types II and XI in the Marketplace
Patents on Collagenopathy, types II and XI
Experimental / Informatics
List of terms related to Collagenopathy, types II and XI
The type II and XI collagenopathies are a group of disorders that affect connective tissue, the tissue that supports the body's joints and organs. These disorders are caused by defects in type II or type XI collagen. Collagens are complex molecules that provide structure, strength, and elasticity to connective tissue. Type II and type XI collagen disorders are grouped together because both types of collagen are components of the cartilage found in joints and the spinal column, the inner ear, and the jelly-like substance that fills the eyeball (the vitreous). The type II and XI collagenopathies result in similar clinical features.
Genetic changes are related to the following types of collagenopathy, types II and XI.
The system for classifying collagenopathies is changing as researchers learn more about the genetic causes of these disorders.The clinical features of the type II and XI collagenopathies vary among the disorders, but there is considerable overlap. Common signs and symptoms include problems with bone development that can result in short stature, enlarged joints, spinal curvature, and arthritis at a young age. For some people, bone changes can be seen only on X-ray images. Problems with vision and hearing, as well as a cleft palate with a small lower jaw, are common. Some individuals with these disorders have distinctive facial features such as protruding eyes and a flat nasal bridge.
Mutations in the COL11A1, COL11A2, and COL2A1 genes cause collagenopathy, types II and XI. These genes carry instructions for the protein strands that make up type II and type XI collagen. All collagen molecules are made of three protein strands (called alpha chains). The alpha chains may be identical or different, depending on the type of collagen. Type II collagen is made by combining three copies of the alpha chain made by the COL2A1 gene. Type XI collagen, on the other hand, is composed of three different alpha chains: the products of the COL2A1, COL11A1, and COL11A2 genes.
Mutations in these genes interfere with the proper assembly of type II and XI collagens or reduce the amount of these collagens. Defective or reduced numbers of collagen molecules affect the development of bones and other connective tissues, causing the signs and symptoms of the type II and XI collagenopathies.
This article incorporates public domain text from The U.S. National Library of Medicine
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:07:42.000Z
|
mdi2lxp6uol7fgbs7jaxzqq2tjdfggie
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18953",
"uncompressed_offset": 797693014,
"url": "yourretailhelper.blogspot.com/2012/08/40-aa-or-40-aaa-batteries-for-12-reg-40.html",
"warc_date": "2013-11-22T14:53:30.000Z",
"warc_filename": "<urn:uuid:79d65202-b4af-4880-9488-d02e232c0e40>",
"warc_url": "http://yourretailhelper.blogspot.com/2012/08/40-aa-or-40-aaa-batteries-for-12-reg-40.html"
}
|
cccc_CC-MAIN-2013-20
|
Looking for a Store/Retail Deal? Search here.
Loading...
Saturday, August 4, 2012
40 AA or 40 AAA Batteries for $12 (Reg $40) + Free Shipping
You could stash these away for Christmas! Get 40 AA or AAA GP Ultra Plus Alkaline Batteries via Saveology for $12 (Reg $40). Plus, Shipping is FREE.
Click on the "Home Goods" deals to see this offer.
Don’t want to miss a single deal? Go here to get Hot Deals sent directly to your Inbox! Thanks for joining Your Retail Helper.
This post may contain affiliate links. Go here to see our full Disclosure Statement.
Copyright Information
©2010–2012 Your Retail Helper All rights reserved. No content on this site may be reused in any fashion without written permission.
This work is licensed under a Creative Commons Attribution 3.0 United States License. THIS WORK BY YOUR RETAIL HELPER IS LICENSED UNDER A CREATIVE COMMONS LICENSE. YOU ARE FREE TO USE ANY INFORMATION FOUND ON THIS SITE AS LONG AS PROPER CREDIT IS GIVEN TO YOUR RETAIL HELPER AND A LINK BACK IS PROVIDED. IF YOU HAVE ANY QUESTIONS, PLEASE CONTACT US.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:19:28.000Z
|
kvjluvv457cdczg24s5gwzp7zegzphnd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18956",
"uncompressed_offset": 443083,
"url": "2012.igem.org/Team:Manitoba/Safety",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://2012.igem.org/Team:Manitoba/Safety"
}
|
cccc_CC-MAIN-2013-20
|
Team:Manitoba/Safety
From 2012.igem.org
This is a template page. READ THESE INSTRUCTIONS.
You are provided with this team page template with which to start the iGEM season. You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki. You can find some examples HERE.
You MUST have all of the pages listed in the menu below with the names specified. PLEASE keep all of your pages within your teams namespace.
Home Team Official Team Profile Project Parts Submitted to the Registry Modeling Notebook Safety Attributions
Use this page to answer the questions on the safety page.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:01:11.000Z
|
ek2hdsptnr4n4c4wpv5s7l5xvkdpqr3s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18976",
"uncompressed_offset": 27807484,
"url": "blog.mozilla.org/ux/2012/12/welcome-arun-ganesan-our-new-ux-designer/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://blog.mozilla.org/ux/2012/12/welcome-arun-ganesan-our-new-ux-designer/"
}
|
cccc_CC-MAIN-2013-20
|
Welcome, Arun Ganesan, our new UX designer!
Larissa
0
Arun joined us a couple of weeks ago as an Interaction Designer on Firefox OS. Here’s what he has to say about himself:
Before I joined Mozilla, I had a great time studying Human-Computer Interaction at Carnegie Mellon University and designing Augmented Reality greeting cards for Hewlett-Packard. I love products and people; Most happiest when in the company of books, tech, or my best buddies or when I am enjoying the bright sunny outdoors.
Welcome, Arun! We hope you’ll enjoy working with us :)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:55:26.000Z
|
7a7vjtpw3f45uuwd6xanwov4olhbv3xt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:18990",
"uncompressed_offset": 43991351,
"url": "ccsenet.org/journal/index.php/mas/article/view/3932",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://ccsenet.org/journal/index.php/mas/article/view/3932"
}
|
cccc_CC-MAIN-2013-20
|
Review of Study on Resin Dye-Fixatives on Cotton Fabrics
Yikai Yu, Yuejun Zhang
Abstract
This paper introduced the study on preparation and properties of resin dye-fixatives on cotton fabrics in detail, and analysize the relations between their different structures, molecular weight and their fastness properties, from which some disciplines were obtained. Lastly, some suggestions on resolving the shortcomings of resin dye-fixatives on cotton fabrics were given according to the liturature results.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Modern Applied Science ISSN 1913-1844 (Print) ISSN 1913-1852 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:32:07.000Z
|
555mslyloccswltdfentdv7stxbvq5bz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19009",
"uncompressed_offset": 79073773,
"url": "dotnetkicks.com/stories/8620/Banker_s_Rounding_vs_Common_Rounding_in_NET",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://dotnetkicks.com/stories/8620/Banker_s_Rounding_vs_Common_Rounding_in_NET"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
Banker's Rounding vs. Common Rounding in .NET
0
kicks
Banker's Rounding vs. Common Rounding in .NET (Unpublished)
Depending on your math background, .NET's rounding functionality MAY NOT work the way you expect!!! Check out the included code to implement an alternative (known as Common Rounding) in addition to .NET's built-in Math.Round() function.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:04:11.000Z
|
ob5lrrqd5bk5573hgvn77knxubhfzvhc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19014",
"uncompressed_offset": 84878966,
"url": "elinux.org/index.php?oldid=106286&title=RPi_Buying_Guide",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://elinux.org/index.php?title=RPi_Buying_Guide&oldid=106286"
}
|
cccc_CC-MAIN-2013-20
|
RPi Buying Guide
From eLinux.org
Revision as of 12:28, 5 March 2012 by Psergiu (Talk | contribs)
Jump to: navigation, search
Contents
Back to the Hub
Getting Started:
Buying Guide - for advice on buying the Raspberry Pi.
SD Card Setup - for information on how to prepare the SD Card used to boot your Raspberry Pi.
Basic Setup - for help with buying / selecting other hardware and setting it up.
Beginners Guide - you are up and running, now what can you do?
Advanced Setup - for more extensive information on setting up.
Trouble Shooting - some things to check if things don't work as expected.
Ordering
Raspberry Pi has appointed Premier Farnell and RS Components as its authorised manufacturing distributors.
If you see the units for sale from other sources (in particular eBay), it is likely that they are at BEST hopeful resellers, or SCAM sites, either way units will not be available any sooner than through the above distributors, or you will pay far more than it is worth (if you get it at all).
Raspberry Pi's distributors will ship worldwide to the best of their ability (ie subject to origin export and local import laws).
Countries that are currently subject to UK (including EU and UN) export restrictions include North Korea, Iran, Ivory Coast, Liberia and Zimbabwe. A full list and further details are provided at [1]
For shipping costs, please refer to the websites of the authorised resellers.
Premier Farnell Worldwide
Premier Farnell also trades worldwide under the names Farnell, Element14, Newark Electronics, CPC and MCM Electronics.
RS Components Worldwide
RS Components also trades worldwide under the names Electrocomponents, Allied Electronics and DesignSpark.
Sales order numbers
• Allied Electronics: 70229569
• CPC Farnell: SC12590
• Farnell, Element 14: 2081185 or 83T1943
• FarnellNewark.br: currently unknown
• Newark: 83T1943
• RS, Electrocomponents: currently unknown
Australia
Brazil
Bulgaria
Cambodia
Both distributors ship from their Singapore depot:
Canada
China
Denmark
France
(March 3, 2012 at 9:55 am: Reports that RS requires company details; Farnell postage is expensive)
Germany
Hong Kong
Hungary
Italy
Note: The VAT number is mandatory to complete the pre-order with Farnell, the same is for the registration to the RS website (i.e. you have to register as a company).
India
Indonesia
Ireland
Japan
Korea
Laos
Both companies supply from their Singapore depot:
Malaysia
Myanmar
Mexico
Netherlands
New Zealand
Phillipines
Poland
Portugal
Romania
Russia
Singapore
Spain
Sweden
Taiwan
Thailand
Ukraine
UK
USA
Vietnam
Both distributors supply from their Singapore depots:
Other
Please carefully check whether any of the following companies operate in your territory:
If not, you can use the export service of the following companies. There will be extra shipping and duties to be paid when using this option.
1st Production Run & Release
The initial 10,000 RaspberryPi Boards have sold out. Preorders for coming batches are possible.
1. The foundation have built an initial run of 10,000 Model-B units.
2. Due to extreme demand, the units will be NOT sold directly from the shop (see #Licensed Manufacture below).
3. You may buy a Raspberry Pi from Farnell or from RS Components
4. A limit of one unit per person - unfortunately this also means no combined shipping for this batch (demand depends how long this will be enforced)*
5. Normal unlimited sales should take place quickly after.
* There were reports that several people ordered multiple units at launch,
however it appears that Farnell removed any excess items when they reviewed
and confirmed the order for shipping dates.
This has also appears to apply for the pre-orders they have taken.
1st Batch Order FAQ
NOTE: While every attempt has been made to provide accurate information,
this FAQ is not official and is based on what information is available at the time of writing.
Press Releases
Farnell:
Post-Launch FAQ by Farnell, see their attached docx file for details.
RS Components:
Post-Launch statement by RS Components
Raspberry Pi, Your Questions Answered by RS Components
Q: Couldn't this have been handled better, I couldn't get on the site to order and they sold too quickly?
Both distributors were indeed unprepared for the volume of traffic the launch generated (they were warned by the foundation before hand).
Chances are if the foundation had gone with their original plan of selling through their own shop, the situation would have been far worse, with no option of pre-order either.
The distributors only have 5,000 units each to sell, reports have estimated the registered interest/pre-orders totalling over 2 million (no official figures available yet). Even if it is half of that, it means the number of available units was less than 1% of the demand.
Q: If interest was obviously so high...why only build 10,000 units?
There is a big risk involved with building a large batch of units and selling them, and 10,000 units would take well over $250,000 in capital investment. For a very small charity, that is a massive ask in itself. Much of that funding came from the Foundation Trustees' own personal investment.
Thankfully, the massive bonus of licensing out manufacture, is that the build rate is no longer limited by the foundation's own funding, which means there will be many more units available much sooner.
Q: I've been unable to register an account with the distributor, as I am not a company?
There have been several reported problems with individuals placing orders (i.e. not having company accounts or details).
Both distributors "should" take orders from individuals, however it appears each of the different localised sites may have different requirements so this will be investigated to ensure that this is corrected if needed.
Often, many of the company related fields on application are optional, if in doubt contact their sales team for help.
Q: Worldwide launch? It was not available here!
The distributors decided to make the units only available from selected locations, it appears the foundation were not made aware of this beforehand.
Considering the small number of available units, it would have been unlikely to have improved the situation.
Worldwide availability will be monitored, it is expected that they will be made available as soon as possible.
Q: The price for the RPi from Farnell verses the price from RS Components is different, why?
RS Components (at least for the UK) do not include shipping costs for non-corporate accounts. Farnell (again for the UK) will ship for free.
Q: I've only been able to register my interest, what now?
Be patient, both distributors have said they will contact people when they have more details (alternatively keep an eye on their sites for news).
RS Components, in particular have only taken people's details, and according to the above press-release will wait until they receive their allocated 5,000 units.
Q: I registered on the Raspberry Pi Site's Mailing List but I didn't get an email
Unfortunately, the mail server had problems with sending out the 100K+ emails in time, it is believed the email was often marked as spam by a lot of email systems so was rejected or returned on-mass, or sent to Junk folders. Yes, this system should have been tested, but the foundation were keen not to send unnecessary emails to people prior to launch.
The email contained the same information about the announcement as was publicly posted on the website (28th Feb 2012) before launch day, no additional or extra information was given through the email.
Licensed Manufacture
The foundation has chosen to license manufacture of the RPi, which should provide several advantages including:
1. The involvement of RS Components and Premier Farnell means that build volume can be increased much, much faster than would have been possible otherwise. Due to costs and working capital, the foundation would have been limited to batches of only 10k Raspberry Pis; the Raspberry Pi will now be being built to match demand.
2. Both Premier Farnell and RS Components have worldwide distribution networks, so wherever you are in the world, you will be able to buy from a local distributor. It’s a much better way for you to buy than getting them all shipped from the Foundation in the UK.
3. Both RS Components and Premier Farnell will be taking preorders, something which the foundation would otherwise be unable to do.
4. The foundation will still receive a percentage from the sale of every RPi sold, which will be put straight back into the charity.
5. Primarily, by removing the focus on dealing with manufacture, distribution and sales, this frees up the limited resources of the foundation to focus on the original aims and goals of the project.
Additional detail is available in the video interview between Eben Upton and SlashDot here (28/02/12).
What You Get In The Box
This is unconfirmed until units start to ship:
1. Pre-Assembled Raspberry Pi board
2. Quick Start Guide (likely to be paper copy of RPi Model-AB Guide)
Note:
1. The board will be supplied assembled (since most of the components are not suitable for home builds, including the BGA[1]package mounted SoC[2] and PoP[3] memory).
2. The board will NOT have GPIO or JTAG header pins (are not supplied, although may be available from the shop later on).
3. The board will NOT have CSI and DSI connectors fitted (needs confirmation).
4. All other connectors will be assembled in place.
Accessories
Some accessories will be made available from the shop (farnell have several bundles planned):
• USB Power Supply (UK/EU/US Compatible)[4]
• Pre-Prepared System SD-Card (software will be provided to prepare your own) -size is unconfirmed
• Cases (will be available in a few months - i.e. Q2 2012)
• AddOn/Expansion Boards (will be available later on - i.e. GertBoard due soon)
See Typical Hardware You Will Need for details about other items you may require.
Price
Although the foundation is UK based, the guide price of the units are in USD since the RPi components are sourced in USD$.
The price is $25USD (~£16GBP) for model A, and $35USD (~£23GBP) for model B.
Items will be subject to local Tax (i.e. UK will have 20% VAT added) and shipping cost is not included.
Clones & Copies
The foundation plans to release all the required schematics and plans to reproduce the RPi hardware, so clones and copies will be welcome.
However, since the unit is built around the Broadcom SoC, the interested party will require suitable sized orders to obtain them. The foundation were fortunate enough to be supported in this aspect by Broadcom to enable the project to be feasible.
References
1. http://en.wikipedia.org/wiki/Ball_grid_array
2. http://en.wikipedia.org/wiki/System_on_a_chip
3. http://en.wikipedia.org/wiki/Package_on_package
4. http://www.raspberrypi.org/forum/general-discussion/is-the-raspberrypi-going-to-be-sold-as-a-kit/#p32289
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:48:07.000Z
|
yurm2ehn6itqsqkimwn3luozx7fjcjyh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19015",
"uncompressed_offset": 84919864,
"url": "elinux.org/index.php?oldid=201206&title=Ttc",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://elinux.org/index.php?title=Ttc&oldid=201206"
}
|
cccc_CC-MAIN-2013-20
|
Ttc
From eLinux.org
Revision as of 21:03, 13 December 2012 by Tim Bird (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
ttc is a program for manipulating targets from a host. It provides similar functionality to TCF in eclipse or adb in Android. With this tool you can build software for a particular target, install it on the target, reboot the target, and otherwise control operation of the target.
The name "ttc" originally comes from "Tim's target control". It was originally named just "target", and then "tc", but both of those had name collisions with already-existing tools.
Download
Miscelaneous Release Notes
The tar file available for download (at least as of version 1.2.3) contains the actual 'ttc' program itself as well as some sample helper scripts and some ttc.conf examples. ttc.conf.sample2 includes some samples of configuration inheritance, which is useful for working with the same board, but with different kernels or configuration settings.
Documentation
The ttc usage manual is here: Ttc Program Usage Guide
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:26:08.000Z
|
t3pnnph3r64tenuht6iollkle3vnlbns
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19041",
"uncompressed_offset": 111137280,
"url": "genomebiology.com/2011/12/7/R65/abstract",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://genomebiology.com/2011/12/7/R65/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research
Proteome-wide evidence for enhanced positive Darwinian selection within intrinsically disordered regions in proteins
Johan Nilsson1, Mats Grahn1 and Anthony PH Wright1,2*
Author Affiliations
1 School of Life Sciences, Södertörn University, SE-141 89 Huddinge, Sweden
2 Clinical Research Center, Novum Level 5, Department of Laboratory Medicine and Center for Biosciences, Karolinska Institutet, SE-141 86 Huddinge, Sweden
For all author emails, please log on.
Genome Biology 2011, 12:R65 doi:10.1186/gb-2011-12-7-r65
Published: 19 July 2011
Abstract
Background
Understanding the adaptive changes that alter the function of proteins during evolution is an important question for biology and medicine. The increasing number of completely sequenced genomes from closely related organisms, as well as individuals within species, facilitates systematic detection of recent selection events by means of comparative genomics.
Results
We have used genome-wide strain-specific single nucleotide polymorphism data from 64 strains of budding yeast (Saccharomyces cerevisiae or Saccharomyces paradoxus) to determine whether adaptive positive selection is correlated with protein regions showing propensity for different classes of structure conformation. Data from phylogenetic and population genetic analysis of 3,746 gene alignments consistently shows a significantly higher degree of positive Darwinian selection in intrinsically disordered regions of proteins compared to regions of alpha helix, beta sheet or tertiary structure. Evidence of positive selection is significantly enriched in classes of proteins whose functions and molecular mechanisms can be coupled to adaptive processes and these classes tend to have a higher average content of intrinsically unstructured protein regions.
Conclusions
We suggest that intrinsically disordered protein regions may be important for the production and maintenance of genetic variation with adaptive potential and that they may thus be of central significance for the evolvability of the organism or cell in which they occur.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:01:26.000Z
|
pjxe3xw6yectowbvr2yjvvwd5g5m5m7r
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19069",
"uncompressed_offset": 153186149,
"url": "lists.maemo.org/pipermail/maemo-developers/2010-July/027010.html",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://lists.maemo.org/pipermail/maemo-developers/2010-July/027010.html"
}
|
cccc_CC-MAIN-2013-20
|
[maemo-developers] Optification in MADDE, again
From: Martin Storsjö martin at martin.st
Date: Fri Jul 2 12:31:57 EEST 2010
Hi,
It seems I'm late to the discussion on optification in MADDE... In the
earlier discussion, I saw this quote:
> You cannot use that with MADDE, because maemo-optify* commands use
> internally some dpkg* command options that are not implemented by MADDE.
When grepping through the source of maemo-optify 0.2.1, I see no such
calls at all, anyone care to clarify this?
I tried adding the maemo-optify scripts outside of MADDE, in my path (on
OS X), and it seems to work just fine, but the rest of the environment
adds some complications.
dh_fixperms, which write the list of files for tarlisted, doesn't
recognize symlinks at all, but this can be fixed with the attached patch.
This would be an issue also if doing manual optification and using
symlinks, I think?
The final problem, though, is that of the order of commands in
debian/rules, which, for me, initially looked like this:
dh_strip
dh_compress
dh_fixperms
# dh_perl
# dh_makeshlibs
dh_installdeb
dh_shlibdeps
dh_gencontrol
dh_md5sums
maemo-optify
dh_builddeb
dh_fixperms is called a few steps before maemo-optify, so it creates a
.tarlist that references files as they are at that point, but maemo-optify
changes them later on. maemo-optify cannot be called before dh_installdeb,
though. Moving dh_fixperms down to below maemo-optify does seem to work,
although I'm not sure if that's an acceptable change in general.
// Martin
-------------- next part --------------
A non-text attachment was scrubbed...
Name: dh_fixperms-symlinks.patch
Type: text/x-diff
Size: 414 bytes
Desc:
URL: <http://lists.maemo.org/pipermail/maemo-developers/attachments/20100702/2a88cfd4/attachment.patch>
More information about the maemo-developers mailing list
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:13:04.000Z
|
uymplfeh62scd6tuo3bs23bqa6lfst4u
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19070",
"uncompressed_offset": 153190406,
"url": "lists.maemo.org/pipermail/maemo-users/2007-February/004227.html",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://lists.maemo.org/pipermail/maemo-users/2007-February/004227.html"
}
|
cccc_CC-MAIN-2013-20
|
[maemo-users] Nokia Tablet Carrying Case
From: Neil MacLeod gmane at nmacleod.com
Date: Tue Feb 27 18:55:55 EET 2007
Neil MacLeod wrote:
> Iñigo Illán Aranburu wrote:
>> :-) No, I get the extra stylus when I buyed the 770! If you go here[1]
>> and to the others section you will see the three stylus pack to choose
>> for buying.
>>
>> [1] http://direct.nokia.com/shopcart.aspx
>>
> Thanks for the link Iñigo - very useful! And after much difficulty, I
> found a link to the N800 stylus pack:
>
> http://direct.nokia.com/Product.aspx?model=StylusN800
>
> Still no N800 Case though! :(
>
> Many thanks.
>
I'll just add that it is impossible to find the stylus accessories via the standard Nokia online store.
I'm finding it impossible to locate a stylus replacement pack via the normal online store (eg. http://shop.nokia.co.uk/icat/0276499accessories for all N800 accessories - no replacement stylus pack listed).
Unless you know the direct links listed above, you've got no chance of buying a replacement stylus pack!
Nokia... sort it out.
More information about the maemo-users mailing list
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:23:13.000Z
|
jcfyaqj7caqtpkbuynt7wubi26udzhk5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19095",
"uncompressed_offset": 192292522,
"url": "openwetware.org/index.php?oldid=324961&title=Endy%3AReprints",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://openwetware.org/index.php?title=Endy:Reprints&oldid=324961"
}
|
cccc_CC-MAIN-2013-20
|
Endy:Reprints
From OpenWetWare
Revision as of 20:06, 16 July 2009 by Endy (Talk | contribs)
Jump to: navigation, search
Add to My Links
Home Lab Members Research Notebooks Publications Internal Contact
• Note: We also publish thesis proposals, dissertations, and technical reports via DSpace, an online digital repository operated by the MIT Library.
• Note: PDF reprints are provided below within the context of fair use. Please obtain copies from the publisher if appropriate.
• Note: Search "endy d" via PubGet for a third-party automatically generated set of PubMed-listed publications from the lab.
Contents
Student Dissertations
Barry Canton
Engineering the interface between cellular chassis and synthetic biological systems
MIT 2008 dissertation (PDF)
Jeff Gritton
Architecture and evolutionary stability of yeast signaling pathways
MIT 2006 thesis (PDF)
Jason Kelly
Tools and reference standards supporting the engineering and evolution of synthetic biological systems
MIT 2008 dissertation (PDF)
Sriram Kosuri
Simulation, models, and refactoring of bacteriophage T7 gene expression
MIT 2007 dissertation (PDF)
Alex Mallet
(details pending)
Reshma Shetty (co-advisee with Tom Knight
Applying engineering principles to the design and construction of transcriptional devices
MIT 2008 dissertation (PDF)
Francois St-Pierre
Determination of cell fate selection during phage lambda infection
MIT 2009 dissertation (PDF pending)
Samantha Sutton
Engineering phosphorylation-dependent post-translational protein devices
MIT 2008 dissertation (PDF)
Ty Thompson
Models and analysis of yeast mating response : tools for model building, from documentation to time-dependent stimulation
MIT 2008 dissertation (PDF)
Peer Reviewed Articles
Measuring the activity of BioBrick promoters using an in vivo reference standard
Journal of Biological Engineering, 2009 March 20;3:4
Jason R Kelly, Adam J Rubin, Caroline M Ajo-Franklin, John Cumbers, Michael J. Czar, Kim de Mora, Aaron L Glieberman, Dileep D Monie, Drew Endy
URL PDF reprint
Determination of cell fate selection during phage lambda infection
PNAS USA, 2008 December; 105(52), 20705-20710
Francois St-Pierre, Drew Endy
URL PDF reprint
Refinement and standardization of synthetic biological parts and devices
Nature Biotechnology, 2008 July; 26(6), 787-93
Barry Canton, Anna Labno, Drew Endy
URL PDF reprint News & Views
Engineering BioBrick vectors from BioBrick parts
Journal of Biological Engineering, 2008 Apr 14;2:5
Reshma Shetty, Drew Endy, Tom Knight
URL
Stimulus design for model selection and validation in cell signaling
PLoS Comput Biol. 2008 Feb 15;4(2):e30
Josh Apgar, Jared Toettcher, Drew Endy, Forest White, Bruce Tidor
URL
TABASCO: A single molecule, base-pair resolved gene expression simulator
BMC Bioinformatics 2007, 8:480
Sriram Kosuri, Jason R Kelly, Drew Endy
URL
DNA synthesis and biological security
Nature Biotechnology June 2007
Hans Bugl, John P Danner, Robert J Molinari, John T Mulligan, Han-Oh Park, Bas Reichert, David A Roth, Ralf Wagner, Bruce Budowle, Robert M Scripp, Jenifer A L Smith, Scott J Steele, George Church & Drew Endy
URL PDF reprint
Synthetic genomics: Options for governance
Biosecur Bioterror 2007 Dec;5(4):359-62
Michele Garfinkel, Drew Endy, Gerald Epstein, Robert Friedman
URL (Full Report)
Foundations for engineering biology
Nature 24 November 2005 doi:10.1038/nature04342
Drew Endy
URL PDF reprint
Refactoring bacteriophage T7
Nature/EMBO Molecular Systems Biology 13 September 2005 doi:10.1038/msb4100025
Leon Y. Chan, Sriram Kosuri and Drew Endy
URL PDF reprint News & Views October 2004 version
Regulated cell to cell variation in a cell fate decision system
Nature 18 September 2005 doi:10.1038/nature03998
Alejandro Colman-Lerner, Andrew Gordon, Eduard Serra, Tina Chin, Orna Resnekov, Drew Endy, C. Gustavo Pesce and Roger Brent
URL PDF reprint News & Views
Modelling cellular behaviour (insight feature)
Nature 409, 391-395
Drew Endy and Roger Brent
PDF reprint
Computation, prediction, and experimental test of fitness for bacteriophage T7 mutants with permuted genomes
Proceedings of the National Academy of Sciences USA 97, 5375-5380
Drew Endy, Lingchong You, John Yin and Ian Molineux
PDF reprint
Toward antiviral strategies that resist viral escape
Antimicrobial Agents & Chemotherapy 44, 1097-1099
Drew Endy and John Yin
PDF reprint
Intracellular kinetics of a growing virus: A genetically-structured simulation for bacteriophage T7
Biotechnology & Bioengineering 55, 375-389
Drew Endy, Deyu Kong, and John Yin
PDF reprint
Transcribed Lectures
Synthetic biology: Can we make biology easy to engineer? <--note: transcription was not proofed
Industrial Biotechnology' 1 December 2008, 4(4): 340-351
Drew Endy
URL PDF reprint
Other Articles, Not Peer Reviewed
Cribsheet #16: Synthetic Biology
SEED July 2008
Lee Billings, Drew Endy
Illustrator: Thomas Porostocky
URL PDF reprint
Reconstruction of the genomes
Science 2008 Feb 29;319(5867):1196-7
Drew Endy
URL PDF reprint
Building a fab for biology
Scientific American June 2006
David Baker, George Church, Jim Collins, Drew Endy, Joe Jacobson, Jay Keasling, Paul Modrich, Christina Smolke, Ron Weiss
PMID: 16711359
A biological engineer searches for simplicity
Nature 449, 5
Drew Endy
URL
Useful construction
The Scientist January 2006
Drew Endy
URL (login likely req'd.)
URL (login not req'd., as of 24 March 2009)
2003 Synthetic Biology study
US Government October 2003
Drew Endy, Patrick Lincoln, Richard Murray
doi:1721.1/38455
Molecular monogamy
Nature 426, 614-615
Drew Endy and Michael B. Yaffe
PDF reprint
Decoding NF-kB signaling
Science 298, 1189-1190
Alice Y. Ting and Drew Endy
PDF reprint
A standard parts list for biological circuitry
DARPA white paper October 1999
Drew Endy, Adam Arkin
doi:1721.1/29794
Books
Adventures in synthetic biology
Nature 24 November 2005 Cover & Online
Drew Endy, Isadora Deese and Chuck Wadey
PDF, links, and background information
For a reprint, please email isadora AT mit DOT edu
Book Chapters
Synthetic Biology
Bioethics Briefing Book, The Hastings Center, 2008, Chapter 35
Michele Garfinkel, Drew Endy, Gerald Epstein, Robert Friedman
Free Online
Towards a predictive biology: The example of bacteriophage T7
Evolution as Computation, Landweber & Winfree (eds.), DIMACS Workshop, Princeton, 1999, 201-209 (book chapter).
Drew Endy
no e-print currently available (sorry!)
Selected Online Lectures or Debates
Synthetic Biology Debate: Drew Endy & Jim Thomas
The Long Now Foundation, 17 November 2008
Cowell Theater, Fort Mason Center, San Francisco
Online w/ transcription via FORA.tv, DVD for purchase via Whole Earth Films
Programming DNA: A 2-bit language for engineering biology
24C3, The 24th Chaos Communication Congress, 27 December 2007
Berliner Congress Center, Berlin
Online via Google video
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:16:36.000Z
|
yebi3xnsgl4k7ukgeylhvfsn4abpgg54
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19096",
"uncompressed_offset": 192303739,
"url": "openwetware.org/index.php?oldid=221090&title=Kafatos%3AMacCallum%2C_Bob",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://openwetware.org/index.php?title=Kafatos:MacCallum%2C_Bob&oldid=221090"
}
|
cccc_CC-MAIN-2013-20
|
Kafatos:MacCallum, Bob
From OpenWetWare
Revision as of 06:06, 15 July 2008 by Robert M. MacCallum (Talk | contribs)
Jump to: navigation, search
Home Lab Members Research Publications Contact
Bob MacCallum
Division of Cell & Molecular Biology
SAF Building
South Kensington Campus
Imperial College London
London
SW7 2AZ, UK
r dot maccallum at imperial dot ac dot uk
+442075941945
I am a VectorBase Developer in the Kafatos/Christophides Lab at Imperial College, London
.
Research Interests
• Functional genomics data integration into VectorBase, with a current focus on microarray-derived gene expression data.
• Protein structure and function prediction (see my former homepage for predictors of protein disorder, residue-residue contacts and nuclear localisation)
• Evolutionary computation (see PerlGP)
• Regulatory DNA sequence analysis
• Medical informatics (collaboration with David Nelson at Karolinksa University Hospital, Stockholm, Sweden)
Education
Undergraduate
Natural Sciences, Robinson College, University of Cambridge
Postgraduate
University College London, PhD under the supervision of Prof. Janet Thornton
Publications
Here is a link to PubMed which automagically lists my publications.
Here are three more which are not in PubMed:
1. Authors
Togelius, J; et al.
Title
The 2007 IEEE CEC simulated car racing competition
Source
Genetic Programming and Evolvable Machines, 2008
2. Authors
Aggarwal, V; MacCallum, RM
Title
Evolved matrix operations for post-processing protein secondary structure predictions
Source
GENETIC PROGRAMMING, PROCEEDINGS, 3003: 220-229 2004
Book series title
LECTURE NOTES IN COMPUTER SCIENCE
3. Authors
Heddad, A; Brameier, M; MacCallum, RM
Title
Evolving regular expression-based sequence classifiers for protein nuclear localisation
Source
APPLICATIONS OF EVOLUTIONARY COMPUTING, 3005: 31-40 2004
Book series title
LECTURE NOTES IN COMPUTER SCIENCE
4. Authors
MacCallum, RM
Title
Introducing a perl genetic programming system - and can meta-evolution solve the bloat problem?
Source
GENETIC PROGRAMMING, PROCEEDINGS, 2610: 364-373 2003
Book series title
LECTURE NOTES IN COMPUTER SCIENCE
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:38:08.000Z
|
436lqptas6jb4kzf5vtglgjxz7bgu2px
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19121",
"uncompressed_offset": 213004840,
"url": "quotationsbook.com/forum/post/500/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/forum/post/500/"
}
|
cccc_CC-MAIN-2013-20
|
Village: The Library
discussing quote:
Generally speaking, when a woman offers unsolicited advice or tries to help a man, she has no idea of how critical and unloving she may sound to him. Gray, John
Started by rikshaka
...unloving she may sound
amitkoth said:
Hello! I just changed the quote text, should be better now - wouldn't want this to be wrong!
Robertofgoodna said:
That all depends on the skill of the woman in framing the advice, and on the skill of the man to listen with an open ear.
You need to login or register to post
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:44:40.000Z
|
qlvp6nlns76ubsg3wddohrz2tvgx2n5o
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19122",
"uncompressed_offset": 213009540,
"url": "quotationsbook.com/quote/14095/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/quote/14095/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Popular applause veers with the wind. Bright, John
This quote is about fame · Search on Google Books to find all references and sources for this quotation.
A bit about Bright, John ...
John Bright (November 16, 1811 March 27, 1889), was a British Radical and Liberal statesman, associated with Richard Cobden in the formation of the Anti-Corn Law League.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:04:43.000Z
|
5k7uiumrwxb34ej5ixdg4uax5mp225bu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19123",
"uncompressed_offset": 213015757,
"url": "quotationsbook.com/quote/28612/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/quote/28612/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
It is not best that we should all think alike; it is a difference of opinion that makes horse races. Twain, Mark
This quote is about opinions · Search on Google Books to find all references and sources for this quotation.
A bit about Twain, Mark ...
Samuel Langhorne Clemens (November 30, 1835 April 21, 1910), better known by his pen name Mark Twain, was a famous and popular American humorist, novelist, writer and lecturer.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:52:41.000Z
|
rark4yyrwzwk5uxivk4h6gz2vxwoyplm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19124",
"uncompressed_offset": 213022122,
"url": "quotationsbook.com/quote/bookmark_users/25121/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/quote/bookmark_users/25121/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
The world has always gone through periods of madness so as to advance a bit on the road to reason. Broch, Hermann
This quote is about madness · Search on Google Books to find all references and sources for this quotation.
A bit about Broch, Hermann ...
Hermann Broch (November 1, 1886 - May 30, 1951) was a 20th century Austrian writer, considered one of the major Modernists.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:06:51.000Z
|
hxyatji2g6gp6mwud5cn2ycqvisdtb7d
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19125",
"uncompressed_offset": 213028584,
"url": "quotationsbook.com/quote/gift/18270/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/quote/gift/18270/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Celebrate the happiness that friends are always giving, make every day a holiday and celebrate just living! Bradley, Amanda
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:45:38.000Z
|
ajpci7dk7nuefmnm2kuud5rwe37gz2ci
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19126",
"uncompressed_offset": 213034097,
"url": "quotationsbook.com/quotes/author/5320/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://quotationsbook.com/quotes/author/5320/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Newman, Paul
We don't have a biography. Please consult wikipedia.
"The embarrassing thing is that the salad dressing is out-grossing my films."
Newman, Paul on embarrassment
"Show me a good loser and I will show you a loser."
Newman, Paul on losers and losing
"Acting is a question of absorbing other people's personalities and adding some of your own experience."
Newman, Paul on acting and actors
Take a look at recent activity on QB!
Search Quotations Book
Photos >>
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:20:42.000Z
|
iw6t2cg423qea4okbq4pze42zjnznvbc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19127",
"uncompressed_offset": 216331297,
"url": "regimechangeiran.blogspot.com/2005/04/eu-under-pressure-as-iran-lays-down.html",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://regimechangeiran.blogspot.com/2005/04/eu-under-pressure-as-iran-lays-down.html"
}
|
cccc_CC-MAIN-2013-20
|
Thursday, April 28, 2005
EU under pressure as Iran lays down gauntlet in nuclear talks
Daniel Dombey in Brussels, Gareth Smyth in Tehran and Harvey,Morris in Jerusalem, Financial Times:
The European Union is facing one of the biggest tests yet of its policy on Iran's nuclear programme, as Tehran increases pressure in negotiations and doubts mount about the unity of the EU itself. READ MORE
Diplomats from both sides meet for talks in London tonight, following warnings by Iran that unless its latest offer is accepted the talks would end. Under that scenario, Iran has said it will resume enriching uranium, a step that could lead to the production of weapons grade material.
Last month Tehran called for "firm guarantees" from Europe over political relations, trade and security but emphasised its demands that it be able to maintain its nuclear activities - which it stresses are peaceful - over the long term. "If there is no agreement and negotiations collapse, there is no choice but to restart the programme," Kamal Kharrazi, foreign minister, said yesterday.
Cyrus Nasseri, Iran's chief negotiator, told the FT that, other than "differences on nitty-gritty and details", it remained for Europe to come down "to making a decision" over whether it wanted negotiations to continue.
EU officials say they want to keep the negotiations - and Iran's agreement to suspend enrichment while they are ongoing - on track until after Iranian presidential elections on June 17. They hope former president Akbar Hashemi Rafsanjani - a relatively pragmatic figure - will win. "I hope they will be able to vote and elect a new president that we can deal with," Javier Solana, EU foreign policy representative, said yesterday, hinting at the EU's preference for Mr Rafsanjani.
For their part, the Europeans are demanding "objective guarantees" that Iran's nuclear programme has no military use. But Britain, France and Germany, the so-called EU3 countries that lead the EU talks, have not always appeared to be in step with each other on what these "objective guarantees" may be, and they may yet pull in different directions as the Iranian pressure mounts.
The EU3 has to date insisted that "objective guarantees" means a permanent halt to enrichment and dismantling equipment.
But at a February meeting with Iranian negotiators, Jacques Chirac, French president, indicated he might consider an Iranian proposal that rather than dismantling equipment, the International Atomic Energy Agency would monitor the programme to ensure its peaceful nature. Such a scenario would imply that Iran might not need to stop all enrichment activity - contrary to the official EU line.
French foreign ministry officials and German Chancellor Gerhard Schröder rushed to "clarify" Mr Chirac's comments and make clear that the EU position had not changed.
Some European diplomats also suggest the EU3 and Iran could reach a compromise under which Iran would continue its suspension of uranium enrichment for three or five years, while retaining a small number of centrifuges, the crucial mechanism in the enrichment process. Yet this again is far softer than the official EU3 position, which is championed by the UK and supported by the US.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:11:05.000Z
|
pw63qmqqkgtslkex2f6yukyiw6y7r3ss
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19130",
"uncompressed_offset": 219638942,
"url": "robots.net/person/VoodooZ/diary.html?start=1",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://robots.net/person/VoodooZ/diary.html?start=1"
}
|
cccc_CC-MAIN-2013-20
|
Older blog entries for VoodooZ (starting at number 1)
I just created the project page for my newest project SRX1. Check it out!
Could someone promote me to a higher level please so I can post details on my latest robot SRX1 here?
Thanks in advance,
X
Share this page
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:19:50.000Z
|
6uxavlar4vjzufe2n2cctyf5ztzjuozv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19149",
"uncompressed_offset": 248610533,
"url": "strategywiki.org/wiki/June_16",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://strategywiki.org/wiki/June_16"
}
|
cccc_CC-MAIN-2013-20
|
Category:June 16
From StrategyWiki, the video game walkthrough and strategy guide wiki
(Redirected from June 16)
Jump to: navigation, search
Articles detailing events that are related to June 16. This may include the release of games or systems, the founding of a video game related company or some other important event.
Social networking
Personal tools
Namespaces
Variants
Views
Actions
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:49:58.000Z
|
zj7ijslofxccbdebvxgsramrc2q3slco
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19191",
"uncompressed_offset": 299129232,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/DetailsPage/4442.02006-07",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/DetailsPage/4442.02006-07?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
4442.0 - Family Characteristics and Transitions, Australia, 2006-07
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 06/06/2008 Reissue
Page tools: RSS Search this Product
Publications
4442.0 - Family Characteristics and Transitions, Australia Released 15/07/2008
Data Cubes
FCTS Data Item List
FCTS Publication Tables 1–20 Released 15/07/2008
New South Wales Released 15/08/2008
Victoria Released 15/08/2008
Queensland Released 15/08/2008
South Australia Released 15/08/2008
Western Australia Released 15/08/2008
Tasmania Released 15/08/2008
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:11:10.000Z
|
7e4ppn2g53cec2liyc2dk4q5m626z2ie
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19192",
"uncompressed_offset": 299144621,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/30990B92192B2033CA25776D001B5CF3",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/30990B92192B2033CA25776D001B5CF3?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
6401.0 - Consumer Price Index, Australia, Mar 2010 Quality Declaration
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 28/04/2010
Page tools: Print Page Print All RSS Search this Product
MARCH KEY FIGURES
Dec Qtr 2009 to Mar Qtr 2010
Mar Qtr 2009 to Mar Qtr 2010
Weighted average of eight capital cities
% change
% change
Food
1.1
0.7
Alcohol and tobacco
1.3
3.5
Clothing and footwear
-4.3
-1.8
Housing
1.5
6.1
Household contents and services
-1.3
1.4
Health
4.7
5.1
Transportation
1.3
4.1
Communication
-0.1
0.2
Recreation
-1.0
1.2
Education
5.6
5.7
Financial and insurance services
2.0
2.0
All groups
0.9
2.9
All groups excluding Housing and Financial and insurance services
0.6
2.1
All Groups, Quarterly change
Contribution to quarterly change, March Quarter 2010 - March Quarter 2010
MARCH KEY POINTS
THE ALL GROUPS CPI
• rose 0.9% in the March quarter 2010, compared with a rise of 0.5% in the December quarter 2009.
• rose 2.9% through the year to March quarter 2010, compared with a rise of 2.1% through the year to December quarter 2009.
OVERVIEW OF CPI MOVEMENTS
• The most significant price rises this quarter were for automotive fuel (+4.2%), pharmaceuticals (+13.3%), deposit and loan facilities (+3.4%), vegetables (+10.3%), electricity (+5.9%), house purchase (+1.2%) and hospital and medical services (+2.9%).
• The most significant offsetting price falls were for furniture (-4.6%), fruit (-5.7%), domestic holiday travel and accommodation (-2.3%), audio, visual and computing equipment (-5.9%), men's outerwear (-6.7%) and children's and infants' clothing (-9.9%).
NOTES
FORTHCOMING ISSUES
ISSUE (QUARTER) Release Date
June 2010 28 July 2010
September 2010 27 October 2010
December 2010 25 January 2011
March 2011 27 April 2011
CHANGES IN THIS ISSUE
The previous 'Analyses and Comments' section of this publication has been split into 'Main Contributors to Change' and 'Capital Cities Comparison'. There has been no change in the level of detail or content provided.
CPI REVIEW UPDATE
The ABS is currently undertaking a major review of the CPI. Information paper: Issues to be considered during the 16th Series Australian Consumer Price Index Review, December 2009 (cat.no. 6468.0) is available at <http://www.abs.gov.au>.
Public forums were held in each capital city during February and March 2010. Submissions to the review closed on 12 March 2010 and are available at <http://www.abs.gov.au>. The outcomes from the review will be announced in December 2010. The 16th series CPI will be implemented in October 2011, in respect of the September quarter 2011.
ROUNDING
Any discrepancies between totals and sums of components in this publication are due to rounding.
LINKS TO OTHER PARTS OF THIS RELEASE ON THE WEBSITE
To access the 'Main Contributors to Change' data on the ABS website <http://www.abs.gov.au> use the link 'Main Contributors to Change' as shown below.
To access the 'Capital Cities Comparison' data on the ABS website <http://www.abs.gov.au> use the link 'Capital Cities Comparison' as shown below.
The standard way to access links to other parts of this or any release on the ABS website <http://www.abs.gov.au> is by selecting the required link from the links list in the box at the top left hand side of the 'Summary' page.
INQUIRIES
For further information about these and related statistics, contact the National Information and Referral Service on 1300 135 070.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:20:34.000Z
|
ohyow4wyhilqclvgvldtjhioz5vzyz5q
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19193",
"uncompressed_offset": 299153771,
"url": "www.abs.gov.au/Ausstats/abs%40.nsf/0/5CED2473B23BB10BCA256C3200241530",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.abs.gov.au/Ausstats/abs@.nsf/0/5CED2473B23BB10BCA256C3200241530?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1384.6 - Statistics - Tasmania, 2005
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 13/09/2002
Page tools: Print Page Print All RSS Search this Product
Contents >> Trade >> Tasmania's trade performance >> Excess of exports over imports
Tasmania's recorded exports exceed imports in value. Tasmania's rich mineral resources and an environment capable of producing far more primary produce than its small domestic population requires is one reason. Another is the understating of import figures, with only direct imports into Tasmania being recorded.
EXCESS OF MERCHANDISE EXPORTS OVER IMPORTS, Tasmania, Value
Years
$m
1998-99
1,612.3
1999-2000
1,774.9
2000-01
1,911.4
2001-02
1,869.4
2002-03
1,675.2
Source: ABS data available on request, International Trade data base.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:51.000Z
|
swx3zu37gqlbm45ssxrsmcswpkga47lj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19194",
"uncompressed_offset": 299160855,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/ProductsbyReleaseDate/3ED310F455C0BB6ECA2570AD0003328D",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/ProductsbyReleaseDate/3ED310F455C0BB6ECA2570AD0003328D?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
6410.0 - Price Indexes of Copper Materials, Australia, Dec 1997
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 23/01/1998
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
This publication has been discontinued and is replaced by 6427.0 - Producer Price Indexes, Australia.
Previously: Price Indexes of Metallic Materials, Australia (ISSN: 0818-3449)
These indexes measure price movements in copper materials used in the manufacturing of electrical equipment. Index numbers are published for industrial electric motors, distribution transformers and power transformers.
The frequency of this publication has been changed from monthly to quarterly after the June 1997 issue.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:24:02.000Z
|
fdb2tdrxqj2qqp23sm2r4qg4htxs5kg4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19195",
"uncompressed_offset": 299167952,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/second%2Blevel%2Bview?issue=2000-01&prodno=6541.0.30.001&prodno=6541.0.30.001&tabname=Related+Products&viewtitle=Microdata%3A+Survey+of+Income+and+Housing%2C+Expanded+CURF%2C+Australia~2000-01~Previous~11%2F11%2F2004",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/second+level+view?ReadForm&prodno=6541.0.30.001&viewtitle=Microdata:%20Survey%20of%20Income%20and%20Housing,%20Expanded%20CURF,%20Australia~2000-01~Previous~11/11/2004&tabname=Related%20Products&prodno=6541.0.30.001&issue=2000-01&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
6541.0.30.001 - Microdata: Survey of Income and Housing, Expanded CURF, Australia, 2000-01
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 11/11/2004
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:52:34.000Z
|
2kkgy63cfubcevsocjmdogmumsxwame5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19196",
"uncompressed_offset": 346907435,
"url": "www.biomedcentral.com/1471-2105/12/254/abstract",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.biomedcentral.com/1471-2105/12/254/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Methodology article
Fusion of metabolomics and proteomics data for biomarkers discovery: case study on the experimental autoimmune encephalomyelitis
Lionel Blanchet1*, Agnieszka Smolinska1, Amos Attali2, Marcel P Stoop3, Kirsten AM Ampt1, Hans van Aken2, Ernst Suidgeest2, Tinka Tuinstra2, Sybren S Wijmenga1, Theo Luider3 and Lutgarde MC Buydens1
Author Affiliations
1 Radboud University Nijmegen, Institute for Molecules and Materials, Heyendaalseweg 135, 6524 NP Nijmegen, The Netherlands
2 Abbott Healthcare Pharmaceuticals Nederland B.V., C.J. van Houtenlaan 36, 1381 CP Weesp, The Netherlands
3 Department of Neurology, Erasmus University Medical Center Rotterdam, Dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands
For all author emails, please log on.
BMC Bioinformatics 2011, 12:254 doi:10.1186/1471-2105-12-254
Published: 22 June 2011
Abstract
Background
Analysis of Cerebrospinal Fluid (CSF) samples holds great promise to diagnose neurological pathologies and gain insight into the molecular background of these pathologies. Proteomics and metabolomics methods provide invaluable information on the biomolecular content of CSF and thereby on the possible status of the central nervous system, including neurological pathologies. The combined information provides a more complete description of CSF content. Extracting the full combined information requires a combined analysis of different datasets i.e. fusion of the data.
Results
A novel fusion method is presented and applied to proteomics and metabolomics data from a pre-clinical model of multiple sclerosis: an Experimental Autoimmune Encephalomyelitis (EAE) model in rats. The method follows a mid-level fusion architecture. The relevant information is extracted per platform using extended canonical variates analysis. The results are subsequently merged in order to be analyzed jointly. We find that the combined proteome and metabolome data allow for the efficient and reliable discrimination between healthy, peripherally inflamed rats, and rats at the onset of the EAE. The predicted accuracy reaches 89% on a test set. The important variables (metabolites and proteins) in this model are known to be linked to EAE and/or multiple sclerosis.
Conclusions
Fusion of proteomics and metabolomics data is possible. The main issues of high-dimensionality and missing values are overcome. The outcome leads to higher accuracy in prediction and more exhaustive description of the disease profile. The biological interpretation of the involved variables validates our fusion approach.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:24:31.000Z
|
tiyqwk6zayhbx6gej5l5xrvvblh5n6xo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19197",
"uncompressed_offset": 346920816,
"url": "www.biomedcentral.com/1471-2148/9/149/abstract",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.biomedcentral.com/1471-2148/9/149/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Phylogenetic analysis of the SAP30 family of transcriptional regulators reveals functional divergence in the domain that binds the nuclear matrix
Keijo M Viiri*, Taisto YK Heinonen, Markku Mäki and Olli Lohi
Author Affiliations
Paediatric Research Centre, University of Tampere Medical School and Tampere University Hospital, 33520 Tampere, Finland
For all author emails, please log on.
BMC Evolutionary Biology 2009, 9:149 doi:10.1186/1471-2148-9-149
Published: 30 June 2009
Abstract
Background
Deacetylation of histones plays a fundamental role in gene silencing, and this is mediated by a corepressor complex containing Sin3 as an essential scaffold protein. In this report we examine the evolution of two proteins in this complex, the Sin3-associated proteins SAP30L and SAP30, by using an archive of protein sequences from 62 species.
Results
Our analysis indicates that in tetrapods SAP30L is more similar than SAP30 to the ancestral protein, and the two copies in this group originated by gene duplication which occurred after the divergence of Actinopterygii and Sarcopterygii about 450 million years ago (Mya). The phylogenetic analysis and biochemical experiments suggest that SAP30 has diverged functionally from the ancestral SAP30L by accumulating mutations that have caused attenuation of one of the original functions, association with the nuclear matrix. This function is mediated by a nuclear matrix association sequence, which consists of a conserved motif in the C-terminus and the adjacent nucleolar localization signal (NoLS).
Conclusion
These results add further insight into the evolution and function of proteins of the SAP30 family, which share many characteristic with nuclear scaffolding proteins that are intimately involved in regulation of gene expression. Furthermore, SAP30L seems essential to eukaryotic biology, as it is found in animals, plants, fungi, as well as some taxa of unicellular eukaryotes.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:04:20.000Z
|
7kcpytvxjezqj37ost4oldas62s5ivpj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19198",
"uncompressed_offset": 346933034,
"url": "www.biomedcentral.com/1472-6815/12/8?fmt_view=mobile",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.biomedcentral.com/1472-6815/12/8?fmt_view=mobile"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Superior semicircular canal dehiscence in East Asian women with osteoporosis
Alexander Yu1,2, Douglas L Teich3, Gul Moonis3 and Eric T Wong1,2*
Author affiliations
1 South Cove Community Health Center, Boston, MA, USA
2 Department of Neurology, Beth Israel Deaconess Medical Center, Boston, MA, USA
3 Section of Neuroradiology/Department of Radiology, Beth Israel Deaconess Medical Center, Boston, MA, USA
For all author emails, please log on.
Citation and License
BMC Ear, Nose and Throat Disorders 2012, 12:8 doi:10.1186/1472-6815-12-8
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1472-6815/12/8
Received:1 January 2012
Accepted:12 July 2012
Published:25 July 2012
© 2012 Yu et al.; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Superior semicircular canal dehiscence (SSCD) may cause Tullio phenomenon (sound-induced vertigo) or Hennebert sign (valsalva-induced vertigo) due to the absence of bone overlying the SSC. We document a case series of elderly East Asian women with atypical SSCD symptoms, radiologically confirmed dehiscence and concurrent osteoporosis.
Methods
A retrospective record review was performed on patients with dizziness, vertigo, and/or imbalance from a neurology clinic in a community health center serving the East Asian population in Boston. SSCD was confirmed by multi-detector, high-resolution CT of the temporal bone (with Pöschl and Stenvers reformations) and osteoporosis was documented by bone mineral density (BMD) scans.
Results
Of the 496 patients seen in the neurology clinic of a community health center from 2008 to 2010, 76 (17.3%) had symptoms of dizziness, vertigo, and/or imbalance. Five (6.6%) had confirmed SSCD by multi-detector, high-resolution CT of the temporal bone with longitudinal areas of dehiscence along the long axis of SSC, ranging from 0.4 to 3.0 mm, as seen on the Pöschl view. Two of the 5 patients experienced motion-induced vertigo, two fell due to disequilibrium, and one had chronic dizziness. None had a history of head trauma, otologic surgery, or active intracerebral disease. On neurological examination, two patients had inducible vertigo on Dix-Hallpike maneuver and none experienced cerebellar deficit, Tullio phenomenon, or Hennebert sign. All had documented osteoporosis or osteopenia by BMD scans. Three of them had definite osteoporosis, with T-scores < −2.5 in the axial spine, while another had osteopenia with a T-score of −2.3 in the left femur.
Conclusions
We describe an unusual presentation of SSCD without Tullio phenomenon or Hennebert sign in a population of elderly, East Asian women. There may be an association of SSCD and osteoporosis in this population. Further research is needed to determine the incidence and prevalence of this disorder, as well as the relationship of age, race, osteoporosis risk, and the development of SSCD.
Keywords:
Vertigo; Osteoporosis; Superior semicircular canal; Canal dehiscence; Neurotology
Background
Superior semicircular canal dehiscence (SSCD) is an uncommon cause of vertigo and disequilibrium. The initial population described by Minor et al.[1] in 1998 was young, with a median age of 41, and they experienced vertigo or oscillopsia inducible by sound (Tullio phenomenon) and/or increased middle ear or intracranial pressure (Hennebert sign). Computed tomography (CT) of the temporal bone revealed dehiscence of bone overlying one or both of the SSCs [1,2]. The dehisced bone consequently acts as a third window in the inner ear that can disturb the normal pressure gradient directing the endolymphatic flow within the vestibular system [1,3]. Surgical repair by plugging the bony defect can result in improvement of vertigo and disequilibrium in some patients [1,2] Figure 1.
Figure 1. High-resolution multi-detector CT of the temporal bone was performed with 0.625 mm slices and reformations of the SSC along the longitudinal axis (Pöschl view) and transverse axis (Stenvers view). To measure the extent of dehiscence, a straight line was drawn subtending the arc of the SSC and rounding to the nearest 0.5 mm in the Pöschl view [3]. In patient 1, the petrous bone overlying the right SSC was eroded, but without dehiscence, as seen on the (A) Pöschl view and (C) Stenvers view. However, there was dehiscence of the left SSC as seen on the (B) Pöschl view (arrowhead) and (D) Stenvers views (arrow).
We identified five patients with SSCD from a community health center that serves the East Asian population in Boston. Unlike previous reports, our patients were all elderly women of East Asian descent, had concomitant osteoporosis or osteopenia, and lacked Tullio phenomenon or Hennebert sign.
Methods
Patients with neurologic symptoms, including those with dizziness, vertigo, and disequilibrium, were evaluated by the neurologist E.T.W. Medical records were reviewed according to a protocol approved by an institutional review board at the clinic. Patients presenting with vertigo, dizziness, or disequilibrium with unclear etiology, as well as those suspected of having unusual inner ear pathology, underwent high-resolution multi-detector CT of the temporal bone, with 0.625 mm slices and reformations of the SSC along the longitudinal axis (Pöschl view) and transverse axis (Stenvers view). To measure the extent of dehiscence, a straight line was drawn subtending the arc of the SSC and rounding to the nearest 0.5 mm in the Pöschl view [3]. If indicated, head CT or magnetic resonance imaging was done to rule out intracerebral or cerebrovascular pathology. T-scores were extracted from bone mineral density (BMD) scans when available.
Results
Patient characteristics were summarized in Table 1 and 2. Among the 496 individuals seen in the neurology clinic between 2008 and 2010, the median age was 58 (range 20–93) years. SSCD was found in five (1.0%) elderly Chinese women with a median age of 72 (range 57 to 85) years. The prevalence in our cohort is doubled when compared to a large autopsy series of the general population (0.5%) reported to date [4]. Among patients with symptomatic dizziness, vertigo, and disequilibrium (n = 76), the prevalence of SSCD was substantially higher, or 6.6%. Thirty-three of the 76 patients (43.4%) had BMD scans and 27 (35.5%) had documented osteoporosis or osteopenia.
Table 1. Characteristics of patients with SSCD and osteoporosis/osteopenia*
Table 2. Summary of patient characteristics
All five individuals had radiological evidence of SSCD confirmed by high-resolution CT of the temporal bone with Pöschl and Stenvers views (Figure 1). None had a history of head trauma, otologic surgery, or active intracerebral disease. Two had histories of intermittent motion-induced vertigo while another two fell secondary to disequilibrium. The vertigo and disequilibrium symptoms were of new onset in three, occurring within 3 months prior to neurological evaluation, while one had a 10-year history of chronic intermittent vertigo. One patient had chronic bilateral hearing loss, while another had tinnitus and vertigo-associated nausea and vomiting. None experienced Tullio phenomenon or Hennebert sign. During neurological examination, two patients had rotatory nystagmus on left-sided Dix-Hallpike maneuver. Although they may have concurrent benign paroxysmal positional vertigo, neither patient derived benefit from Brandt-Daroff exercise or Epley maneuver. The other three patients had normal oculomotor, vestibular, and cerebellar examinations.
All five women were notable for abnormal T-scores on BMD scans. T-scores within three years of SSCD diagnosis were available for four of the five patients; the only patient without T-score values had documentation of osteoporosis in clinical notes prior to receiving care in the clinic. Three of them had definite osteoporosis, with T-scores <−2.5 in the axial spine, while another had osteopenia with a T-score of −2.3 in the left femur (Table 1). Two patients had previously used alendronate for the prevention of fractures from osteoporosis, all for periods of less than 5 years. At the time of SSCD diagnosis, two patients were taking calcium plus vitamin D supplement, while another two used multivitamins that included vitamin D. One patient was taking both ranitidine and omeprazole.
Discussion
There are major differences between our five elderly, East Asian women with SSCD when compared to cases described in the literature with respect to the demographics and clinical presentations. Our patients had a median age of 75 (range 57 to 85) years, which is significantly older than the median age of 41 (range 13 to 70) years reported in Minor’s review of 65 patients [1]. All of our patients are women while other reports described either a male predominance or equal gender distribution [5,6]. Most importantly, none of our patients experienced Tullio phenomenon or Hennebert sign, while prior report described a high prevalence of these neuro-otologic symptoms, 88% and 63%, respectively [1]. This may be due to the relatively small size dehiscence in our cohort, which were all < 2.0 mm. Yuen et al.[3] reported that patients with dehiscence of ≥ 3.0 mm experienced an average air-bone gap hearing loss of 10 decibel on pure-tone audiometry between 500–2000 hertz while none experienced such hearing loss when the dehiscence was < 3.0 mm. Pfammatter et al.[6] found that large dehiscence of 2.5 mm or greater were associated with significantly more vestibulocochlear symptoms, including Tullio phenomenon and Hennebert sign. Although not performed, additional testing in our cohort, such as the enlarged, low threshold click-evoked vestibulo-ocular reflex that aligns with the SSC [7] and the large amplitude, low threshold ocular vestibular evoked cervical myogenic potential [8,9], may provide confirmatory physiological evidence of SSCD.
The pathophysiological mechanism giving rise to SSCD in our cohort may be different from the previously reported population, in whom an earlier development of SSCD may be a result of congenital maldevelopment of the petrous bone [1,4]. Notably, all of our patients have osteoporosis or osteopenia and no prior report to date has described abnormal bone mineral metabolism in patients with SSCD. Because Asians are particularly at risk of developing osteoporosis [10], our older patients could have had normal formation of the petrous bone at birth but developed SSCD later in life from the prolonged osteoporotic erosion of bone overlying the SSC. Our view is consistent with the rising prevalence of SSCD or canal thinning in the elderly population, particularly for those at age 80 or older [11]. Furthermore, the slow evolution of dehiscence from osteoporosis may explain the smaller size of the bony defect, ranging from 0.5 to 2.0 mm, in our cohort at diagnosis. The protracted development of dehiscence may also allow time for compensatory adaptation by the nervous system resulting in a paucity of Tullio phenomenon, Hennebert sign, and other severe vestibulocochlear symptoms. However, we cannot exclude the possibility that SSCD and osteoporosis are separate disease processes that co-developed in our cohort.
The incidence and prevalence of SSCD is unknown in a population of patients with vertigo, dizziness, and/or disequilibrium. Autopsy series of cadaver temporal bone revealed an incidence of 0.3% in the general population without neuro-otologic deficits [12]. But among those with inner ear symptoms, the incidence may be as high as 19% in a retrospective series [12]. We found five with SSCD among 76 patients with vertigo, dizziness, and/or disequilibrium, or a prevalence of 6.6%. We suspect that this prevalence is higher than the general population because the clinic, which primarily serves the Asian population in Boston, may allow enrichment of the population at risk for the development of SSCD. Furthermore, improved CT technology may have helped the earlier detection of SSCD. Compared to the 50% sensitivity when 1.0 mm-collimated CT with transverse and coronal images, SSCD was better visualized with 93% sensitivity when 0.5 mm-collimated CT was used together with reformation along the long axis of the SSC [2]. However, further research would be needed to determine the exact incidence and prevalence of SSCD among Asian patients and the general population in the United States, as well as the pathophysiological mechanisms of SSCD in these two groups.
Conclusions
We documented a case series of elderly, East Asian women with atypical SSCD, as confirmed by high-resolution multi-detector CT of the temporal bone, and concurrent osteoporosis with abnormal T-scores as demonstrated by BMD scans. There may be an association between SSCD and osteoporosis in this susceptible patient population.
Abbreviations
BMD: Bone mineral density; CT: Computed tomography; SSC: Superior semicircular canal; SSCD: Superior semicircular canal dehiscence.
Competing interests
The authors declare that they have no competing interests.
Authors’ contribution
AY drafted the manuscript and worked on data acquisition and analysis; DT drafted the manuscript and analyzed the data; GM analyzed the data; ETW drafted the manuscript and worked on data acquisition and analysis. All authors read and approved the final manuscript.
Acknowledgements
This work was presented in part at the 63rd annual meeting of the American Academy of Neurology, April 9–16, 2011, Honolulu, HI. We thank the primary care physicians and nursing staff at South Cove Community Health Center for their input and patient care. Funding was provided partially by the Chinese Center of Long Island.
References
1. Minor LB, Solomon D, Zinreich JS, Zee DS: Sound- and/or pressure-induced vertigo due to bone dehiscence of the superior semicircular canal.
Arch Otolaryngol Head Neck Surg 1998, 124:249-258. PubMed Abstract | Publisher Full Text
2. Belden CJ, Weg N, Minor LB, Zinreich SJ: CT evaluation of bone dehiscence of the superior semicircular canal as a cause of sound- and/or pressure-induced vertigo.
Radiology 2003, 226:337-343. PubMed Abstract | Publisher Full Text
3. Yuen H-W, Boeddinghaus R, Eikelboom RH, Atlas MD: The relationship between the air-bone gap and the size of superior semicircular canal dehiscence.
Otolaryngol Head Neck Surg 2009, 141:689-694. PubMed Abstract | Publisher Full Text
4. Carey JP, Minor LB, Nager GT: Dehiscence or thinning of bone overlying the superior semicircular canal in a temporal bone survey.
Arch Otolaryngol Head Neck Surg 2000, 126:137-147. PubMed Abstract | Publisher Full Text
5. Zhou G, Gopen Q, Poe DS: Clinical and diagnostic characterization of canal dehiscence syndrome: a great otologic mimicker.
Otol Neurotol 2007, 28:920-926. PubMed Abstract | Publisher Full Text
6. Pfammatter A, Darrouzet V, Gärtner M, Somers T, Van Dinther J, Trabalzini F, Ayache D, Linder T: A superior semicircular canal dehiscence syndrome multicenter study: is there an association between size and symptoms?
Otol Neurotol 2010, 31:447-454. PubMed Abstract | Publisher Full Text
7. Aw ST, Todd MJ, Aw GE, Magnussen JS, Curthoys IS, Halmagyi GM: Click-evoked vestibulo-ocular reflex: Stimulus–response properties in superior canal dehiscence.
Neurology 2006, 11:1079-1087.
8. Welgampola MS, Myrie OA, Minor LB, Carey JP: Vestibular-evoked myogenic potential thresholds normalize on plugging superior canal dehiscence.
Neurology 2008, 70:464-472. PubMed Abstract | Publisher Full Text
9. Rosengren SM, Aw ST, Halmagyi GM, McAngus Todd NP, Colebatch JG: Ocular vestibular evoked myogenic potentials in superior canal dehiscence.
J Neurol Neurosurg Psychiatry 2008, 79:559-568. PubMed Abstract | Publisher Full Text
10. Barrett-Connor E, Siris ES, Wehren LE, Miller PD, Abbott TA, Berger ML, Santora AC, Sherwood LM: Osteoporosis and fracture risk in women of different ethnic groups.
J Bone Miner Res 2005, 20:185-194. PubMed Abstract | Publisher Full Text
11. Nadgir RN, Ozonoff A, Devaiah AK, Halderman AA, Sakai O: Superior semicircular canal dehiscence: congenital or acquired condition.
AJNR Am J Neuroradiol 2011, 32:947-949. PubMed Abstract | Publisher Full Text
12. Crovetto M, Whyte J, Rodriguez OM, Lecumberri I, Martinez C, Eléxpuru J: Anatomo-radiological study of the superior semicircular canal dehiscence: Radiological considerations of superior and posterior semicircular canals.
Eur J Radiol 2010, 76:167-172. PubMed Abstract | Publisher Full Text
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1472-6815/12/8/prepub
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:14:46.000Z
|
nnlsvvpyszfahz7vihamuam3yih6hpjq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19202",
"uncompressed_offset": 371122458,
"url": "www.ccsenet.org/journal/index.php/elt/article/view/505",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.ccsenet.org/journal/index.php/elt/article/view/505"
}
|
cccc_CC-MAIN-2013-20
|
Talking Terms: Choosing and Using Terminology for EFL Classrooms
Roger Berry
Abstract
This paper discusses the use of grammatical terminology in English language teaching. Accepting that it is a common feature of many classrooms, the paper attempts to help teachers understand the role and nature of terminology. A distinction is made between terms which are transparent (e.g. ‘countable’), opaque (e.g. ‘verb’) or iconic (e.g. ‘–ing form’). A number of criteria for evaluating the suitability of terminology for classroom use are also offered. In this way it is hoped that teachers will be better equipped to make well-informed decisions about the terms they choose to use in the classroom.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
English Language Teaching ISSN 1916-4742 (Print) ISSN 1916-4750 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:26:22.000Z
|
vmgbnswuwyz3zkpafq4nufq773q7njyj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19203",
"uncompressed_offset": 371127425,
"url": "www.ccsenet.org/journal/index.php/esr/article/view/18708/0",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.ccsenet.org/journal/index.php/esr/article/view/18708/0"
}
|
cccc_CC-MAIN-2013-20
|
Unmixing and Target Recognition in Airborne Hyper-Spectral Images
Amir Averbuch, Michael Zheludev, Valery Zheludev
Abstract
We present two new linear algorithms that perform unmixing in hyper-spectral images and then recognize their targets whose spectral signatures are given. The first algorithm is based on the ordered topology of spectral signatures. The second algorithm is based on a linear decomposition of each pixel's neighborhood. The sought after target can occupy sub- or above pixel. These algorithms combine ideas from algebra and probability theories as well as statistical data mining. Experimental results demonstrate their robustness. This paper is a complementary extension to Averbuch & Zheludev (2012).
Full Text: PDF DOI: 10.5539/esr.v1n2p200
Refbacks
• There are currently no refbacks.
This work is licensed under a Creative Commons Attribution 3.0 License.
Earth Science Research ISSN 1927-0542 (Print) ISSN 1927-0550 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:44:08.000Z
|
ncmzvinhbwd3jwdxsmm2ocnxmjink3ow
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19207",
"uncompressed_offset": 389333809,
"url": "www.comics.org/series/26141/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.comics.org/series/26141/"
}
|
cccc_CC-MAIN-2013-20
|
Apex Novelties, 1968 Series
Published in English (United States)
Publication Dates:
[October] 1968 - August 1969
Number of Issues Published:
3 (#[nn] - #3)
Format:
Color cover; Black and white interior; 5 x 7 inches; Newsprint
Series Details:
Indicia Publishers:
• without indicia publisher information (3 issues)
Notes
Principally by R. Crumb (using various pseudonyms) and S. Clay Wilson.
Most data from J. Kennedy, The Official Underground and Newave Comix Price Guide.
Editing
Index Status
Indexed Partially Indexed Pending Approval Reserved Skeleton Data Only
[nn] 2 3
Cover Status
Scan available Needs Replacement No Scan available
[nn] 2 2 3
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:45:01.000Z
|
utg3pfcz55grgmdc7tebrhbnm6rgasul
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19215",
"uncompressed_offset": 444393286,
"url": "www.familysearch.org/learn/wiki/en/Find_Birth_Information_in_Wales_1837_to_1901",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Find_Birth_Information_in_Wales_1837_to_1901"
}
|
cccc_CC-MAIN-2013-20
|
Find Birth Information in Wales 1837 to 1901Edit This Page
From FamilySearch Wiki
If your ancestor lived in Wales between 1837 and 1901, search these records to find information about his or her family. These links will lead you to the best records to search, what to look for, and what finding aids to use.
1. Civil Registration
2. Census records
3. Chapel records
4. Church records
5. Probate records
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 11 November 2011, at 16:00.
• This page has been accessed 1,751 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:02:46.000Z
|
siyh6kv7a6kcbuogytmzeeuwxzsumqci
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19216",
"uncompressed_offset": 444404563,
"url": "www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/5th_Battery,_Mississippi_Artillery",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/5th_Battery,_Mississippi_Artillery"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "5th Battery, Mississippi Artillery"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 05:02, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:06:42.000Z
|
srjkrk3g5j7jcunofkhdhj5qxuouhuad
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19218",
"uncompressed_offset": 444456435,
"url": "www.familysearch.org/learn/wiki/en/index.php?target=User+talk%3ALdrbelties&title=Special%3AWhatLinksHere",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=Special:WhatLinksHere&target=User+talk%3ALdrbelties"
}
|
cccc_CC-MAIN-2013-20
|
Pages that link to "User talk:Ldrbelties"
From FamilySearch Wiki
What links here
Filters Hide transclusions | Hide links | Hide redirects
No pages link to User talk:Ldrbelties.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:01:24.000Z
|
fcag7cd7bwjqtzqkhxg2ymuyjdluz6j7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19223",
"uncompressed_offset": 480386444,
"url": "www.grandtheftwiki.com/Launch",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.grandtheftwiki.com/Launch"
}
|
cccc_CC-MAIN-2013-20
|
Launch
From Grand Theft Wiki
Jump to: navigation, search
A Launch in GTA San Andreas.
The Launch is a light patrol boat available only in Grand Theft Auto: San Andreas.
Description
The Launch is essentially a medium-sized boat with armor plating, which is purely cosmetic and will not protect it from taking damage. It has a .50 caliber machine gun on the back; it, however, cannot be used by the player or any NPC, and is considered a static object. Other than that, the boat is also available with minor roof configurations, including a canopy over the front seats or the middle compartment, or having no canopy at all. The boat is also painted blue.
Its speed and handling is fairly good, on par with similar sized speedboats such as the Speeder and Predator, but is affected by its "heavy" armor.
Locations
The Launch occasionally spawns inside the Easter Basin Naval Station in Easter Basin, San Fierro. However, entering the Naval Base automatically gives the player a 5-star wanted level, which means the Launch is tricky to obtain.
The only instance of the Launch other than its constant spawning location is in the loading bay of the aircraft carrier during the mission Vertical Bird; unfortunately, it cannot be stolen from there as the rear door of the ship closes at the exact moment Carl passes under it.
See also
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:57:43.000Z
|
onmz7tnccwsdyqtl7qddhqpafnvdjc55
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19224",
"uncompressed_offset": 492377565,
"url": "www.hindawi.com/journals/ijad/2011/490140/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.hindawi.com/journals/ijad/2011/490140/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
International Journal of Alzheimer's Disease
Volume 2011 (2011), Article ID 490140, 15 pages
doi:10.4061/2011/490140
Review Article
Neuroimaging Measures as Endophenotypes in Alzheimer's Disease
1Laboratory of Neuro Imaging, Department of Neurology, UCLA School of Medicine, 635 Charles Young Drive South, Suite 225, Los Angeles, CA 90095, USA
2Mary S. Easton Center for Alzheimer's Disease Research, Department of Neurology, UCLA School of Medicine, 10911 Weyburn Avenue, Suite 200, Los Angeles, CA 90095, USA
Received 2 September 2010; Revised 8 January 2011; Accepted 7 February 2011
Academic Editor: Lindsay A. Farrer
Copyright © 2011 Meredith N. Braskie et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Late onset Alzheimer's disease (AD) is moderately to highly heritable. Apolipoprotein E allele ε4 (APOE4) has been replicated consistently as an AD risk factor over many studies, and recently confirmed variants in other genes such as CLU, CR1, and PICALM each increase the lifetime risk of AD. However, much of the heritability of AD remains unexplained. AD is a complex disease that is diagnosed largely through neuropsychological testing, though neuroimaging measures may be more sensitive for detecting the incipient disease stages. Difficulties in early diagnosis and variable environmental contributions to the disease can obscure genetic relationships in traditional case-control genetic studies. Neuroimaging measures may be used as endophenotypes for AD, offering a reliable, objective tool to search for possible genetic risk factors. Imaging measures might also clarify the specific mechanisms by which proposed risk factors influence the brain.
1. Introduction
Alzheimer’s disease (AD) is thought to be at least 58–74% heritable [13]. However, much of that heritability has yet to be explained by variants in specific risk genes. Mutations in the amyloid precursor protein (APP) [4], presenilin 1 (PSEN1) [5], and presenilin 2 (PSEN2) [6, 7] genes are known to lead to early onset, familial AD. In familial AD, the disease typically follows an autosomal dominant, usually highly penetrant mode of inheritance. However, for many years only the 4 allele of apolipoprotein E (APOE4) [8] was identified as a reliable genetic risk factor for late-onset AD. On average, 24% of control subjects carry at least one copy of APOE4 [9], and each risk allele carries more than threefold odds of developing AD [9], although these numbers vary across studies; this is a relatively large odds ratio for a highly prevalent risk gene. Recently, large sample genome-wide association (GWA) studies have successfully identified and replicated associations between several single nucleotide polymorphisms (SNPs) and AD [10] (Table 1), namely, in the CLU [11, 12], PICALM [1113], and CR1 [13] genes and near the BIN1 and EXOC3L2 genes [12]. Numerous other genetic polymorphisms also have been associated with a diagnosis of AD, but with less statistical evidence, and replication results are frequently inconsistent [14] (http://www.alzgene.org/). Much work yet remains in discovering the sources of AD heritability. As we note below, large-scale neuroimaging studies provide an approach to discover, replicate, and study new genetic risk factors.
Table 1: Top AD risk genes.
AD is a complex disease whose onset and trajectory are influenced by (1) environmental factors and (2) many genetic polymorphisms having small effects and/or rare polymorphisms having larger effects. Because contributing genes have large effects in aggregate but small effects individually, association studies typically require large samples to reliably identify the individual contribution of any one polymorphism, especially since stringent corrections for multiple comparisons are required by GWA studies. Additionally, genes involved in either neurodevelopment or degeneration or both may contribute to AD risk. The onset of AD is clinically detectable only when the pathological hallmarks of the disease such as amyloid plaques, neurofibrillary tangles, and neuronal loss have advanced to the point where memory impairment and other behavioral changes become evident. Therefore, symptoms may be manifest when abundant pathology overwhelms an otherwise healthy brain, or limited pathology occurs in a brain whose health and resilience is compromised by cortical thinning, reduced white matter integrity, or restricted blood flow.
It is difficult for case-control studies to identify genetic risk factors for AD based on clinical diagnosis alone. This is because AD diagnosis relies on evidence of cognitive deficits identified using standard cognitive tests. Performance on cognitive tests may be influenced by factors unrelated to disease, such as fatigue, anxiety, general test-taking ability, and practice effects. As such, well-educated people suffering from cognitive decline can appear normal in a clinical setting, while cognitively normal worriers may appear to be impaired. Other late-life dementias also may be clinically misdiagnosed as AD. Using brain endophenotypes that are objective and highly reproducible over time may make it easier to identify AD genetic risk factors and to understand their impact on the brain.
In recent multisite efforts, researchers have performed brain scans on and genotyped large numbers of cognitively intact and impaired older adults. These studies have improved the ability of researchers to identify AD-related genes. In this article, we review the results of neuroimaging studies that evaluate the effects on the brain of top AD-related candidate genes other than APOE as well as genetic contributions to brain vulnerability. We discuss the findings from GWA studies that have used neuroimaging measures as endophenotypes for AD, and we offer suggestions for future studies. Finally, we discuss multigene and more advanced genetic models as means to identify specific genetic contributions to AD. The main findings of the studies discussed here are summarized in Table 2 by imaging phenotype.
Table 2: SNPs with AD-relevant effects detected by neuroimaging measures.
2. Candidate Gene Approach
There are two main ways to investigate effects of AD-relevant genes using brain imaging—the first is to study candidate genes already associated with AD, and the second is to use genome-wide scanning to perform an unbiased search of up to a million genetic polymorphisms. Both types of approach have been applied in neuroimaging studies of AD. The earliest studies have focused on the most widely studied candidate gene, APOE.
Although not without conflicting results, many studies have linked APOE4 to neuroimaging measures such as regional hypometabolism assessed using fluorodeoxyglucose positron emission tomography (FDG-PET) (which measures brain glucose metabolism) [1517], functional magnetic resonance imaging (fMRI) activity (which measures variations in regional levels of blood oxygenation and is thought to reflect both blood flow and neuronal activity) during memory tasks and at rest [1826], regional brain volume or cortical thickness (measures of structural gray matter integrity) [2731], white matter integrity [3235], cerebral blood flow [3639], and AD-related pathology such as amyloid and neurofibrillary tangle load [4044]. Results from such APOE neuroimaging studies have been reviewed previously [14, 45, 46].
Neuroimaging differences associated with the APOE genotype may result from incipient AD, or they may relate instead to differences specific to the genotype independent of AD pathology (e.g., developmental differences). If other AD risk genes were to resemble APOE in their effects on the brain, it would support the notion that those brain differences are related to the pathological processes of AD. Additionally, determining the effects on the brain of other AD risk gene variants would help to characterize the mechanisms of those risk alleles, enabling more targeted therapeutic treatments to be developed. Thus far, relatively few neuroimaging studies have examined the effect of AD candidate risk genes other than APOE on the brain (Table 1).
The most recent and comprehensive candidate gene study to date was performed by Biffi and colleagues (2010), who evaluated the effects of top AD risk polymorphisms on six measures shown to predict AD risk and measure disease progression [47]. The authors measured hippocampus, amygdala, and white matter lesion volumes and thickness of the entorhinal cortex, parahippocampal gyrus, and temporal pole cortex in AD patients, mild cognitively impaired (MCI) patients, and normal controls. People with MCI have some degree of demonstrable cognitive impairment not severe enough to warrant a diagnosis of dementia. Approximately 10–15% of those with amnestic MCI convert to probable AD each year compared with an estimated 1-2% of similarly aged cognitively intact individuals [48]. MCI therefore can be used as an indicator of early AD-related changes in the brain. The authors focused on confirmed risk polymorphisms and other potential risk variants identified in recent GWA studies. Among these were APOE, CLU, PICALM, CR1, CNTN5, and BIN1. APOE, which encodes apolipoprotein E—an apolipoprotein that interacts with β-amyloid [49]—was correlated with all brain measures except for white matter lesion volumes. CNTN5, which codes for contactin 5—a protein that may play a role in regional axonal development [50]—is not currently listed as a top AD risk gene [9]. However, it was associated with all measures except for amygdala volume. All the genetic variants except for CLU were statistically correlated with entorhinal cortex thickness. The CLU gene encodes clusterin (also known as apolipoprotein J)—another apolipoprotein that interacts with β-amyloid [51]. Additionally, a variant in the PICALM gene, which codes for phosphatidylinositol binding clathrin assembly protein—a protein involved in regulating the fusion of synaptic vesicles [52]—was correlated with hippocampal volume. Finally, BIN1, which encodes bridging integrator 1—a protein involved in neurite growth [53]—was correlated with temporal pole cortical thickness [47]. The authors suggested that although sample sizes affect the power to detect gene effects, the specificity of relationships with particular polymorphisms may reflect the function and expression patterns of the resulting proteins, possibly elucidating mechanisms that contribute to AD risk [47]. The CLU risk variant rs11136000 was not associated with any of the measures here, but our research group recently found that in young healthy adults, the risk allele of that SNP was associated with reduced integrity of broad white matter regions, observed with diffusion tensor imaging [54]. The lipid transport and membrane recycling performed by the clusterin protein [55] may be important to myelin development but not to medial temporal lobe gray matter. Choosing measures that reflect the purported protein function associated with risk genes in question might help to focus the search for gene effects in the brain.
Another AD gene with structural effects on the brain is SORL1, which encodes the sortilin-related receptor. The gene product is a low-density lipoprotein receptor that may be involved in processing the amyloid precursor protein [56]. SORL1 may also play a role in cardiovascular health [57]. Cuenco and colleagues (2008) evaluated how 30 different polymorphisms in the SORL1 gene related to general cerebral atrophy, hippocampal atrophy, white matter hyperintensities and cerebrovascular disease, which they measured semi-quantitatively [58]. Among the variants tested in African-American and white AD-control sibships was rs2282649—a top AD genetic risk factor [9]. In whites, this variant was associated with cerebral and hippocampal atrophy as part of a 3 SNP haplotype [58]. SNPs within SORL1 also were associated with white matter hyperintensities in two studies [58, 59]. The strongest relationship between rs2282649 and AD is in Asian populations (as determined in a large meta-analysis) [9]. Future comparisons of SNP effects on the brain in Asians versus Caucasians may clarify how this polymorphism relates to AD.
Babiloni and colleagues (2006) used electroencephalography (EEG) to examine how another AD risk gene, CST3, affects resting cortical rhythmicity (the frequency of repetitive spiking of neuronal activity) in subjects with AD and MCI. One haplotype evaluated contained an AD top risk SNP (rs1064039) [60]. CST3 codes for cystatin C, a protein that colocalizes with -amyloid [61] and may be involved in the proliferation of neural stem cells [62]. The amplitude decrease of alpha 1 sources (parietal, occipital, and temporal areas) was more pronounced in AD and MCI patients with the CST3 risk haplotype, possibly indicating greater amyloid load or neuronal death [60]. Follow-up studies of this polymorphism that evaluate brain atrophy using MRI or amyloid load using PET imaging may be valuable.
Some additional neuroimaging studies of major AD risk genes examined the ACE gene, which codes for angiotensin converting enzyme—a protein that modulates the cardiovascular system by helping to regulate extracellular volume. ACE also affects the central nervous system by influencing neurons in the hippocampus and amygdala and helping to maintain the blood brain barrier [63, 64]. All these studies evaluated the commonly evaluated ACE insertion/deletion (I/D). The ACE D/D polymorphism was associated with increased severity of white matter hyperintensities or cerebral infarction in some [65, 66] but not all [67, 68] studies. One study found that the I/I genotype was associated with increased AD risk, and smaller hippocampi and amygdalae [68]. Another found that D carriers with MCI showed differences in resting state fMRI brain activity compared with I homozygotes [63]. The I/D variant examined in these studies is not one of the two currently listed by a large meta-analysis (http://www.alzgene.org/) [9] as being significantly associated with Alzheimer’s disease overall, although some evidence links it with AD risk or unspecified cognitive decline [69, 70]. Regardless, since this variant in the ACE gene appears to modulate brain structure and function, it would be valuable to investigate the effects of other ACE polymorphisms having stronger relationships to AD: namely rs1800764 and rs4291 [9].
Recently, Erten-Lyons and colleagues (2010) evaluated the effects of a less studied AD risk gene, FAS, on the brain in 242 older adults who were cognitively intact or had MCI or AD [71]. FAS codes for the Fas (TNF receptor superfamily, member 6) protein, which may be involved in apoptosis in AD [72]. The authors evaluated 97 SNPs in or near the FAS gene that had been previously associated with AD. After adjustment for multiple testing, they found that rs1468063 was associated with faster AD progression. Carriers of the T allele of that SNP had greater ventricular volumes and smaller brain volumes in a subgroup of 56 subjects [71].
The candidate gene approach also may be used to evaluate the effects of genes predisposing subjects to characteristics (such as hypertension, obesity, high cholesterol, and diabetes) that increase the risk of AD [7375] without necessarily being directly involved in the development of classic AD pathology such as amyloid plaques or neurofibrillary tangles. Examining the effects of these variants in healthy adults and focusing on brain areas susceptible to earliest AD processes may be productive in isolating polymorphisms that create a vulnerability that AD-related pathology later exploits. Recent work has already demonstrated that some such genes have an effect in the brain. For instance, Ho et al. (2010) recently demonstrated in 206 cognitively intact older adults from the ADNI study that risk allele carriers for rs3751812 in the fat mass and obesity associated gene (FTO) had smaller average brain volumes in frontal and occipital lobes relative to noncarriers (Figure 1) [76]. Those of European descent carrying two copies of the common adverse variant of FTO have increased risk for obesity, relative to those carrying no copies [77]. The connection between FTO and brain atrophy is important, as it suggests one mechanism whereby cardiovascular risk factors (including risk genes) may make the brain more vulnerable to the later effects of AD. The FTO gene may cause brain atrophy by promoting a craving for greater caloric intake resulting in higher body mass index (which is also associated with brain atrophy; [78, 79]). It is also possible that FTO affects the brain by direct gene action to promote tissue atrophy or insufficiency. Even so, a variety of lifestyle factors, including education, diet, and exercise, are associated with reduced brain atrophy. This underscores the value of controlling preventable risk factors for brain atrophy [80].
Figure 1: Common genetic variants (single nucleotide polymorphisms) associated with temporal lobe volume in a GWA study are shown in (a) along with an image showing the effects of the top hit, GRIN2b, on brain volume [81].The figure is adapted from Stein et al. (2010) with kind permission from the authors and publishers. (b) shows the effect (regression coefficients) of the candidate obesity gene, FTO, on brain atrophy in a cognitively normal adults and those with MCI and AD [76]. The figure is adapted from Ho et al. (2010) with kind permission from the authors and publishers.
Other studies have focused on variants associated with genes important for blood pressure regulation and cholesterol levels such as the previously mentioned ACE [65, 66] and SORL1 variant studies [58, 59]. Studies focusing on regions affected early in AD such as the hippocampus, entorhinal cortex [82], and posterior cingulate cortex [15] may be helpful in further elucidating the links between AD and cardiovascular health.
3. Genome-Wide Association Studies
Recently, a small number of studies have used genome-wide association (GWA) to search for novel genetic variants associated with AD endophenotypes. Discovering new risk genes would be extremely beneficial to the study of AD. Clinical trials could then selectively enroll, or perform sub-analyses on risk allele carriers, who are more likely to decline than noncarriers. Those at heightened genetic risk might also benefit the most from early treatment. Additionally, using AD risk genes as covariates would boost power in AD-related studies since modeling the identified genetic risk factors reduces otherwise unexplained variance in the disease trajectory, making other influential factors easier to detect.
Several initiatives, such as Alzheimer’s Disease Neuroimaging Initiative (ADNI) (http://www.loni.ucla.edu/ADNI), are now searching for new gene risk variants using neuroimaging traits that are highly heritable, easily measured in a reliable way, and associated with AD [83]. This may be a valuable way to overcome some of the obstacles inherent in diagnosis-based searches for risk polymorphisms. For instance, one might use as an endophenotype the baseline regional neuroimaging measures known to predict longitudinal cognitive decline in amnestic MCI or early AD. Such measures make specific diagnoses unnecessary because they focus on symptoms, namely the confluence of longitudinally decreased cognitive ability with specific functional or structural brain deficits that predict that decrease. Also, as continuous measures that vary across the continuum of normalcy from MCI to AD, neuroimaging measures may offer greater statistical power for genetic analysis than binary diagnostic categories. Suggested criteria for endophenotypes are that the measures are associated with illness, are heritable, are apparent in an individual regardless of whether the illness is active, and that they co-segregate with illness within families [84]. Some neuroimaging measures, such as hippocampal and ventricular volume largely meet these criteria as endophenotypes for AD. Both increased ventricular volume [8588] and decreased volume of medial temporal lobe structures, especially the hippocampus [8792] predict cognitive decline, are moderately to highly heritable [9395], and are associated with AD and genetic risk for AD (Table 2). Other measures that show promise in predicting cognitive decline are brain amyloid burden as measured using Pittsburgh Compound B [96] and white matter integrity (in general and perhaps more specifically in the parietal lobe) as measured with diffusion tensor imaging [97] both of which are also highly heritable [98, 99]. Some neuroimaging measures may not yet be considered endophenotypes. For instance, glucose metabolism as measured with FDG-PET [100102], and cerebral perfusion as measured with arterial spin labeling [103] also may predict cognitive decline, but large-scale heritability studies of these measures in healthy older adults are needed to ascertain their potential for identifying genetic influences. These guidelines may be useful when evaluating the utility of a measure as an endophenotype.
One recent GWA study by Shen and associates (2010) evaluated genetic associations with brain structure using a large number of nonspecific phenotypes. They studied 733 AD and MCI patients and normal controls from the ADNI cohort and controlled for age, sex, education, handedness, and baseline intracranial volume [104]. The authors examined 142 regions of interest and found that the well-known variants in APOE (rs429358/rs7412 a.k.a. ε2/3/4) and in a more newly identified gene, TOMM40 (rs2075650), were strongly associated with bilateral hippocampus and amygdala volumes. Four additional SNPs were associated at the level with regional gray matter density. In the EPHA4 gene, rs10932886 was correlated with gray matter density in the left precuneus and bilateral frontal regions—regions in which atrophy occurs in late AD [105]. EPHA4 codes for the EPH receptor A4—a receptor tyrosine kinase that regulates dendritic spine morphology in pyramidal cells of the adult hippocampus. EPHA4 also helps to control glial glutamate transport resulting in regulation of hippocampal function [106]. Its association with hippocampal structure and function makes this gene an intriguing target for future study. Likewise, rs6463843 in the NXPH1 gene was associated with gray matter density in the left middle orbital frontal gyrus. NXPH1 encodes the neurexophilin 1 protein, which is a physical ligand for -neurexins—proteins that may participate in synaptic function [107]. Finally, rs4692256 (LOC391642) was associated with gray matter density in the right hippocampus, but the function of the genetic material containing that SNP is unknown. The authors also reported a number of other associations at the more liberal level [104].
Two other recent ADNI-based GWA studies focused their searches on temporal lobe structures; temporal lobe volume is highly heritable and is also a relatively good predictor of developing AD. Potkin et al. (2009) used a genome-wide search for polymorphisms affecting hippocampal gray matter density, and identified novel AD susceptibility genes in 381 subjects who had AD or were normal controls [108]. AD cases differed in genotype from controls at rs429358 (one of the two SNPs comprising the APOE 2/3/4 genotype), and at rs2075650 in the TOMM40 gene. Using a significance threshold of and covarying for age, sex, and the number of APOE4 alleles, four SNPs were associated with right or left hippocampal gray matter density [108]. Two of these, rs10074258 and rs12654281, were in or near the EFNA5 gene [108], which encodes the ephrin-A5 protein implicated in nervous system development including in the hippocampus [109]. The gene function and association with hippocampal structure across multiple SNPs makes it an alluring target for future study. Two other SNPs associated with hippocampal gray matter density at the level were rs10781380 in the PRUNE2 gene and rs1888414 near the FDPSP gene [108]. These two SNPs have a less clear tie to AD-related symptoms compared with those in EFNA5. At the level, the authors also identified correlations of right or left hippocampal gray matter density with genotypes at an additional 11 SNPs.
In a larger study also using the ADNI dataset, Stein and colleagues (2010) used MRI and GWA to identify SNPs associated with temporal lobe and hippocampal volumes in 742 AD and MCI patients and healthy elderly adults, controlling for age and sex (Figure 1) [81]. The authors also evaluated the relationship between temporal lobe volume and the APOE2/3/4 genotype, which was not part of the Illumina gene chip used in the GWA. As expected, APOE4 was associated with lower temporal lobe volume. Additionally, at a significance level of , the authors identified two SNPs that were associated with bilateral temporal lobe volume across diagnoses: rs10845840 in the GRIN2B gene (independent of an APOE4 effect), and rs2456930, located in an intergenic region of chromosome 15 [81]. The GRIN2B gene codes for a regulatory subunit 2B (NR2B) of the NMDA (N-methyl D-aspartate) glutamate receptor. NR2B is implicated in learning, memory, and structural plasticity, and cognitive deficits in Alzheimer’s disease [110, 111]. The same glutamate receptor is also the target of memantine [112], a drug designed to slow the progression of AD. This makes GRIN2B an attractive target for future AD investigations generally, and also specifically with respect to how it may modulate memantine drug effects.
Finally, in the first voxelwise GWA (vGWA) study, Stein and colleagues (2010) examined the effects of genetic variation on brain structure as determined using tensor-based morphometry, while controlling for age and sex [113]. Rather than testing for genetic associations with one or a small number of structural measures, associations were tested at each of hundreds of thousands of voxels in the image—leading to a whole-brain, whole-genome search. The authors evaluated 740 subjects from the ADNI study who had AD or MCI, or were normal controls, and identified only the most significant SNP association at each voxel. Top SNPs identified within known genes in this GWA search were rs476463 in the CSMD2 gene and rs2429582 in the CADPS2 gene [113]. CSMD2 (CUB and Sushi multiple domains 2) maps to a chromosomal region that may contain a suppressor of oligodendrogliomas [114], although little is yet known about the protein function. CADPS2 codes for Ca++-dependent secretion activator 2, a protein that regulates synaptic vesicle and large dense core vesicle priming in neurons, and promotes monoamine uptake and storage in neurons [115]. Although no SNP survived a false discovery rate correction at [113], this method remains promising when larger sample sizes become available. Stringent corrections are needed when searching an entire image for genomic effects, but the size of the search space can be greatly reduced by carrying forward promising voxels to later analyses. Because of this, the sample sizes needed to replicate a GWA finding, when searching an entire image, are typically much smaller than the discovery sample size (as low as 300-400 rather than 700 subjects [113]) as the voxels with no effects can be discarded in the replication analyses.
The sample size needed to detect statistical relationships between genetic risk factors and specific brain measures depends upon the measure being studied. Beckett and colleagues (2010) recently compared the ability of various MRI- and PET-derived attributes to track the progression of MCI and AD [116]. Regions of interest derived from specific brain voxels showing significant relationships to cognitive impairment in previous studies gave greater power to detect a slowing of the disease than measures related to whole structures such as the hippocampus. The increased power of statistical voxel selection was later reinforced by studies using both MRI [117] and FDG-PET [118]. Such statistically predefined regions of interest may be promising targets of genetic studies in which gene effects can be mapped using statistical mapping approaches. By focusing on regions with greatest statistical effects, the power to detect or replicate genetic effects in follow-up studies is vastly increased [119]. In that regard, imaging studies can avoid a general problem in large-scale genetics; by focusing on promising voxels, replication samples may in fact be smaller than the discovery samples, if the effects of the genes in the brain are somewhat localized. The selection of sets of voxels showing significant genetic associations is helpful to boost power, above and beyond focusing solely on regions that are clinically important to the disease of interest (which is also important). Such an approach has been advocated by Chen et al. (2010) and Wu et al. (2010) [118, 120]. There are at least three advantages in focusing on specific voxels over predefined anatomical regions of interest. First, although a given gene variant may affect a region that shows dramatic effects in a given disease, that whole region may not be equally affected. Using a voxelwise approach may help to identify subregions that would provide a more concentrated focus for future replication efforts. An example is a recent study of the brain derived neurotrophic factor (BDNF) genes, in which common variants were associated with brain fiber integrity on DTI, in 455 subjects [119]. When the sample was split into two, the same regions of the white matter showed associations in each subsample, but there would have been no a priori reason to select those regions as implicated. Limiting a search to significant voxels in follow-up studies boosts power by avoiding image wide corrections for statistical tests at voxels less likely to show an effect. Secondly, although the focus of a study may be AD, pathways altered by a specific gene variant may be relevant to multiple complex diseases and disorders. Data collection and analysis are costly in genetic neuroimaging studies. Therefore, reporting all significant results can provide information that may not otherwise be easily obtained but may be useful to researchers at large. Thirdly, image based tests for replication, such as conjunction tests, can be devised that allow specific sets of brain regions, not just specific genes, to be replicated as showing associations (see, e.g., Ho et al. 2010 [76]).
In GWA studies, it is conventional to enforce a significance cut-off of or . This represents a Bonferroni-type correction for the false positives that could occur when 500,000 SNPs are searched for statistical effects. As adjacent SNPs are somewhat correlated (due to linkage disequilibrium effects), the effective number of tests is slightly fewer than the number of SNPs tested, but even SNPs falling below are considered to show “genome-wide evidence” requiring replication in subsequent studies or in meta-analyses of multiple independent datasets. So far, there is no universal agreement as to what statistical threshold for GWA studies is the best. The above ROI-based GWA studies reviewed here all used a threshold of at least 10-7 to report their top findings [81, 104, 108], which controls for multiple comparisons in the tests performed. Dudbridge and Gusnanto (2008) suggested that a genome-wide significance threshold should not account only for markers that have been tested in a study, but also for all possible genomic variation. This leads to a more conservative threshold of [121]. Because of the required time and cost of collecting and analyzing neuroimaging data, the sample sizes here, although large for imaging studies, remain small for genetic studies. These smaller sample sizes may produce false positives unless independent replication is performed. Still, functionally promising SNPs have been identified in these studies, highlighting numerous replication targets for future work.
All four of the above GWA studies were performed using scans from the ADNI dataset with a high degree of overlap of subjects. Even so, the top SNPs were not replicated across studies. This may be due to a number of methodological factors. First, the sample sizes needed to detect a genetic association depend on the minor allele frequency and effect size, and are typically between a few hundred and several thousand subjects. With this limitation, measures that show association in one study may be missing in another. Even different software used to measure the same structure do not give perfectly correlated measures. Also, many associations will be missed due to imprecision in the measures—single gene effects are typically only detectable for measures with the highest precision and reproducibility. Additionally, across studies, the initial genetic searches did not adjust for the same covariates in addition to age and sex. For instance, Potkin and colleagues covaried for APOE genotype [108], but Shen and colleagues covaried for education, handedness, and baseline intracranial volume [104], and the Stein et al. studies did not use additional covariates [81, 113]. Finally, the choices of ROI and methods of delineating those regions varied across studies. The ENIGMA (Enhancing Neuro Imaging Genetics through Meta-Analysis) project (http://enigma.loni.ucla.edu/) [122] is one of several multicenter initiatives to standardize genetic and imaging methods. Its goal is to empower future replication efforts and make it easier to perform meta-analyses. Because different SNP sets are genotyped in different studies, imputation methods are employed to allow the same set of genomic variations to be queried across every dataset.
Using GWA to evaluate how genetic variance affects AD endophenotypes in cognitively intact younger and older adults may also aid in identifying AD genetic risk factors. Genetic variants associated with brain measures in young cognitively normal adults are less likely to be associated with molecular pathology. More likely, they support early vulnerabilities in the brain that AD pathology later exploits. The polymorphisms may, for instance, relate to health factors that increase the risk of AD, such as obesity and diabetes, or may relate to neural development in regions affected in early AD, such as the hippocampus and entorhinal cortex. Variants identified in cognitively intact older adults may relate to both AD molecular processes and vulnerabilities in the brain. Using amyloid imaging measures in these subjects may be helpful in identifying genetic risk factors for earliest AD changes.
An imaging measure may be associated with a particular polymorphism during development but may also be related to other gene polymorphisms with respect to degeneration later in life. Therefore, it is not the measurement, but rather its context and other demographic factors that determine whether gene effects relate to neurodevelopment or degeneration. This should be borne in mind when replicating gene effects across cohorts. For instance, in Stein et al. (2011), caudate volume was associated with commonly carried variants in dopamine-related genes, and the effects were found in an large elderly cohort scanned in North America, and replicated in a young adult cohort scanned in Australia [123]. Such replications of SNPs may indicate gene effects that persist throughout life. The use of two very different samples is likely to identify genes of enduring relevance across the lifespan, but may miss or fail to replicate effects that exist or are more dominant only in late or early life. Naturally, there is a greater preponderance of apoptotic events in an elderly sample and more developmental or synaptogenic processes in the younger samples. For this reason, genome-wide meta-analyses must not regard failure to replicate as a sign that gene is not influential in a given part of the lifespan, or in a given cohort or continent.
In a study of normal brain aging, Seshadri and colleagues (2007) investigated genetic associations with measures of total cerebral brain volume, lobar, ventricular and white matter hyperintensity volumes, and scores on six cognitive tests. They identified three SNPs (located in ERBB4, PDLIM5, and RFX4) that were associated both with measures of frontal or parietal brain volumes and with tests of executive function and abstract reasoning. These results did not survive testing for multiple comparisons, but they may be used to generate future hypotheses or to offer support to findings in future GWA studies [124]. As this study was one of brain aging rather than of AD, cognitively normal adults were studied and not all measures examined were specific to AD risk. Therefore, some of the SNPs generated may relate more to brain aging or normal development than to AD risk.
Two GWA studies that we know of have examined endophenotypes in healthy young adults—a GWA study of caudate volume in 1198 young and old adults [123] and the first voxelwise GWA study of diffusion tensor images [125]. Further studies that focus on brain measurements specific to AD would be useful additions to the field. Since the brain differences that are likely to occur in normal adults are subtle compared to those in studies of a brain disease, very large numbers of subjects are needed to perform GWA in healthy young adults and to show that the results are reliable and reproducible across independent samples. The ENIGMA network brings together researchers in imaging and genetics, and current analyses are probing structural and functional neuroimaging and GWA data from over 10,000 subjects. This type of effort will prove invaluable in replication studies. ENIGMA also allows for the identification of “slow climbers”—genetic variants that may not be significant in all studies or in any one study alone, but may become highly significant when data is aggregated across studies.
GWA and vGWA involve huge numbers of comparisons, which may result in false positives if not properly controlled. It is therefore incumbent upon readers of such studies to critically evaluate the significance levels of the studies before basing potentially costly experiments upon their results. However, such exploratory studies may provide information that would not otherwise be easily obtained and can be extremely useful in focusing future work. For instance, one might not collect thousands of MRI scans to test the effect of one SNP previously found to be marginally significant. However, it may make sense to test the effects of that SNP in conjunction with other more established ones when GWA data has already been collected and the MRI scans have been physically analyzed. In this way, it is possible to build easily on previous results until they are strong enough to warrant independent exploration.
In addition, the large number of statistical tests involved in a genome-wide and/or image wide search requires special methods to boost power, including gene-based tests [126], ridge regression models [127], multilocus modeling, and meta-analysis. In the first voxelwise GWA studies of MRI and DTI [113, 125], no single SNP passed the conventional threshold for genome-wide significance; even so, the top SNPs can be prioritized when screening new imaging datasets for replications of these hits. Efforts such as the ENIGMA consortium have found that some SNPs identified by GWA are robustly associated with hippocampal volume and total brain volume. Although no single contributing site was able to find results that were genome-wide significant, the effects of several SNPs were robustly replicated when meta-analyzed across imaging datasets of more than 6400 subjects from 16 imaging sites [128].
4. Multiple Genetic Risk Factors
A statistical test of association between a set of SNPs and a disease can offer far greater power and success in determining genetic risk than tests of single SNPs [129]. This is in part because the risk conferred by different SNPs may depend on the context and on several demographic and environmental factors—the age of the cohort, their educational level, and even their socioeconomic status [130]. Because of this, more complex models of gene action in AD are likely to include not only multiple SNPs, but also environmental and other risk factors that affect whether those variants are relevant or innocuous.
Multilocus genetic modeling refers to a large class of methods that assesses the effects of sets of SNPs—within the same or different genes—in predicting clinical diagnosis, prognosis, or disease risk. Looking at the additive or epistatic (interactive) effects of multiple risk gene variants may be useful, especially when the genes in question have similar effects. For instance, Szolnoki and colleagues (2003) found in 961 subjects that carriers of APOE2 or APOE4 had increased risk of white matter hyperintensities in their brains only if they also carried risk variants in the ACE or MTHFR (methylenetetrahydrofolate reductase (NAD(P)H)) genes [131]. All three are listed as top AD risk genes [9] and also affect the cardiovascular system, so it makes sense to examine their additive effects on the brain. Multilocus genetic models can assess the combined effects of multiple gene sets acting together.
Because adjacent SNPs in a genome-wide association study may be highly correlated due to linkage disequilibrium, it is not possible to use standard statistical methods, such as multiple regression, to identify which SNPs exert an influence on a trait. Machine learning methods that can cope with high-dimensional sets of predictors include such techniques as penalized regression, adaptive boosting, and the “Bayesian lasso”. All of these methods have been used widely in quantitative genetics, and show substantial promise for analyzing brain imaging phenotypes.
Multilocus models are conceptually attractive as they allow the testing of the aggregate effect of several SNPs in the same gene, which individually may have effects too weak to detect on their own. In one study [126], we applied a novel method, multivariate principal components regression (PCReg) to test whole genes for associations with imaging data, not just single SNPs within them. When multiple partial-F tests were used to test the joint effect of all SNPs in a gene on regional brain volume differences, we identified several genes associated with brain-related disorders that are highly relevant to brain structure. GRB-associated binding protein 2 gene, GAB2—the most significantly associated gene in our analysis—has previously been linked to late-onset AD, and GAB2 associations showed a symmetric signal in the white matter superior to the lateral ventricles. As a caveat, other methods that include multiple SNPs can sacrifice power as increasingly stringent corrections are applied to guard against finding spurious associations using high-dimensional regression models with many parameters. Even so, efficient gene-based association tests across the whole brain can drastically reduce the number of independent tests performed, detecting known genes highly relevant to brain structure that may be missed by univariate methods alone.
5. Conclusion
In summary, using neuroimaging endophenotypes to identify AD risk factors is a new and promising enterprise. Future studies of the combined effects of multiple candidate risk factors, and an expansion of genome-wide studies to a wide variety of imaging modalities may help generate new endophenotypes that predict AD. Additionally, a focus on particular contributions to AD risk, such as deposition of AD-related pathology, or developmental vulnerabilities might prove productive in unraveling disease complexity. For instance, searching for gene variants of an AD endophenotype in a large sample of healthy young adults would be most likely to uncover genes affecting developmental vulnerabilities to the disease. In contrast, examining a given endophenotype in AD and MCI patients while controlling for gene variants known to affect that measure in younger adults would boost the power to identify polymorphisms related to AD processes and cumulative environmental risk factors, while excluding some developmental effects. Careful selection of endophenotype, data pooling across studies and analysis of multiple different aspects of AD pathology and vulnerabilities may prove invaluable in the quest to explain the genetic risk for AD.
References
1. A. L. M. Bergem, K. Engedal, and E. Kringlen, “The role of heredity in late-onset Alzheimer disease and vascular dementia: a twin study,” Archives of General Psychiatry, vol. 54, no. 3, pp. 264–270, 1997. View at Scopus
2. M. Gatz, N. L. Pedersen, S. Berg et al., “Heritability for Alzheimer's disease: the study of dementia in Swedish twins,” Journals of Gerontology. Series A, vol. 52, no. 2, pp. M117–M125, 1997. View at Scopus
3. M. Gatz, C. A. Reynolds, L. Fratiglioni et al., “Role of genes and environments for explaining Alzheimer disease,” Archives of General Psychiatry, vol. 63, no. 2, pp. 168–174, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
4. A. Goate, M. C. Chartier-Harlin, M. Mullan et al., “Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease,” Nature, vol. 349, no. 6311, pp. 704–706, 1991. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
5. R. Sherrington, E. I. Rogaev, Y. Liang et al., “Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease,” Nature, vol. 375, no. 6534, pp. 754–760, 1995. View at Scopus
6. E. Levy-Lahad, W. Wasco, P. Poorkaj et al., “Candidate gene for the chromosome 1 familial Alzheimer's disease locus,” Science, vol. 269, no. 5226, pp. 973–977, 1995. View at Scopus
7. E. I. Rogaev, R. Sherrington, E. A. Rogaeva et al., “Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene,” Nature, vol. 376, no. 6543, pp. 775–778, 1995. View at Scopus
8. E. H. Corder, A. M. Saunders, W. J. Strittmatter et al., “Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families,” Science, vol. 261, no. 5123, pp. 921–923, 1993. View at Scopus
9. L. Bertram, M. B. McQueen, K. Mullin, D. Blacker, and R. E. Tanzi, “Systematic meta-analyses of Alzheimer disease genetic association studies: the AlzGene database,” Nature Genetics, vol. 39, no. 1, pp. 17–23, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
10. N. Ertekin-Taner, “Genetics of Alzheimer disease in the pre- and post-GWAS era,” Alzheimer's Research and Therapy, vol. 2, no. 1, page 3, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
11. D. Harold, R. Abraham, P. Hollingworth et al., “Genome-wide association study identifies variants at CLU and PICALM associated with Alzheimer's disease,” Nature Genetics, vol. 41, no. 10, pp. 1088–1093, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
12. S. Seshadri, A. L. Fitzpatrick, M. A. Ikram, et al., “Genome-wide analysis of genetic loci associated with Alzheimer disease,” Journal of the American Medical Association, vol. 303, no. 18, pp. 1832–1840, 2010. View at Publisher · View at Google Scholar · View at PubMed
13. J.-C. Lambert, S. Heath, G. Even, et al., “Genome-wide association study identifies variants at CLU and CR1 associated with Alzheimer's disease,” Nature Genetics, vol. 41, no. 10, pp. 1094–1099, 2009. View at Publisher · View at Google Scholar · View at PubMed
14. T. Zetzsche, D. Rujescu, J. Hardy, and H. Hampel, “Advances and perspectives from genetic research: development of biological markers in Alzheimer's disease,” Expert Review of Molecular Diagnostics, vol. 10, pp. 667–690, 2010.
15. G. W. Small, L. M. Ercoli, D. H. S. Silverman et al., “Cerebral metabolic and cognitive decline in persons at genetic risk for Alzheimer's disease,” Proceedings of the National Academy of Sciences of the United States of America, vol. 97, no. 11, pp. 6037–6042, 2000. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
16. L. Mosconi, S. De Santi, M. Brys et al., “Hypometabolism and altered cerebrospinal fluid markers in normal apolipoprotein E E4 carriers with subjective memory complaints,” Biological Psychiatry, vol. 63, no. 6, pp. 609–618, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
17. E. M. Reiman, K. Chen, G. E. Alexander et al., “Correlations between apolipoprotein E ε4 gene dose and brain-imaging measurements of regional hypometabolism,” Proceedings of the National Academy of Sciences of the United States of America, vol. 102, no. 23, pp. 8299–8302, 2005. View at Publisher · View at Google Scholar · View at PubMed
18. S. Y. Bookheimer, M. H. Strojwas, M. S. Cohen et al., “Patterns of brain activation in people at risk for Alzheimer's disease,” New England Journal of Medicine, vol. 343, no. 7, pp. 450–456, 2000. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
19. N. A. Suthana, A. Krupa, M. Donix et al., “Reduced hippocampal CA2, CA3, and dentate gyrus activity in asymptomatic people at genetic risk for Alzheimer's disease,” NeuroImage, vol. 53, no. 3, pp. 1077–1084, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
20. M. W. Bondi, W. S. Houston, L. T. Eyler, and G. G. Brown, “fMRI evidence of compensatory mechanisms in older adults at genetic risk for Alzheimer disease,” Neurology, vol. 64, no. 3, pp. 501–508, 2005. View at Scopus
21. S. D. Han, W. S. Houston, A. J. Jak et al., “Verbal paired-associate learning by APOE genotype in non-demented older adults: fMRI evidence of a right hemispheric compensatory response,” Neurobiology of Aging, vol. 28, no. 2, pp. 238–247, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
22. N. Filippini, B. J. MacIntosh, M. G. Hough et al., “Distinct patterns of brain activity in young carriers of the APOE-ε4 allele,” Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 17, pp. 7209–7214, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
23. M. Pihlajamaki, K. O'Keefe, L. Bertram et al., “Evidence of altered posteromedial cortical fMRI activity in subjects at risk for Alzheimer disease,” Alzheimer Disease and Associated Disorders, vol. 24, no. 1, pp. 28–36, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
24. J. Lind, J. Persson, M. Ingvar et al., “Reduced functional brain activity response in cognitively intact apolipoprotein E ε4 carriers,” Brain, vol. 129, no. 5, pp. 1240–1248, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
25. M. A. Trivedi, T. W. Schmitz, M. L. Ries et al., “Reduced hippocampal activation during episodic encoding in middle-aged individuals at genetic risk of Alzheimer's disease: a cross-sectional study,” BMC Medicine, vol. 4, article 1, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
26. G. Xu, D. G. Mclaren, M. L. Ries et al., “The influence of parental history of Alzheimer's disease and apolipoprotein E ε4 on the BOLD signal during recognition memory,” Brain, vol. 132, no. 2, pp. 383–391, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
27. A. C. Burggren, M. M. Zeineh, A. D. Ekstrom et al., “Reduced cortical thickness in hippocampal subregions among cognitively normal apolipoprotein E e4 carriers,” NeuroImage, vol. 41, no. 4, pp. 1177–1183, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
28. F. Crivello, H. Lemaître, C. Dufouil et al., “Effects of ApoE-ε4 allele load and age on the rates of grey matter and hippocampal volumes loss in a longitudinal cohort of 1186 healthy elderly persons,” NeuroImage, vol. 53, no. 3, pp. 1064–1069, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
29. P. Shaw, J. P. Lerch, J. C. Pruessner et al., “Cortical morphology in children and adolescents with different apolipoprotein E gene polymorphisms: an observational study,” Lancet Neurology, vol. 6, no. 6, pp. 494–500, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
30. N. Schuff, N. Woerner, L. Boreta et al., “MRI of hippocampal volume loss in early Alzheimer's disease in relation to ApoE genotype and biomarkers,” Brain, vol. 132, no. 4, pp. 1067–1077, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
31. A. J. Jak, W. S. Houston, B. J. Nagel, J. Corey-Bloom, and M. W. Bondi, “Differential cross-sectional and longitudinal impact of APOE genotype on hippocampal volumes in nondemented older adults,” Dementia and Geriatric Cognitive Disorders, vol. 23, no. 6, pp. 382–389, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
32. J. Nierenberg, N. Pomara, M. J. Hoptman, J. J. Sidtis, B. A. Ardekani, and K. O. Lim, “Abnormal white matter integrity in healthy apolipoprotein E epsilon4 carriers,” NeuroReport, vol. 16, no. 12, pp. 1369–1372, 2005. View at Publisher · View at Google Scholar · View at Scopus
33. J. Persson, J. Lind, A. Larsson et al., “Altered brain white matter integrity in healthy carriers of the APOE ε4 allele: a risk for AD?” Neurology, vol. 66, no. 7, pp. 1029–1033, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
34. C. D. Smith, H. Chebrolu, A. H. Andersen et al., “White matter diffusion alterations in normal women at risk of Alzheimer's disease,” Neurobiology of Aging, vol. 31, no. 7, pp. 1122–1131, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
35. C. Wang, G. T. Stebbins, D. A. Medina, et al., “Atrophy and dysfunction of parahippocampalwhite matter in mild Alzheimer's disease,” Neurobiology of Aging. In press.
36. M. Thambisetty, L. Beason-Held, Y. An, M. A. Kraut, and S. M. Resnick, “APOE ε4 genotype and longitudinal changes in cerebral blood flow in normal aging,” Archives of Neurology, vol. 67, no. 1, pp. 93–98, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
37. A. S. Fleisher, K. M. Podraza, K. J. Bangen et al., “Cerebral perfusion and oxygenation differences in Alzheimer's disease risk,” Neurobiology of Aging, vol. 30, no. 11, pp. 1737–1748, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
38. P. Hogh, G. M. Knudsen, K. H. Kjaer, O. S. Jørgensen, O. B. Paulson, and G. Waldemar, “Single photon emission computed tomography and apolipoprotein E in Alzheimer's disease: impact of the ε4 allele on regional cerebral blood flow,” Journal of Geriatric Psychiatry and Neurology, vol. 14, no. 1, pp. 42–51, 2001. View at Scopus
39. N. Scarmeas, C. G. Habeck, J. Hilton et al., “APOE related alterations in cerebral activation even at college age,” Journal of Neurology, Neurosurgery and Psychiatry, vol. 76, no. 10, pp. 1440–1444, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
40. G. W. Small, P. Siddarth, A. C. Burggren et al., “Influence of cognitive status, age, and APOE-4 genetic risk on brain FDDNP positron-emission tomography imaging in persons without dementia,” Archives of General Psychiatry, vol. 66, no. 1, pp. 81–87, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
41. A. Drzezga, T. Grimmer, G. Henriksen et al., “Effect of APOE genotype on amyloid plaque load and gray matter volume in Alzheimer disease,” Neurology, vol. 72, no. 17, pp. 1487–1494, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
42. C. C. Rowe, K. A. Ellis, M. Rimajova et al., “Amyloid imaging results from the Australian Imaging, Biomarkers and Lifestyle (AIBL) study of aging,” Neurobiology of Aging, vol. 31, no. 8, pp. 1275–1283, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
43. E. M. Reiman, K. Chen, X. Liu et al., “Fibrillar amyloid-β burden in cognitively normal people at 3 levels of genetic risk for Alzheimer's disease,” Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 16, pp. 6820–6825, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
44. J. C. Morris, C. M. Roe, C. Xiong et al., “APOE predicts amyloid-beta but not tau Alzheimer pathology in cognitively normal aging,” Annals of Neurology, vol. 67, no. 1, pp. 122–131, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
45. N. Scarmeas and Y. Stern, “Imaging studies and APOE genotype in persons at risk for Alzheimer's disease,” Current Psychiatry Reports, vol. 8, no. 1, pp. 11–17, 2006. View at Scopus
46. S. Bookheimer and A. Burggren, “APOE-4 genotype and neurophysiological vulnerability to Alzheimer's and cognitive aging,” Annual Review of Clinical Psychology, vol. 5, pp. 343–362, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
47. A. Biffi, C. D. Anderson, R. S. Desikan et al., “Genetic variation and neuroimaging measures in Alzheimer disease,” Archives of Neurology, vol. 67, no. 6, pp. 677–685, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
48. R. C. Petersen, “Mild cognitive impairment: transition between aging and Alzheimer's disease,” Neurologia, vol. 15, no. 3, pp. 93–101, 2000. View at Scopus
49. K. R. Bales, T. Verina, D. J. Cummins et al., “Apolipoprotein E is essential for amyloid deposition in the APP(V717F) transgenic mouse model of Alzheimer's disease,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 26, pp. 15233–15238, 1999. View at Publisher · View at Google Scholar · View at Scopus
50. Y. Shimoda and K. Watanabe, “Contactins: emerging key roles in the development and function of the nervous system,” Cell Adhesion and Migration, vol. 3, no. 1, pp. 64–70, 2009. View at Publisher · View at Google Scholar · View at Scopus
51. B. V. Zlokovic, C. L. Martel, J. B. Mackic et al., “Brain uptake of circulating apolipoproteins J and E complexed to Alzheimer's amyloid β,” Biochemical and Biophysical Research Communications, vol. 205, no. 2, pp. 1431–1437, 1994. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
52. A. Harel, F. Wu, M. P. Mattson, C. M. Morris, and P. J. Yao, “Evidence for CALM in directing VAMP2 trafficking,” Traffic, vol. 9, no. 3, pp. 417–429, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
53. M. H. Butler, C. David, G. C. Ochoa et al., “Amphiphysin II (SH3p9; BIN1), a member of the amphiphysin/Rvs family, is concentrated in the cortical cytomatrix of axon initial segments and nodes of ranvier in brain and around T tubules in skeletal muscle,” Journal of Cell Biology, vol. 137, no. 6, pp. 1355–1367, 1997. View at Publisher · View at Google Scholar · View at Scopus
54. M. N. Braskie, N. Jahanshad, J. L. Stein, et al., “Common Alzheimer's disease risk variant within the CLU gene affects white matter microstructure in young adults,” San Diego, Calif, USA, 2010.
55. G. Dati, A. Quattrini, L. Bernasconi et al., “Beneficial effects of r-h-CLU on disease severity in different animal models of peripheral neuropathies,” Journal of Neuroimmunology, vol. 190, no. 1-2, pp. 8–17, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
56. E. Rogaeva, Y. Meng, J. H. Lee et al., “The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease,” Nature Genetics, vol. 39, no. 2, pp. 168–177, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
57. K. Ohwaki, H. Bujo, M. Jiang, H. Yamazaki, W. J. Schneider, and Y. Saito, “A secreted soluble form of LR11, specifically expressed in intimal smooth muscle cells, accelerates formation of lipid-laden macrophages,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 27, no. 5, pp. 1050–1056, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
58. K. T. Cuenco, K. L. Lunetta, C. T. Baldwin et al., “Association of distinct variants in SORL1 with cerebrovascular and neurodegenerative changes related to Alzheimer disease,” Archives of Neurology, vol. 65, no. 12, pp. 1640–1648, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
59. M. Schuur, J. C. Van Swieten, S. Schol-Gelok et al., “Genetic risk factors for cerebral small-vessel disease in hypertensive patients from a genetically isolated population,” Journal of Neurology, Neurosurgery and Psychiatry, vol. 82, no. 1, pp. 41–44, 2011. View at Publisher · View at Google Scholar · View at PubMed
60. C. Babiloni, L. Benussi, G. Binetti et al., “Genotype (cystatin C) and EEG phenotype in Alzheimer disease and mild cognitive impairment: a multicentric study,” NeuroImage, vol. 29, no. 3, pp. 948–964, 2006. View at Publisher · View at Google Scholar · View at PubMed
61. H. V. Vinters, G. S. Nishimura, D. Lenard Secor, and W. M. Pardridge, “Immunoreactive A4 and gamma-trace peptide colocalization in amyloidotic arteriolar lesions in brains of patients with Alzheimer's disease,” American Journal of Pathology, vol. 137, no. 2, pp. 233–240, 1990.
62. P. Taupin, J. Ray, W. H. Fischer et al., “FGF-2-responsive neural stem cell proliferation requires CCg, a novel autocrine/paracrine cofactor,” Neuron, vol. 28, no. 2, pp. 385–397, 2000.
63. Z. Zhang, L. Deng, F. Bai et al., “Alteration of resting brain function by genetic variation in angiotensin converting enzyme in amnestic-type mild cognitive impairment of Chinese Han,” Behavioural Brain Research, vol. 208, no. 2, pp. 619–625, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
64. O. Von Bohlen and Halbach, “Angiotensin IV in the central nervous system,” Cell and Tissue Research, vol. 311, no. 1, pp. 1–9, 2003. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
65. N. Purandare, R. C. Oude Voshaar, Y. Davidson et al., “Deletion/insertion polymorphism of the angiotensin-converting enzyme gene and white matter hyperintensities in dementia: a pilot study,” Journal of the American Geriatrics Society, vol. 54, no. 9, pp. 1395–1400, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
66. Z. Szolnoki, F. Somogyvari, A. Kondacs, M. Szabó, and L. Fodor, “Evaluation of the roles of common genetic mutations in leukoaraiosis,” Acta Neurologica Scandinavica, vol. 104, no. 5, pp. 281–287, 2001. View at Publisher · View at Google Scholar · View at Scopus
67. D. Bartres-Faz, C. Junque, I. C. Clemente et al., “MRI and genetic correlates of cognitive function in elders with memory impairment,” Neurobiology of Aging, vol. 22, no. 3, pp. 449–459, 2001. View at Publisher · View at Google Scholar · View at Scopus
68. K. Sleegers, T. den Heijer, E. J. van Dijk et al., “ACE gene is associated with Alzheimer's disease and atrophy of hippocampus and amygdala,” Neurobiology of Aging, vol. 26, no. 8, pp. 1153–1159, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
69. L. A. Farrer, T. Sherbatich, S. A. Keryanov et al., “Association between angiotensin-converting enzyme and Alzheimer disease,” Archives of Neurology, vol. 57, no. 2, pp. 210–214, 2000.
70. B. Palumbo, D. Cadini, G. Nocentini, E. Filipponi, M. L. Fravolini, and U. Senin, “Angiotensin converting enzyme deletion allele in different kinds of dementia disorders,” Neuroscience Letters, vol. 267, no. 2, pp. 97–100, 1999. View at Publisher · View at Google Scholar · View at Scopus
71. D. Erten-Lyons, A. Jacobson, P. Kramer, A. Grupe, and J. Kaye, “The FAS gene, brain volume, and disease progression in Alzheimer's disease,” Alzheimer's and Dementia, vol. 6, no. 2, pp. 118–124, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
72. J. H. Su, A. J. Anderson, D. H. Cribbs et al., “Fas and Fas Ligand are associated with neuritic degeneration in the AD brain and participate in β-amyloid-induced neuronal death,” Neurobiology of Disease, vol. 12, no. 3, pp. 182–193, 2003. View at Publisher · View at Google Scholar · View at Scopus
73. M. Kivipelto, E. L. Helkala, M. P. Laakso et al., “Apolipoprotein E ε4 allele, elevated midlife total cholesterol level, and high midlife systolic blood pressure are independent risk factors for late-life Alzheimer disease,” Annals of Internal Medicine, vol. 137, no. 3, pp. 149–155, 2002. View at Scopus
74. L. J. Launer, G. W. Ross, H. Petrovitch et al., “Midlife blood pressure and dementia: the Honolulu-Asia aging study,” Neurobiology of Aging, vol. 21, no. 1, pp. 49–55, 2000. View at Publisher · View at Google Scholar · View at Scopus
75. L. A. Profenno, A. P. Porsteinsson, and S. V. Faraone, “Meta-analysis of Alzheimer's disease risk with obesity, diabetes, and related disorders,” Biological Psychiatry, vol. 67, no. 6, pp. 505–512, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
76. A. J. Ho, J. L. Stein, X. Hua et al., “A commonly carried allele of the obesity-related FTO gene is associated with reduced brain volume in the healthy elderly,” Proceedings of the National Academy of Sciences of the United States of America, vol. 107, no. 18, pp. 8404–8409, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
77. T. M. Frayling, N. J. Timpson, M. N. Weedon et al., “A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity,” Science, vol. 316, no. 5826, pp. 889–894, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
78. C. A. Raji, A. J. Ho, N. N. Parikshak et al., “Brain structure and obesity,” Human Brain Mapping, vol. 31, no. 3, pp. 353–364, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
79. A. J. Ho, C. A. Raji, J. T. Becker et al., “Obesity is linked with lower brain volume in 700 AD and MCI patients,” Neurobiology of Aging, vol. 31, no. 8, pp. 1326–1339, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
80. A. J. Ho, C. A. Raji, J. T. Becker, et al., “The effects of physical activity, education, and body mass index on the aging brain,” Human Brain Mapping. In press.
81. J. L. Stein, X. Hua, J. H. Morra et al., “Genome-wide analysis reveals novel genes influencing temporal lobe structure with relevance to neurodegeneration in Alzheimer's disease,” NeuroImage, vol. 51, no. 2, pp. 542–554, 2010. View at Publisher · View at Google Scholar · View at PubMed
82. H. Braak and E. Braak, “Frequency of stages of Alzheimer-related lesions in different age categories,” Neurobiology of Aging, vol. 18, no. 4, pp. 351–357, 1997. View at Publisher · View at Google Scholar
83. A. J. Saykin, L. Shen, T. M. Foroud et al., “Alzheimer's Disease Neuroimaging Initiative biomarkers as quantitative phenotypes: genetics core aims, progress, and plans,” Alzheimer's and Dementia, vol. 6, no. 3, pp. 265–273, 2010. View at Publisher · View at Google Scholar · View at PubMed
84. I. I. Gottesman and T. D. Gould, “The endophenotype concept in psychiatry: etymology and strategic intentions,” American Journal of Psychiatry, vol. 160, no. 4, pp. 636–645, 2003. View at Publisher · View at Google Scholar
85. P. Vemuri, H. J. Wiste, S. D. Weigand et al., “Serial MRI and CSF biomarkers in normal aging, MCI, and AD,” Neurology, vol. 75, no. 2, pp. 143–151, 2010. View at Publisher · View at Google Scholar · View at PubMed
86. Y. Y. Chou, N. Lepore, P. Saharan et al., “Ventricular maps in 804 ADNI subjects: correlations with CSF biomarkers and clinical decline,” Neurobiology of Aging, vol. 31, no. 8, pp. 1386–1400, 2010. View at Publisher · View at Google Scholar · View at PubMed
87. S. Kovacevic, M. S. Rafii, and J. B. Brewer, “High-throughput, fully automated volumetry for prediction of MMSE and CDR decline in mild cognitive impairment,” Alzheimer Disease and Associated Disorders, vol. 23, no. 2, pp. 139–145, 2009. View at Publisher · View at Google Scholar · View at PubMed
88. A. S. Fleisher, S. Sun, C. Taylor et al., “Volumetric MRI vs clinical predictors of Alzheimer disease in mild cognitive impairment,” Neurology, vol. 70, no. 3, pp. 191–199, 2008. View at Publisher · View at Google Scholar · View at PubMed
89. S. L. Risacher, A. J. Saykin, J. D. West, L. Shen, H. A. Firpi, and B. C. McDonald, “Baseline MRI predictors of conversion from MCI to probable AD in the ADNI cohort,” Current Alzheimer Research, vol. 6, no. 4, pp. 347–361, 2009. View at Publisher · View at Google Scholar
90. S. Galluzzi, C. Geroldi, R. Ghidoni et al., “The new Alzheimer's criteria in a naturalistic series of patients with mild cognitive impairment,” Journal of Neurology, vol. 257, no. 12, pp. 2004–2014, 2010. View at Publisher · View at Google Scholar · View at PubMed
91. L. G. Apostolova, P. M. Thompson, A. E. Green et al., “3D comparison of low, intermediate, and advanced hippocampal atrophy in MCI,” Human Brain Mapping, vol. 31, no. 5, pp. 786–797, 2010. View at Publisher · View at Google Scholar · View at PubMed
92. X. Hua, A. D. Leow, N. Parikshak et al., “Tensor-based morphometry as a neuroimaging biomarker for Alzheimer's disease: an MRI study of 676 AD, MCI, and normal subjects,” NeuroImage, vol. 43, no. 3, pp. 458–469, 2008. View at Publisher · View at Google Scholar · View at PubMed
93. W. S. Kremen, M. S. Panizzon, M. C. Neale et al., “Heritability of brain ventricle volume: converging evidence from inconsistent results,” Neurobiology of Aging, 2010. View at Publisher · View at Google Scholar · View at PubMed
94. A. L. DeStefano, S. Seshadri, A. Beiser et al., “Bivariate heritability of total and regional brain volumes: the Framingham study,” Alzheimer Disease and Associated Disorders, vol. 23, no. 3, pp. 218–223, 2009. View at Publisher · View at Google Scholar · View at PubMed
95. K. L. Lunetta, P. M. Erlich, K. T. Cuenco et al., “Heritability of magnetic resonance imaging (MRI) traits in Alzheimer disease cases and their siblings in the MIRAGE study,” Alzheimer Disease and Associated Disorders, vol. 21, no. 2, pp. 85–91, 2007. View at Publisher · View at Google Scholar · View at PubMed
96. J. C. Morris, C. M. Roe, E. A. Grant et al., “Pittsburgh compound B imaging and prediction of progression from cognitive normality to symptomatic Alzheimer disease,” Archives of Neurology, vol. 66, no. 12, pp. 1469–1475, 2009. View at Publisher · View at Google Scholar · View at PubMed
97. E. Scola, M. Bozzali, F. Agosta et al., “A diffusion tensor MRI study of patients with MCI and AD with a 2-year clinical follow-up,” Journal of Neurology, Neurosurgery and Psychiatry, vol. 81, no. 7, pp. 798–805, 2010. View at Publisher · View at Google Scholar · View at PubMed
98. M. C. Chiang, M. Barysheva, D. W. Shattuck et al., “Genetics of brain fiber architecture and intellectual performance,” Journal of Neuroscience, vol. 29, no. 7, pp. 2212–2224, 2009. View at Publisher · View at Google Scholar · View at PubMed
99. A. L. Hinrichs, M. A. Mintun, D. Head et al., “Cortical binding of Pittsburgh compound B, an endophenotype for genetic studies of Alzheimer's disease,” Biological Psychiatry, vol. 67, no. 6, pp. 581–583, 2010. View at Publisher · View at Google Scholar · View at PubMed
100. S. M. Landau, D. Harvey, C. M. Madison et al., “Comparing predictors of conversion and decline in mild cognitive impairment,” Neurology, vol. 75, no. 3, pp. 230–238, 2010. View at Publisher · View at Google Scholar · View at PubMed
101. W. Jagust, A. Gitcho, F. Sun, B. Kuczynski, D. Mungas, and M. Haan, “Brain imaging evidence of preclinical Alzheimer's disease in normal aging,” Annals of Neurology, vol. 59, no. 4, pp. 673–681, 2006. View at Publisher · View at Google Scholar · View at PubMed
102. G. Chetelat, F. Eustache, F. Viader et al., “FDG-PET measurement is more accurate than neuropsychological assessments to predict global cognitive deterioration in patients with mild cognitive impairment,” Neurocase, vol. 11, no. 1, pp. 14–25, 2005. View at Publisher · View at Google Scholar · View at PubMed
103. L. L. Chao, S. T. Buckley, J. Kornak et al., “ASL perfusion MRI predicts cognitive decline and conversion from MCI to dementia,” Alzheimer Disease and Associated Disorders, vol. 24, no. 1, pp. 19–27, 2010. View at Publisher · View at Google Scholar · View at PubMed
104. L. Shen, S. Kim, S. L. Risacher et al., “Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: a study of the ADNI cohort,” NeuroImage, vol. 53, no. 3, pp. 1051–1063, 2010. View at Publisher · View at Google Scholar · View at PubMed
105. P. M. Thompson, K. M. Hayashi, G. De Zubicaray et al., “Dynamics of gray matter loss in Alzheimer's disease,” Journal of Neuroscience, vol. 23, no. 3, pp. 994–1005, 2003.
106. M. A. Carmona, K. K. Murai, L. Wang, A. J. Roberts, and E. B. Pasqualea, “Glial ephrin-A3 regulates hippocampal dendritic spine morphology and glutamate transport,” Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 30, pp. 12524–12529, 2009. View at Publisher · View at Google Scholar · View at PubMed
107. M. Missler, R. E. Hammer, and T. C. Sudhof, “Neurexophilin binding to α-neurexins. A single LNS domain functions as an independently folding ligand-binding unit,” Journal of Biological Chemistry, vol. 273, no. 52, pp. 34716–34723, 1998. View at Publisher · View at Google Scholar
108. S. G. Potkin, G. Guffanti, A. Lakatos et al., “Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer's Disease,” PLoS ONE, vol. 4, no. 8, Article ID e6501, 2009. View at Publisher · View at Google Scholar · View at PubMed
109. A. Martinez and E. Soriano, “Functions of ephrin/Eph interactions in the development of the nervous systemml: emphasis on the hippocampal system,” Brain Research Reviews, vol. 49, no. 2, pp. 211–226, 2005. View at Publisher · View at Google Scholar · View at PubMed
110. P. Kurup, Y. Zhang, J. Xu et al., “Aβ-mediated NMDA receptor endocytosis in Alzheimer's disease involves ubiquitination of the tyrosine phosphatase STEP61,” Journal of Neuroscience, vol. 30, no. 17, pp. 5948–5957, 2010. View at Publisher · View at Google Scholar
111. C. Balducci, R. Tonini, E. Zianni et al., “Cognitive deficits associated with alteration of synaptic metaplasticity precede plaque deposition in AβPP23 transgenic mice,” Journal of Alzheimer's Disease, vol. 21, no. 4, pp. 1367–1381, 2010. View at Publisher · View at Google Scholar · View at PubMed
112. P. Xia, H.-S. V. Chen, D. Zhang, and S. A. Lipton, “Memantine preferentially blocks extrasynaptic over synaptic NMDA receptor currents in hippocampal autapses,” Journal of Neuroscience, vol. 30, no. 33, pp. 11246–11250, 2010. View at Publisher · View at Google Scholar · View at PubMed
113. J. L. Stein, X. Hua, S. Lee et al., “Voxelwise genome-wide association study (vGWAS),” NeuroImage, vol. 53, no. 3, pp. 1160–1174, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
114. W. L. Lau and S. B. Scholnick, “Identification of two new members of the CSMD gene family small star, filled,” Genomics, vol. 82, pp. 412–415, 2003.
115. I. Brunk, C. Blex, D. Speidel, N. Brose, and G. Ahnert-Hilger, “Ca2+-dependent activator proteins of secretion promote vesicular monoamine uptake,” Journal of Biological Chemistry, vol. 284, no. 2, pp. 1050–1056, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
116. L. A. Beckett, D. J. Harvey, A. Gamst et al., “The Alzheimer's Disease Neuroimaging Initiative: annual change in biomarkers and clinical outcomes,” Alzheimer's and Dementia, vol. 6, no. 3, pp. 257–264, 2010. View at Publisher · View at Google Scholar · View at PubMed
117. X. Hua, S. Lee, I. Yanovsky et al., “Optimizing power to track brain degeneration in Alzheimer's disease and mild cognitive impairment with tensor-based morphometry: an ADNI study of 515 subjects,” NeuroImage, vol. 48, no. 4, pp. 668–681, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
118. K. Chen, J. B. S. Langbaum, A. S. Fleisher et al., “Twelve-month metabolic declines in probable Alzheimer's disease and amnestic mild cognitive impairment assessed using an empirically pre-defined statistical region-of-interest: findings from the Alzheimer's Disease Neuroimaging Initiative,” NeuroImage, vol. 51, no. 2, pp. 654–664, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
119. M.-C. Chiang, M. Barysheva, A. W. Toga et al., “BDNF gene effects on brain circuitry replicated in 455 twins,” NeuroImage, vol. 55, no. 2, pp. 448–454, 2011. View at Publisher · View at Google Scholar · View at PubMed
120. X. Wu, K. Chen, L. Yao et al., “Assessing the reliability to detect cerebral hypometabolism in probable Alzheimer's disease and amnestic mild cognitive impairment,” Journal of Neuroscience Methods, vol. 192, no. 2, pp. 277–285, 2010. View at Publisher · View at Google Scholar · View at PubMed
121. F. Dudbridge and A. Gusnanto, “Estimation of significance thresholds for genomewide association scans,” Genetic Epidemiology, vol. 32, no. 3, pp. 227–234, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
122. P. M. Thompson, N. G. Martin, and M. J. Wright, “Imaging genomics,” Current Opinion in Neurology, vol. 23, no. 4, pp. 368–373, 2010. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
123. J. L. Stein, D. P. Hibar, S. K. Madsen, et al., “Discovery and replication of dopamine-related gene effects on caudate volume in young and elderly populations (N=1198) using genome-wide search,” In press.
124. S. Seshadri, A. L. de Stefano, R. Au et al., “Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham study,” BMC Medical Genetics, vol. 8, article S15, supplement 1, 2007. View at Publisher · View at Google Scholar · View at PubMed
125. D. P. Hibar, J. L. Stein, N. Jahanshad, et al., “Voxelwise genome-wide association of Diffusion Tensor Images identifies putative novel variants influencing white matter integrity in 467 related young adults,” San Diego, Calif, USA, 2010.
126. D. P. Hibar, J. L. Stein, O. Kohannim, et al., “Voxelwise gene-wide association study (vGeneWAS): multivariate gene-based association testing in 731 elderly subjects,” Technical report, UCLA, http://www.loni.ucla.edu/~thompson/vGeneWAS/, 2010.
127. O. Kohannim, X. Hua, and D. P. Hibar, “Boosting power for clinical trials using classifiers based on multiple biomarkers,” Neurobiology of Aging, vol. 31, pp. 1429–1442, 2010.
128. The ENIGMA Consortium, Genome-wide association meta-analyses of hippocampal volume: results from the ENIGMA Consortium, Quebec City, 2011.
129. N. R. Wray and P. M. Visscher, “Narrowing the boundaries of the genetic architecture of schizophrenia,” Schizophrenia Bulletin, vol. 36, no. 1, pp. 14–23, 2010. View at Publisher · View at Google Scholar · View at PubMed
130. M. C. Chiang, K. L. McMahon, G. I. de Zubicaray, et al., “Environmental factors surpass genetic influences in determining fiber microstructure as the brain develops: a diffusion tensor imaging study of 705 twins,” San Diego, Calif, USA, 2010.
131. Z. Szolnoki, F. Somogyvari, A. Kondacs et al., “Specific APO E genotypes in combination with the ACE D/D or MTHFR 677TT mutation yield an independent genetic risk of leukoaraiosis,” Acta Neurologica Scandinavica, vol. 109, no. 3, pp. 222–227, 2004. View at Publisher · View at Google Scholar · View at Scopus
132. J. P. A. Ioannidis, P. Boffetta, J. Little et al., “Assessment of cumulative evidence on genetic associations: interim guidelines,” International Journal of Epidemiology, vol. 37, no. 1, pp. 120–132, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
133. W. James Kent, C. W. Sugnet, T. S. Furey et al., “The human genome browser at UCSC,” Genome Research, vol. 12, no. 6, pp. 996–1006, 2002. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:36:35.000Z
|
3ip6lskgpjwg4kniszv7rkac2qqizcpb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19235",
"uncompressed_offset": 517093919,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?124811"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Introduction (Galactic Empires Volume Two)
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Introduction (Galactic Empires Volume Two)
Author: Brian W. Aldiss
Year: 1976
Type: ESSAY
ISFDB Record Number: 124811
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:19:50.000Z
|
lp4tdf7gr7f72lpyxzzlovbovpnxkkfr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19240",
"uncompressed_offset": 553147776,
"url": "www.lgam.info/rss",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.lgam.info/rss"
}
|
cccc_CC-MAIN-2013-20
|
RSS
RSS or "Really Simple Syndication" is a family of web feed formats used to publish frequently updated works—such as blog entries, news headlines, audio, and video—in a standardized format. An RSS document (which is called a "feed", "web feed", or "channel") includes full or summarized text, plus metadata such as publishing dates and authorship.
Many Councils are now publishing news via RSS feeds.
To add an RSS feed to the site use the "Feed Module", e.g.
[[module Feed src="http://bundaberg.qld.gov.au/news/rss" limit="1"]][[/module]]
This site publishes its own RSS feeds, and uses third party feeds on a number of pages.
The easiest way to view an RSS Feed is by using and RSS Reader.
RSS Readers
LGAM RSS Feeds
Third Party RSS Feeds
External Links & References
1. Wikipedia
Page tags: it
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:07:17.000Z
|
zpjwydkxjiguuf2o6el2qtbhb7emqlyb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19242",
"uncompressed_offset": 553729646,
"url": "www.libreoffice.org/download/?lang=ne&type=mac-x86&version=4.0.1",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.libreoffice.org/download/?type=mac-x86&lang=ne&version=4.0.1"
}
|
cccc_CC-MAIN-2013-20
|
The free office suite
Download LibreOffice
LibreOffice Mac OS X (Intel), version 4.0.1, Nepali. Not the version you wanted? Change System, Version or Language
This version of LibreOffice is prepared with care and presented with pride by the LibreOffice community. PLEASE NOTE that, since this is the very second version in the series, make sure to read the release notes (under "Handy resources").
You need to download and install these files in order:
• Source code
LibreOffice is an open source project and you can therefore download the source code to build your own installer.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:19:29.000Z
|
kjrpqltjqsw7bdmw3ukqxyjdbdi4h654
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19244",
"uncompressed_offset": 569042947,
"url": "www.mariowiki.com/Topmini",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.mariowiki.com/Topmini"
}
|
cccc_CC-MAIN-2013-20
|
Topmini
From the Super Mario Wiki
Jump to: navigation, search
Topmini
Species Origin Topman
First Appearance Super Mario Galaxy (2007)
Latest Appearance Super Mario Galaxy 2 (2010)
Topminis are the smallest members of the Topman Tribe, appearing only in Super Mario Galaxy and its sequel as enemies.
Contents
[edit] History
[edit] Super Mario Galaxy
Topminis first appeared in Super Mario Galaxy where they were enemies in several levels where Topmen appeared (mostly in the Battlerock Galaxy and the Dreadnought Galaxy). They were typically found in groups of two to three Topminis and they tried to spin into Mario which would simply push him backwards. This move, though incapable of damaging Mario directly, can push him into some sort of hazard which will damage him.
Topminis can only be defeated by a spin which will cause them to explode into one Star Bit that Mario can collect. However, they could also be destroyed by shooting a Star Bit at them, which would give three Star Bits instead of just one. In many areas after the Topminis are defeated, a hole will appear and more of the enemies will emerge from it.
In the Buoy Base Galaxy only, Topminis can be released from a special Sentry Beam that will attempt to knock Mario into something dangerous.
[edit] Super Mario Galaxy 2
They appear in Super Mario Galaxy 2 in the Space Storm Galaxy. They behaved just as in the previous game.
[edit] Names in Other Languages
Language Name Meaning
Italian Robobaby From the Topmen's italian name, "Robopunta", with "baby".
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:02:48.000Z
|
xnc6lyd4qnpmuhrg32nfcqngjkji3nhe
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19248",
"uncompressed_offset": 574261563,
"url": "www.mdpi.com/1422-0067/13/6/6679",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.mdpi.com/1422-0067/13/6/6679"
}
|
cccc_CC-MAIN-2013-20
|
Int. J. Mol. Sci. 2012, 13(6), 6679-6697; doi:10.3390/ijms13066679
Review
Intravascular Targets for Molecular Contrast-Enhanced Ultrasound Imaging
1 MI Lab, Department of Circulation and Medical Imaging, Norwegian University of Science and Technology (NTNU), Trondheim N-7006, Norway 2 Department of Medical Technology, SINTEF Technology and Society, Trondheim N-7491, Norway
* Author to whom correspondence should be addressed.
Received: 19 April 2012; in revised form: 21 May 2012 / Accepted: 22 May 2012 / Published: 1 June 2012
(This article belongs to the Special Issue Advances in Molecular Oncology)
Download PDF Full-Text [1754 KB, uploaded 1 June 2012 11:50 CEST]
Abstract: Molecular targeting of contrast agents for ultrasound imaging is emerging as a new medical imaging modality. It combines advances in ultrasound technology with principles of molecular imaging, thereby allowing non-invasive assessment of biological processes in vivo. Preclinical studies have shown that microbubbles, which provide contrast during ultrasound imaging, can be targeted to specific molecular markers. These microbubbles accumulate in tissue with target (over) expression, thereby significantly increasing the ultrasound signal. This concept offers safe and low-cost imaging with high spatial resolution and sensitivity. It is therefore considered to have great potential in cancer imaging, and early-phase clinical trials are ongoing. In this review, we summarize the current literature on targets that have been successfully imaged in preclinical models using molecularly targeted ultrasound contrast agents. Based on preclinical experience, we discuss the potential clinical utility of targeted microbubbles.
Keywords: ultrasound imaging; targeted contrast agents; angiogenesis; molecular imaging; microbubbles; cancer
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Moestue, S.A.; Gribbestad, I.S.; Hansen, R. Intravascular Targets for Molecular Contrast-Enhanced Ultrasound Imaging. Int. J. Mol. Sci. 2012, 13, 6679-6697.
AMA Style
Moestue SA, Gribbestad IS, Hansen R. Intravascular Targets for Molecular Contrast-Enhanced Ultrasound Imaging. International Journal of Molecular Sciences. 2012; 13(6):6679-6697.
Chicago/Turabian Style
Moestue, Siver A.; Gribbestad, Ingrid S.; Hansen, Rune. 2012. "Intravascular Targets for Molecular Contrast-Enhanced Ultrasound Imaging." Int. J. Mol. Sci. 13, no. 6: 6679-6697.
Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:14:26.000Z
|
pn5ldmetyrteoxby64p65qraxiubb6sb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19249",
"uncompressed_offset": 574270638,
"url": "www.mdpi.com/1660-4601/9/10/3575",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.mdpi.com/1660-4601/9/10/3575"
}
|
cccc_CC-MAIN-2013-20
|
Int. J. Environ. Res. Public Health 2012, 9(10), 3575-3587; doi:10.3390/ijerph9103575
Article
Fruits and Vegetables Consumption and Associated Factors among In-School Adolescents in Five Southeast Asian Countries
Karl Peltzer 1,2,* and Supa Pengpid 3
1 HIV/STI and TB (HAST) Research Programme, Human Sciences Research Council, 134 Pretorius Street, Pretoria 0002, South Africa 2 Department of Psychology, University of Limpopo, Turfloof Campus, Sovenga, Limpopo 0727, South Africa 3 Department of Health System Management and Policy, University of Limpopo, Ga-Rankuwa Campus, Medunsa, Pretoria, 0204, South Africa
* Author to whom correspondence should be addressed.
Received: 16 July 2012; in revised form: 17 September 2012 / Accepted: 8 October 2012 / Published: 11 October 2012
(This article belongs to the Special Issue Health Behavior and Public Health)
Download PDF Full-Text [172 KB, uploaded 11 October 2012 13:57 CEST]
Abstract: The aim of the study was to assess the prevalence of fruits and vegetable consumption and associated factors among Southeast Asian in-school adolescents. Data were collected by self-report questionnaire from nationally representative samples (total 16,084) of school children aged 13 to 15 years in five Southeast Asian countries. Overall, 76.3% of the 13 to 15 year-olds had inadequate fruits and vegetables consumptions (less than five servings per day); 28% reported consuming fruits less than once per day and 13.8% indicated consuming vegetables less than once per day. In multivariable analysis, lack of protective factors and being physically inactive were associated with inadequate fruits and vegetable consumption, and sedentary behaviour and being overweight was protective of inadequate fruits and vegetable consumption. The results stress the need for intervention programmes aimed at increased consumption of fruits and vegetables, targeting proximal factors such as the family environment and distal factors by aiming at integrating other risk factors such as physical activity into health promotion among adolescents.
Keywords: fruits; vegetables; adolescents; psychosocial correlates; health-compromising behaviours; Southeast Asian countries
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Peltzer, K.; Pengpid, S. Fruits and Vegetables Consumption and Associated Factors among In-School Adolescents in Five Southeast Asian Countries. Int. J. Environ. Res. Public Health 2012, 9, 3575-3587.
AMA Style
Peltzer K, Pengpid S. Fruits and Vegetables Consumption and Associated Factors among In-School Adolescents in Five Southeast Asian Countries. International Journal of Environmental Research and Public Health. 2012; 9(10):3575-3587.
Chicago/Turabian Style
Peltzer, Karl; Pengpid, Supa. 2012. "Fruits and Vegetables Consumption and Associated Factors among In-School Adolescents in Five Southeast Asian Countries." Int. J. Environ. Res. Public Health 9, no. 10: 3575-3587.
Int. J. Environ. Res. Public Health EISSN 1660-4601 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:21:40.000Z
|
ke3gsb36whu6igsn55qpvglaa65dctu5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19267",
"uncompressed_offset": 626513645,
"url": "www.panarmenian.net/eng/news/116859/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.panarmenian.net/eng/news/116859/"
}
|
cccc_CC-MAIN-2013-20
|
“Man of Steel” Supermen flick teaser trailers released (video)
PanARMENIAN.Net - Teaser trailers for Superman reboot Man of Steel have been released.
Directed by Zack Snyder, the fantasy film stars Henry Cavill as Superman, Russell Crowe as Superman's father Jor-El from his home planet Krypton, Amy Adams as love interest, Lois Lane and Michael Shannon as villain General Zod.
Kevin Costner and Diane Lane play earth-bound Clark Kent's adoptive parents Jonathan and Martha Kent.
Man of Steel is produced by The Dark Knight Rises director Christopher Nolan, who also co-wrote the screenplay.
Man of Steel is set for release on June 14, 2013, Channel 24 said.
Partner news
Top stories
The jewels were to be loaned to celebrities who have arrived on the French Riviera town for its famous annual film festival.
The list of the finalists also includes Hungary, Azerbaijan, Georgia, Romania, Norway, Iceland, Finland and others.
Set in the gritty blue-collar neighborhood of God’s Pocket, story follows a man stuck with a debt he can't pay.
"Catching Fire" follows Katniss and fellow Hunger Games victor Peeta as they embark on a "Victor's Tour" throughout 12 districts of Panem.
Partner news
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:27:06.000Z
|
rcipnm7uc53xeipasxkzzknej6jjxnpl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19268",
"uncompressed_offset": 626524233,
"url": "www.panarmenian.net/eng/news/124959/",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.panarmenian.net/eng/news/124959/"
}
|
cccc_CC-MAIN-2013-20
|
U.S. judge orders man behind of anti-Islam film jailed
PanARMENIAN.Net - A U.S. judge ordered the alleged filmmaker behind a video that sparked protests across Muslim countries detained without bond Thursday, Sept 27, saying there was a risk he would try to flee, AFP reports.
Nakoula Basseley Nakoula, the alleged director/producer of "Innocence of Muslims," appeared in court after being arrested for breaching the terms of his probation for a 2010 banking fraud conviction.
Prosecutor Robert Dugdale said the 55-year-old had allegedly made eight breaches, including making false statements to probation officers and using at least three different names.
Judge Suzanne Segal ruled that Nakoula, who has been hiding since protests erupted over his film, be detained without bond, saying he was a flight risk and a danger to the community.
"The court has a lack of trust in this defendant," she said.
Concerns have been raised for Nakoula's safety due to the widespread anger his alleged video has provoked among Muslims, and his hastily-arranged court appearance was held under tight security in downtown LA.
The hearing was closed to the public, but journalists and anyone else interested was allowed to follow proceedings via videoconference from a separate building.
Nakoula - allegedly the real identity behind the pseudonym Sam Bacile, listed as the director of "Innocence of Muslims" - was briefly taken into custody earlier this month for questioning by his probation officer.
He was traced to a home address in Cerritos, south of Los Angeles, after international protests erupted against the 14-minute trailer video posted online.
The film depicting the Prophet Mohammed as a thuggish deviant offended many Muslims, and sparked a wave of anti-American protests that have cost several lives and saw mobs set US missions, schools and businesses ablaze.
Partner news
Top stories
Jorge Rafael Videla, an austere former army commander, led Argentina during the bloodiest days of its Dirty War dictatorship.
According to the United Nations, April was Iraq's bloodiest month for almost five years, with 712 people killed.
Reports suggest the rebel fighters may have tried to blow up the walls of the prison, which holds some 4,000 inmates.
Moscow has condemned other nations for supporting rebel forces and failing to condemn what it describes as terrorist attacks on the Syrian regime.
Partner news
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:08:39.000Z
|
upixsguebpl6d277m2n2l47xpfll6vye
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19279",
"uncompressed_offset": 678754027,
"url": "www.seroundtable.com/christmas-2011-logos-14502.html",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.seroundtable.com/christmas-2011-logos-14502.html"
}
|
cccc_CC-MAIN-2013-20
|
2011 Christmas Logos From Search Industry
Dec 24, 2011 • 9:30 pm | (7) by | Filed Under Logos
It is Christmas Eve and the search engines have their logos up already for the very special holiday. We posted on the interesting Google Holiday/Christmas logo yesterday and now I wanted to document all the logos from the whole search industry.
Google (static):
Google (video):
Yahoo (flash):
Bing:
Ask.com:
Dogpile:
Baidu:
Sogou:
Cre8asite :
BruceClay:
Search Engine Roundtable:
Christmas Logos From The Archives:
Let's look back at the old Christmas logos from our industry starting with 2010, then 2009, 2008, the 2007 logos, plus Google's five logos, 2006 logos, Cre8asite in 2005, also '05 Search Engine Roundtable and '05 Google, Yahoo and Ask, plus we have 2004 and some of 2003 archived for you.
Forum discussion at Google Webmaster Help.
Previous story: Daily Search Forum Recap: December 23, 2011
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:21:20.000Z
|
tvwej4th5s3uucksgyv7g7nu5j4sqatg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19280",
"uncompressed_offset": 678763368,
"url": "www.seroundtable.com/recap-11-02-2011-14243.html",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.seroundtable.com/recap-11-02-2011-14243.html"
}
|
cccc_CC-MAIN-2013-20
|
Daily Search Forum Recap: November 2, 2011
Nov 2, 2011 • 4:00 pm | (0) by | Filed Under Search Forum Recap
Here is a recap of what happened in the search forums today, through the eyes of the Search Engine Roundtable and other search forums on the web.
Search Engine Roundtable Stories:
• Two New Google Google Webmaster Hangouts
Google is hosting two new Google Webmaster Hangouts in the next two days. The first is at Wednesday, 2 November 2011 at 4pm eastern/1pm pacific...
• Google: Experts Exchange A Top Blocked Site In Google
I am not a fan of Experts Exchange, I've called it one of the most annoying sites found in Google. Well, with the Panda update it is no longer found that often in Google...
• Google's Matt Cutts Definitive Cloaking Video
Google's Matt Cutts recently did an almost 9 minute video on the topic of cloaking...
• Google Indexing AJAX Content Via POST Requests: Facebook & Disqus
Recently, people started noticing Google being able to index Facebook comments without problem. The hard part is that those comments are rendered in AJAX and only visible via POST requests. GoogleBot, Google's spider, was not able to index that type of content on the web before. Now, Google announced they have "started experiments to rewrite POST requests to GET."
• Bing Energy Drinks For Sale
Yesterday there was Chrome Beer and today we have Bing Energy Drinks. @anthonydnelson shared this photo with me on Twitter. Best part, they only cost $1.99! They do look a bit tastier than Chrome.
• Google Vince 2.0 = Google Panda 2.5.x?
One of the senior members at WebmasterWorld started a thread suggesting that the last group of Google Panda updates were more "Vince" update like than Panda update like. Vince was an update that seemed to push big brands to the front of the results...
• Google AdSense Reports For Ad Network Performance
Google added a new report that breaks down your earnings on Google's certified ad network through DoubleClick Ad Exchange. In March 2010, Google launched the Google certified ad network and it concerned many publishers...
• Google To Bill Developers For Maps API
Not totally unexpected, Google announced they will soon be charging Maps API developers for usage of the Google Maps API. Google said now that it is October, six months after they updated their terms of service, they will start enforcing the new pricing options for the API...
• SEO Stars Vs. SEO Celebrities
Rob Kerry has a wonderful post named Celebrities Killed The SEO Star. In short, Rob said, "I believe that celebrity SEOs, brands and blogs are feeding a generation of untested and poorly trained search marketers, who pass themselves off as SEO experts...
• Chrome Beer
Google Chrome is a very famous browser, but there is also a beer named Chrome by Carling. Clive Darr shared this picture of his pack of Chrome beer on Flickr.
Other Great Search Forum Threads:
Previous story: Two New Google Google Webmaster Hangouts
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:20:05.000Z
|
vuzrkmj4y44qrsoycziwzrblobfvb46r
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19282",
"uncompressed_offset": 694544359,
"url": "www.sourcewatch.org/index.php/Special:RecentChangesLinked/National_Rifle_Association",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.sourcewatch.org/index.php/Special:RecentChangesLinked/National_Rifle_Association"
}
|
cccc_CC-MAIN-2013-20
|
CMD sent two reporters to track ALEC in Oklahoma
Click here to help support our future investigations.
Changes related to "National Rifle Association"
Jump to: navigation, search
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 03:20, 18 May 2013
Page name:
14 May 2013
Personal tools
Namespaces
Variants
Views
Actions
Navigation
How To
Other Info
Other Policies
Google AdSense
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:03:25.000Z
|
wh7xbi5jzo6aanlmutqns74t3wwq2ums
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19292",
"uncompressed_offset": 777724739,
"url": "www.werelate.org/wiki/Place:Czech_Republic",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.werelate.org/wiki/Place:Czech_Republic"
}
|
cccc_CC-MAIN-2013-20
|
Place:Czech Republic
NameCzech Republic
Alt namesCzech Socialist Republicsource: Encyclopedia Britannica (1988) XVI, 905 ff., & III, 836-837
Czechiasource: King, Czech & Slovak Republics (1995) p 10
República Checasource: Britannica Book of the Year (1993) p 48
République tchèquesource: Britannica Book of the Year (1993) p 48
Česká Republikasource: Getty Vocabulary Program
Česká republikasource: Wikipedia
Česká Socialistická Republikasource: Rand McNally Atlas (1994) I-64
České Zemésource: Times Atlas of the World (1992) plate 62
TypeNation
Coordinates49.75°N 15°E
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
The Czech Republic ( ; , , short form Česko ), is a landlocked country in Central Europe. The country is bordered by Germany to the west, Austria to the south, Slovakia to the east and Poland to the north. Its capital and largest city, with 1.3 million inhabitants, is Prague. The Czech Republic includes the historical territories of Bohemia and Moravia and a small part of Silesia.
The Czech state, formerly known as Bohemia, was formed in the late 9th century as a small duchy around Prague, at that time under the dominance of the powerful Great Moravian Empire. After the fall of the Empire in 907, the centre of power was transferred from Moravia to Bohemia, under the Přemyslids. Since 1002 it was formally recognized as part of Holy Roman Empire. In 1212 the duchy was raised to a kingdom and during the rule of Přemyslid dukes/kings and their successors, the Luxembourgs, the country reached its greatest territorial extent (13th–14th century). During the Hussite wars the kingdom faced economic embargoes and crusades from all over Europe. Following the Battle of Mohács in 1526, the Kingdom of Bohemia was gradually integrated into the Habsburg monarchy as one of its three principal parts, alongside the Archduchy of Austria and the Kingdom of Hungary. The Bohemian Revolt (1618–20) lost in the Battle of White Mountain, led to the further centralization of the monarchy including forced recatholization and Germanization. With the dissolution of the Holy Roman Empire in 1806, the Bohemian kingdom became part of the Austrian Empire. In the 19th century the Czech lands became the industrial powerhouse of the monarchy and the core of the Republic of Czechoslovakia which was formed in 1918, following the collapse of the Austro-Hungarian Empire after World War I. After 1933, Czechoslovakia remained the only democracy in central and eastern Europe.
After the Munich Agreement, Polish annexation of Zaolzie and German occupation of Czechoslovakia and the consequent disillusion with the Western response and gratitude for the liberation of the major portion of Czechoslovakia by the Red Army, the Communist Party of Czechoslovakia won the majority in the 1946 elections. In the 1948 coup d'état, Czechoslovakia became a communist-ruled state. In 1968, the increasing dissatisfaction culminated in attempts to reform the communist regime. The events, known as the Prague Spring of 1968, ended with an invasion by the armies of the Warsaw Pact countries (with the exception of Romania); the troops remained in the country until the 1989 Velvet Revolution, when the communist regime collapsed. On 1 January 1993, Czechoslovakia peacefully dissolved into its constituent states, the Czech Republic and the Slovak Republic.
The Czech Republic is the first former member of the Comecon to achieve the status of a developed country according to the World Bank. In addition, the country has the highest human development in Central and Eastern Europe, ranking as a "Very High Human Development" nation. It is also ranked as the third most peaceful country in Europe and most democratic and healthy (by infant mortality) country in the region. It is a pluralist multi-party parliamentary representative democracy, a member of the European Union, NATO, the OECD, the OSCE, the Council of Europe and the Visegrád Group.
Contents
How places in the Czech Republic are organized
The Czech Republic was formed in 1993 following the split of Czechoslovakia. It is divided into regions. The standard at WeRelate is to title Czech place pages according to their pre-split region when it is known, with also-located-in links to the post-split region.
All places in the Czech Republic
Further information on historical place organization in the Czech Republic
Research Tips
This page uses content from the English Wikipedia. The original content was at Czech Republic. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:34:23.000Z
|
oomz4hs2opyuplolojtwygrzcn4k2suz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19293",
"uncompressed_offset": 777759082,
"url": "www.werelate.org/wiki/Pre-Settlement_Exploration",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.werelate.org/wiki/Pre-Settlement_Exploration"
}
|
cccc_CC-MAIN-2013-20
|
Pre-Settlement Exploration
Watchers
Share
Southwest Virginia Project
Return to Southwest Virginia Project Main Page
Index to Articles
An Overview
Summers Summary
Early Exploration Routes
Abraham Wood, 1654
Batts and Fallam 1671
Knights of the Golden Horseshoe, 1716
William Byrd 1736
Dr. Thomas Walker 1749-1750
Gist's Journal, 1750-1751
__________________________
From Source:Summers, 1903:34 et seq. Some reformating has been performed to improve readability (e.g., elimination of one and two sentence paragraphs by compaction when appropriate, insertion of headers, insertion of inline references and notes; square brackets surround modern notes) .
First Exploration, 1641
From the time of the first settlement at Jamestown in 1607, the English Colony had grown rapidly and had expanded until their western borders were in view of the Blue Ridge. With the usual vigor and enterprise of the Anglo-Saxon, ,[1]we find, in the year 1641, a number of the citizens of Virginia petitioning the House of Burgesses for permission 'to undertake the discovery of a new river of land west and southerly from the Appomattox, and, in March, 1642, we find the House of Burgesses passing an act granting such permission. The act is as follows:
Forasmuch as Walker Austin, Rice Hoe, Joseph Johnson and Walter Chiles, for themselves and such others as they shall think fitt to joyn with them, did petition in the Assembly in June 1641 for leave and encouragement to undertake the discovery of a new river of unknowne land bearing west southerly from Appomattake river, Be it enacted and confirmed, that they and every one of them and whom they shall admit shall enjoy and possess to them, their heirs, executors, administrators or assigns all profit whatsoever they in their particular adventure can make unto themselves by such discovery aforesaid, for fourteen years after the date of the said month of January, 1641, provided there be reserved and paid into his Majesty's use by them that shall be appointed to receive them, the fifth part of Royal Mines whatsoever; provided also, that if they shall think fit to employ more than two or three men in the said discovery they shall then do it by commission from the Governor of the Councill. (1 Hen. Stat., p. 262).
It is well to preserve this the earliest known evidence of the desire of any man to hunt out the very country we now occupy. The names of a portion of these first daring spirits, Austin, Johnson and Chiles, afterwards became familiar to our own country, and while no evidence is at hand to establish the fact, yet it is more than probable that these men by their efforts made possible the future success of Walker, Draper, Inglis, Wood, and others.
Second Exploration, 1653
The record of the next effort to reach this portion of the wilderness by the enterprising citizens of Eastern Virginia is to be found in an act of the House of Burgesses of Virginia passed in July, 1653, more than a hundred years before a permanent settlement was effected on the waters of the Clinch or Holston rivers. The Act is as follows. Passed July, 1653:
Whereas, an act was made in the Assembly, 1642, for encouragement of discoveries to the westward and southward of this country, granting them all profits arising thereby for fourteen years, which act is since discontinued and made void, it is by this Assembly ordered that Colonel William Clayborne, Esq., and Captain Henry Fleet, they and their associates with them, either jointly or severally, may discover, and shall enjoy such benefits, profits and trades for fourteen years us they shall find out in places where no English ever have been and discovered, nor have had particular trade, and to take up such lands by patents proving their rights as they shall think good: nevertheless, not excluding others after their choice from taking up land and planting in these new discovered places, as in Virginia now versed. The like order is granted to Major Abram Wood and his associates."
The three gentlemen, William Clayborne, Henry Fleet and Abraham Wood, mentioned in this act, each represented a shire in the Virginia House of Burgesses, and were intent, no doubt, upon the acquisition of wealth and the development of the country. We have no information that leads us to believe that any of the persons named in the preceding act, with the exception of Colonel Abraham Wood, at any time made an effort to accomplish the purpose of that act. Dr. Hale, in his book entitled "Trans-Alleghany Pioneers," makes the following statement:
The New river was first discovered and named in 1654 by Colonel Abraham Wood, who dwelt at the falls of the Appomattox, now the site of Petersburg, Va. Being of an adventurous and speculative turn, he got from the Governor of Virginia a concession to explore the country and open up trade with the Indians to the west. There is no record as to the particular route he took, but as the line of adventure, exploration and discovery was then all east of the mountains, it is probable that he first struck the river not far from the Blue Ridge and near the present Virginia and North Carolina lines."
I do not know from what source Dr. Hale obtained this information, and I give it for what it is worth.
It is reasonable to believe that Colonel Wood made this trip, and, to support this view, three circumstances may be mentioned. First. The House of Burgesses of Virginia had authorized Colonel Wood, along with others, in July of the preceding year, to discover a new river of unknown land where no English had ever been or discovered. Secondly. A gap in the Blue Ridge, lying between the headwaters of Smith river, a branch of the Dan, in Patrick county, and of Little river, a branch of New river, in Floyd county, is to this day called Wood's Gap. Thirdly. The present New river was known at first as Wood's river. It is known that at the time Thomas Batts and a company of men acting under the authority of Colonel Wood visited this section in the year 1671, Wood's Gap and New river had been previously visited and named by Colonel Wood.
Batts, Wood, and Fallen, 1671
In the year 1671, Thomas Batts and several other persons traveled from the falls of the Appomattox, the present site of Petersburg, Va., acting under a commission from Governor Berkley, to explore the country west of the Blue Ridge mountains and the South Sea. It is worthy of notice that at the time this expedition was undertaken it was believed that the waters flowing westward beyond the Appalachian mountains emptied into the South Sea. This was the first effort made to explore the country west of the Blue Ridge, of which any record has been preserved. A journal of this expedition was made by Thomas Batts, one of the company. The first entry in this journal is as follows:
A commission being granted the Hon. Maj. Gen. Wood for ye finding out of the ebbing and flowing of ye waters behind the mountains in order to the discovery of the South Sea: Thomas Batts, Thomas Wood, Robert Fallen, accompanied by Perachute, a great man of the Appomattox Indians, and Jack Nesan, formerly servant to Majr. Genl. Wood, with five horses, set forward from Appomattox town in Va., and about eight of the clock in the morning being Fryday Septr. 1st. 1671, and traveling about forty miles, took up their quarters and found they had traveled from Okenechee path due west: They traveled for twenty-five days, a part of the time through that portion of Virginia, near the present line between this State and North Carolina, but when they reached the foot of the Alleghany Mountains where the same merges into the Blue Ridge, now in Floyd Co. Va., they turned to the north west at a low place in the said mountain known as Wood's Gap; and after some time they came to a river which Genl. Wood had named Wood's River.[2] This river for many years thereafter was known as Wood's River, and many of the early patents in that section of the country describe the lands as located upon Wood's River." The entry in this diary of date the 16th of Sept. says: "About ten of the clock we set forward and, after we had traveled about ten miles, one of the Indians killed a deer; presently after they had a sight of a curious river like the Thames agt. Chilcey (Chelsea), which having a fall yt made a great noise, whose course was N. and so as they supposed, ran W. about certain pleasant mountains which they saw to the westward. At this point they took up their quarters, their course having been W. by N. At this point they found Indian fields with cornstalks in them. They marked the trees with the initials of the company, using branding irons, and made proclamation in these words: 'Long live King Charles ye 2nd. king of England, France, Scotland, Ireland and Virginia and all the terrytories thereunto belonging, defender of the faith.
When they came to ye river-side they found it better and broader than they expected, fully as broad as the Thames over agt, Maping, ye falls much like the falls of the James River in Va., and imagined by the water marks it flowed there about three feet. It was then ebbing water. They set up a stick by the water, but found it ebbed very slowly."
At this point their Indian guides stopped, and refused to go any farther, saying that there dwelt near this place a numerous and powerful tribe of Indians that made salt and sold it to the other tribes, and that no one who entered into their towns had ever been able to escape. Thereupon the trip was abandoned and they started on their return to their homes without having accomplished the object of the exploration, to-wit: the finding of the South Sea. But the journal adds that when they were on the top of the hill they took a prospect as far as they could see and saw westwardly over certain delightful hills a fog arise, and a glimmering light as from water, and supposed they might be from some great bog.
Many writers suppose that this exploring party, after reaching the New river, descended the same to the falls of the Kanawha, but it is more than probable that after they reached the river they ascended the same, and the stopping point mentioned in the diary was in Southwest Virginia, and near where the New river first enters Virginia. Upon the return of this company to their homes Governor Berkley was very much interested in their report, but strange as it may seem to the reader, no further attempts were made by authority of the Government of Virginia for forty years to explore the country west of the mountains. It will be seen from the journal of Thomas Batts that he and his associates, and, beyond a doubt, Colonel Abraham Wood anticipated, by more than half a century, Governor Spotswood and his Knights of the Golden Horse-Shoe, in the exploration and discovery of the country west of the Blue Ridge mountains.
Knights of the Golden Horseshoe, 1716
The next effort made to explore the region west of the mountains, of which we have any account, occurred in 1716, forty-five years after the journey made by Thomas Batts, above described, and sixty years subsequent to the visit of Colonel Abraham Wood. In the month of August, 1716, Governor Alexander Spotswood, with several members of his staff, left Williamsburg by coach and proceeded to Germania, where he left his coach and proceeded on horseback. At Germania this party was supplemented by a number of gentlemen, their retainers, a company of rangers, and four Meherrin Indians—about fifty persons in all. They journeyed by way of the upper Rappahannock, and on the thirty-sixth day out, being September 5, 1716, they scaled the Blue Ridge at Swift Run Gap, now in Augusta county.
John Fontaine, a member of this company, has left a journal of this expedition, and therein thus describes what occurred when they reached the summit of the Blue Ridge: "We drank King George's health and all the royal family's at the very top of the Appalachian mountains."
The company then descended the western side of the mountain, and, reaching the Shenandoah river, they encamped upon its banks. Fontaine thus preserves an account of what occurred:
The Governor had graving irons, but could not grave anything, the stones were so hard. I graved my name on a tree by the riverside, and the Governor hurried a bottle with a paper enclosed on which he writ that he took possession of this place in the name and for King Geo. 1st. of England. We had a good dinner, and after it we got the men together, and loaded all their arms, and we drank the King's health in champaign and fired a volley, the Princess's health in Burgundy and fired a volley, and in claret and fired a volley. We drank the Governor's health and fired another volley. We had several sorts of liquers, viz. Virginia Red Wine and White Wine, Esquebaugh, brandy, shrub, rum, champaign, eavory, punch water, cider, etc. :We called the highest mountain Mount George and the one we crossed over Mount Spotswood."
Governor Spotswood, from the fertility of the soil, gave the name of Euphrates to the river (now Shenandoah), and he believed the same emptied into the great lakes and flowed northward. The Governor, upon his return to Williamsburg, instituted the Order of the Golden-Shoe, and presented to each of the gentlemen accompanying him a small horse-shoe made of gold inscribed with the motto: Sic jurat transcendere montes, "Thus he swears to cross the mountains."
Governor Spotswood, in a letter written in 1716, says: "The chief aim of my expedition over the great mountains in 1716 was to satisfy myself whether it was practicable to come to the lakes." The country thus described was a part of Sussex county, the western boundary of which was undefined. Spotsylvania was formed from Sussex in 1720, Orange from Spotsylvania in 1734, all of said counties including the territory now within the bounds of this county.
All this information is necessary to a history of Washington county, because Washington county was formed from the territory we are now dealing with, and, for the better reason, that the promoters of our early settlements and the founders of our early government came from the Valley of Virginia.
Mackey and Sallings, 1726
In the year 1726, two men named Mackey and Sallings explored the Valley of Virginia. John Peter Sallings, one of the two explorers of the valley above mentioned, was captured by the Indians and passed through this immediate section as early as 1726.
Withers, in his history entitled "Border Warfare," thus describes the captivity of Sallings:
Sallings," he says, "was taken to the country now known as Tennessee, where he remained for some years. In company with a party of Cherokees, he went on a hunting expedition to the salt licks of Kentucky and was there captured by a band of Illinois Indians, with whom the Cherokees were at war. He was taken to Kaskaskia, and adopted into the family of a squaw, whose son had been killed. While with these Indians he several times accompanied them down the Mississippi river, below the mouth of the Arkansas, and once to the Gulf of Mexico.
The Spaniards in Louisiana, desiring an interpreter, purchased him of his Indian mother, and some of them took him to Canada. He was there redeemed by the French Governor of that province, who sent him to the Dutch settlement in New York, whence he made his way home after an absence of six years.
Informal Exploration
The earliest visit to this section of Virginia by an Anglo-Saxon of which we have any record or knowledge was made by Dority, a citizen of Eastern Virginia, who in the year 1690 visited the Cherokee Indians in their home, south of the Little Tennessee, and traded with them. There can be no reasonable doubt that from a very early period, long preceding the making of a permanent settlement by the white man in this section, many of the citizens of Virginia living east of the mountains carried on, in many instances, an active trade with the Indians living south of the Little Tennessee and in Kentucky.
This section was uninhabitated by the Indians for many years previous to the explorations of the white man, and the wilderness was full of game of almost all kinds. Their flesh was valuable, and the skins and furs taken in one season by a single hunter would bring many hundreds of dollars, and thus many daring hunters were induced to visit this section long before any white man thought of settling the lands.
In confirmation of this idea Mr. Vaughan, of Amelia county, Va., who died in the year 1801,-was employed about the year 1740 to go as a packman with a number of Indian traders to the Cherokee nation. The last hunter's cabin he saw as he traveled from Amelia county, Va., to East Tennessee was on Otter river, a branch of Staunton river, now in Bedford county. The route he traveled was an old trading path following closely the location of the Buckingham road to a point where it strikes the Stage Road in Botetourt county; thence nearly upon the ground which the Stage Road occupies, crossing New River at Inglis' Ferry; thence to Seven Mile Ford on the Holston; thence to the left of the road which formed the old Stage Road; thence on to the North' Fork of Holston, above Long Island in Tennessee, crossing it where the Stage Road formerly crossed it, and on into the heart of Tennessee. This hunter's trail, or Indian trace, was an old path when he first saw it, and he continued to travel the same until 1754, trading with the Indians.
Van Meter, Hite, Lewis, and Mackey, c1730
In the year 1730, John and Isaac Van Meter obtained from Governor Gooch, of Virginia, a patent for forty thousand acres of land to be located in the lower valley, and this warrant was sold in 1731 to Joist Hite, of Pennsylvania, who, in 1732, brought his family and sixteen other families and located a few miles south of the present site of Winchester, Va., and this is generally believed to be the first settlement by a white man west of the Blue Ridge.
Emigration to this new land was rapid, and soon reached beyond the confines of Hite's possessions. About the time of the Hite settlement John Lewis, Peter Sallings and Mackey made settlements in the valley. Lewis settled on Lewis' creek near the present site of Staunton, Sallings, at the forks of James river and Mackey, at Buffalo Gap. Within less than one year the population of the country near the settlement made by Lewis was considerable, so rapid was the migration to the new land.
Beverly's Manor and Borden's Grant
The early settlers in this portion of Virginia had to contend with titles obtained by individuals and companies for large tracts of land, and such grantees were usually favorites of the King or of the King's councillors. On the 6th of September, 1736, William Gooch, Lieutenant-Governor of Virginia, issued a patent for the "Manor of Beverly," covering one hundred and eighteen thousand and ninety-one acres of land lying in the county of Orange between the great mountains and on the River Sherando, and on September 7, 1736, William Beverly, of Essex, became the owner of the entire grant. This patent covered most of the fine lands in the Valley of Virginia near Staunton and Waynesboro, and soon thereafter Governor Gooch granted Benjamin Borden five hundred thousand acres of land situated south of Beverly Manor and on the waters of the James and Shenandoah rivers.
Each of the grants above described was to become absolute, provided the patentees succeeded in settling a given number of families thereon in the time named in the grant, and as a result the patentees, Hite, Beverly and Borden, solicited and obtained settlers from America and Europe. Benjamin Borden, upon the receipt of his grant, immediately visited England, and in 1737 returned with a hundred families, [3]among whom were the McDowells, Crawfords, McClures, Alexanders, Walkers, Moores, Matthews and many others, the founders of many of Virginia's distinguished families.
In 1738, the counties of Frederick and Augusta were formed out of Orange. The territories embraced within these two counties included all of Virginia west of the Blue Ridge and was, almost without exception, a howling wilderness occupied by the Indians and wild beasts. It is evident from the statement contained in the act establishing Augusta county that there had been a rapid and considerable increase of the population in the valley.
The act establishing the county of Augusta provided that the organization of the county should take place when the Governor and Council should think there was a sufficient number of inhabitants for appointing justices of the peace and other officers and creating courts therein.
While the act establishing Augusta county was passed in 1738, the county was not organized until 1745. The first court assembled at Staunton on December 9, 1745, at which time the following magistrates were sworn in, having been previously commissioned by the Governor of Virginia—viz.: James Patton, John Buchanan, George Robinson, James Bell, Robert Campbell, John Lewis, John Brown, Peter Scholl, Robert Poage, John Findley, Richard Woods, John Christian, Robert Craven, John Pickens, Andrew Pickens, Thomas Lewis, Hugh Thompson, John Anderson, Robert Cunningham, James Kerr and Adam Dickenson.
James Patton was commissioned high sheriff, John Madison, clerk, and Thomas Lewis, surveyor of the county. It is worthy of note that James Patton, the first sheriff of Augusta county, was the first man to survey and locate lands within the boundaries of Washington county as originally formed, and the land by him acquired composed a considerable part of the best lands within this county.
The idea of offering the dissenters from the Church of England inducements to settle the lands west of the mountains had often been suggested and earnestly advocated by many of the prominent men in the Virginia Colony, but no move in that direction was taken until about the time of the first settlement of the lower Valley, at and after which time the Governor and Council of Virginia, with but little hesitancy, permitted the erection of dissenting churches in the Valley, and encouraged the immigration of settlers whenever possible. The result of this action was a flood of settlers, emigrants from Scotland and Ireland, who came by way of Pennsylvania, mostly Scotch-Irish Presbyterians in belief. They passed into and settled in the Valley, and in a few years the Valley from Harper's Ferry to New river was populated with a progressive, liberty-loving people second to none on earth.
Patton, Walker, and Buchanan, 1736-1753
Colonel James Patton, who came from the north of Ireland in 1736, was one of the first and most influential settlers of the Valley of Virginia. In the year 1745, be secured a grant from the Governor and Council of Virginia, for one hundred and twenty thousand acres of land west of the Blue Ridge, and he and his son-in-law, John Buchanan, who was also deputy surveyor of Augusta county, located lands on the James river, and founded and named Buchanan and Pattonsburg, villages that were built on the opposite sides of the James river, now in Botetourt county.
In the year 1748, Dr. Thomas Walker, who afterwards, on the 39th day of September, 1752, qualified as a deputy surveyor of Augusta county; Colonel James Patton, Colonel John Buchanan, Colonel James Wood and Major Charles Campbell, accompanied by a number of hunters, John Findlay being of the number, explored Southwest Virginia and East Tennessee, and located and surveyed a number of very valuable tracts of land by authority of the grant to Colonel James Patton.
We give below a list of the first surveys made on the waters of the Holston and Clinch rivers. [4] This information is derived from the surveyor's records of Augusta county at Staunton, Va. Each of the above surveys is signed by Thomas Lewis, surveyor of Augusta county, and in the left-hand corner of the plot, recorded with each survey, are written the letters J. B., the initials of John Buchanan, deputy surveyor of the county. It is evident from this record that John Buchanan surveyed the several tracts of'land first located in Washington county, and that he was on the waters of the Indian or Holston river surveying as early as the 14th day of March, 1746.
It will be observed from an inspection of this list of surveys that on April 2, 1750, there was surveyed for Edmund Pendleton 3,000 acres of land lying on West creek, a branch of the South Fork of Indian river, which tract of land now lies in Sullivan county, Tennessee. This tract was patented to Edmund Pendleton in 1756 upon the idea that the Virginia line, when run, would embrace these lands.
It is worthy of note that these early explorers and the many hunters and traders who had previously visited this section called the Holston river the Indian river, while the Indians gave it the name of Hogoheegee, and the French gave it the name of the Cherokee river.
All of the lands surveyed in this county previously to 1748 are described in the surveys as being on the waters of the Indian river. These explorers returned to their homes delighted, no doubt, with the excellent lands they had visited, but nothing resulted from their efforts save the acquisition of a knowledge of the country.
At the time Dr. Walker and his associates made their trip of exploration above described they were followed as far as New river by Thomas Inglis and his three sons, Mrs. Draper and her son and daughter, Adam Harman, Henry Leonard and James Burke, pioneers in search of a home in the wilderness. Lands were surveyed for each of them, which lands are described in the respective surveys as lying on Wood's river, or the waters of Wood's river. Here river, five Indian houses built with logs and covered with bark, around which there were an abundance of bones and many pieces of mats and cloth. On the west side of. the North Fork of Hol- ston river they found four Indian houses, and four miles southwest of the junction of the North and South Forks of Holston river they discovered an Indian fort on the south side of the main Holston river.
On April 2d they left the Holston river and traveled in a northwest direction toward Cumberland Gap, passing over Clinch mountain at Loony's Gap, it is thought. They reached the Clinch river above the present location of Sneedsville, in Hancock county, Tennessee, and on the 12th day of April they reached Powell's river, ten miles from Cumberland Gap. It is well to note at this point that Ambrose Powell, one of Dr. Walker's companions, cut his name upon a tree on the bank of this river, which name and tree were found in the year 1770 by a party of fifteen or twenty Virginians on their way to Kentucky on a hunting expedition, from which circumstance the Virginia Long Hunters gave it the name of Powell's river, which name it still retains. On the 13th they reached Cumberland Gap, which gap Dr. Walker afterwards named Cumberland Gap in honor of the Duke of Cumberland, the son of George II, and the commander of the English forces, on the 16th of April, 1746, at Culloden, where he defeated, with great slaughter, the Highland forces, refusing quarter to the wounded prisoners.
On the 17th of April he reached the Cumberland river and named it at that time. On the 23d a part of this company was left to build a house and plant some peach stones and corn. On the 28th Dr. Walker returned to his company and found that they had built a house 12x8 feet, cleared and broken up some ground and planted corn and peach stones.
This was the first house built by an Anglo-Saxon in the State of Kentucky, and it was used and occupied as late as 1835. The location of this house is on the farm of George M. Faulkner, about four miles below Barboursville, Ky. They thence traveled in a northeast direction, crossing Kentucky river and New river and striking the waters of the Greenbrier, and on the 13th day of July Dr. Walker reached his home. On this journey they killed thirteen buffaloes, eight elks, fifty-three bears, twenty deer, four wild geese and about a hundred and fifty turkeys, and could have killed three times as much meat if they had wanted it.
It is to be recollected that this trip and the building of the cabin in the wilderness of Kentucky was all in the interest of the "Loyal Company."
About this time the "Ohio Company" entered a caveat against the "Loyal Company," and the Loyal Company got into a dispute with Colonel James Patton, who had an unfinished grant below where this company were to begin, and no further progress was made by the company until June 14, 1753.
In the year 1748, Mr. Gray, Mr. Ashford Hughes and others obtained a grant from the Governor and Council for 10,000 acres of land lying on the waters of the New river, which grant was soon afterwards assigned to Peter Jefferson (father of Thomas Jefferson), Dr. Thomas Walker, Thomas Merriweather and David Merriweather, which lands were surveyed and principally settled in the early days of the settlement of this section.
About the same time the Governor and the Council of Virginia granted to John Lewis, of Augusta, and his associates 100,000 acres of land to be located on the Greenbrier river, and thus the English Government sought to displace the French in their efforts to settle and hold the lands west of the Alleghany mountains.
On the other hand, the movements of the English were closely watched by the French, who were equally determined to defeat them in their aspirations. A company of French soldiers in 1752 were sent south as far as the Miami river to notify the English traders among the Indians to leave the country, which they refused to do, and thereupon a fight ensued between the French and Indians, in which fourteen Miami Indians were killed and four white prisoners were taken, and thus began the contest which resulted in the loss to France of all her possessions in Canada and east of the Mississippi river.
In April of the year 1749, the house of Adam Harmon, one of the first settlers near Inglis' Ferry, on New river, was visited by the Indians, and his furs and skins stolen.
• This was the first Indian depredation committed on the white settlers west of the Alleghany mountains.
In the month of November, 1753, the House of Burgesses of
• Dr. Hale's "Trans-Alleghany Pioneers.
Virginia passed an act for the further encouraging of persons to settle on the waters of the Mississippi, which act we here copy in full:
1. Whereas, it will be the means of cultivating a better correspondence with the neighboring Indians if a farther encouragement be given to persons who have settled on the waters of the Mississippi, in the county of Augusta; and, whereas, a considerable number of persons, as well his majesty's natural born subjects as foreign Protestants, are willing to come into this Colony with their families and effects and settle upon the lands near the said waters in case they can have encouragement for 30 doing; and, whereas, the settling of that part of the country will add to the security and strength of the Colony in general and be a means of augmenting his majesty's revenue of quit rents;
2. Be it therefore enacted by the Lieutenant-Governor, Council and Burgesses of this present General Assembly, and it is hereby enacted by the authority of the same, That all persons being Protestants who have already settled or shall hereafter settle and reside on any lands situated to the westward of the ridge of mountains that divide the rivers Roanoke, James and Potowmack, from the Mississippi in the county of Augusta, shall be and are exempted and discharged from the payment of all public county and parish levies for the term of fifteen years next following, any law, usage, or custom to the contrary thereof, in any wise notwithstanding.[5]
The English Government were exceedingly anxious to encourage the settlements on the waters of the Mississippi and thereby strengthen their frontiers and fortify their claim to the lands lying west of the Alleghany mountains, and, in keeping with this desire, the Governor and Council of Virginia, on June 14, 1753, renewed the grant to the "Loyal Company" and allowed them four years' farther time to complete the surveying and seating of said land, and on the 6th day of July following Dr. Thomas Walker, their agent, proceeded with all convenient speed to survey said land and to sell the same to purchasers at three pounds per hundred acres, exclusive of fees and rights. The basis of the operations of Dr. Walker was in Southwest Virginia, and by the end of the year 1754 he had surveyed and sold 224 separate tracts of land containing 45,249 acres, which surveys were made in the name of the several purchasers from him, and many of the said tracts of land were actually occupied by settlers.
During this time James Patton was actively at work surveying and selling lands to settlers under his grant from the Governor and Council, and the tide of emigration was fast settling towards Southwest Virginia, when the French-Indian war of 1754-1763 came on, which war began in all its fury about this time, and thereby Dr. Walker, agent for the "Loyal Company," and James Patton and others were prevented, for the time being, from further prosecuting their enterprises in surveying and settling this portion of Virginia.
In the spring of 1754, numbers of families were obliged, by an Indian invasion, to remove from their settlements in Southwest Virginia, and these removals continued during the entire war. It will be well here to note the fact that the lands held by Stephen Holston, James McCall, Charles Sinclair and James Burke, the earlier settlers of this portion of Virginia, were held by them under what were known at that time as "corn rights—that is, under the law as it then stood, each settler acquired title to a hundred acres for every acre planted by him in corn, but subsequent settlers, as a general rule, held their lands under one of the above-mentioned grants. Stephen Holston, who settled at the head spring of the Middle Fork of Holston some time prior to 1748, did not remain long at this place, but sold his right to James Davis, who, on the 19th of March, 1748, had John Buchanan, deputy surveyor of Augusta county, to survey for him at this point a tract of land containing 1,300 acres, to which he gave the name of "Davis' Fancy," and the descendants of James Davis occupy a portion of this land to this day.
Stephen Holston, when he had disposed of his rights to Davis, constructed canoes, passed down the Holston, Tennessee and Mississippi rivers to Natchez, Mississippi, and thence returned to Virginia, and settled in Culpeper county, where he lived in 1754; afterwards, in 1757, he was captured by the Indians, but, making his escape, he returned to the waters of the Holston, and served under Colonel Christian upon the expedition to Point Pleasant in 1774, and in the expedition against the Cherokees in 1776. Many of his descendants are to be found in East Tennessee at this time.
At the beginning of the year 1753 two families resided on Back creek; James Reed, at Dublin, Va. (from whom Reed creek derived its name); two families on Cripple creek; James Burk, in Burk's Garden; Joseph and Esther Crockett, at the head waters of the South Fork of Holston river; James Davis, at the head waters of the Middle Fork of Holston river, and a family of Dunkards, by the name of McCorkle, on the west bank of New river near Inglis' Ferry. Of these facts we have record evidence. Many other families resided west of New river, of whom we have no record.
And thus closes the record of the first efforts made to explore and settle Southwest Virginia by the white man.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:14:04.000Z
|
tub2wh23ibmcvgoz3ffvr7usk5fv3hlt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19295",
"uncompressed_offset": 781051940,
"url": "www.wikidoc.org/index.php/Local_anesthetic",
"warc_date": "2013-11-22T15:00:26.000Z",
"warc_filename": "<urn:uuid:be5d19fd-fdb6-45ae-9cf6-d3b90fdd03c5>",
"warc_url": "http://www.wikidoc.org/index.php/Local_anesthetic"
}
|
cccc_CC-MAIN-2013-20
|
Local anesthetic
Jump to: navigation, search
WikiDoc Resources for
Local anesthetic
Articles
Most recent articles on Local anesthetic
Most cited articles on Local anesthetic
Review articles on Local anesthetic
Articles on Local anesthetic in N Eng J Med, Lancet, BMJ
Media
Powerpoint slides on Local anesthetic
Images of Local anesthetic
Photos of Local anesthetic
Podcasts & MP3s on Local anesthetic
Videos on Local anesthetic
Evidence Based Medicine
Cochrane Collaboration on Local anesthetic
Bandolier on Local anesthetic
TRIP on Local anesthetic
Clinical Trials
Ongoing Trials on Local anesthetic at Clinical Trials.gov
Trial results on Local anesthetic
Clinical Trials on Local anesthetic at Google
Guidelines / Policies / Govt
US National Guidelines Clearinghouse on Local anesthetic
NICE Guidance on Local anesthetic
NHS PRODIGY Guidance
FDA on Local anesthetic
CDC on Local anesthetic
Books
Books on Local anesthetic
News
Local anesthetic in the news
Be alerted to news on Local anesthetic
News trends on Local anesthetic
Commentary
Blogs on Local anesthetic
Definitions
Definitions of Local anesthetic
Patient Resources / Community
Patient resources on Local anesthetic
Discussion groups on Local anesthetic
Patient Handouts on Local anesthetic
Directions to Hospitals Treating Local anesthetic
Risk calculators and risk factors for Local anesthetic
Healthcare Provider Resources
Symptoms of Local anesthetic
Causes & Risk Factors for Local anesthetic
Diagnostic studies for Local anesthetic
Treatment of Local anesthetic
Continuing Medical Education (CME)
CME Programs on Local anesthetic
International
Local anesthetic en Espanol
Local anesthetic en Francais
Business
Local anesthetic in the Marketplace
Patents on Local anesthetic
Experimental / Informatics
List of terms related to Local anesthetic
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
Overview
A local anesthetic is a drug that causes reversible local anesthesia and a loss of nociception. When it is used on specific nerve pathways (nerve block), effects such as analgesia (loss of pain sensation) and paralysis (loss of muscle power) can be achieved.
Clinical local anesthetics belong to one of two classes: aminoamide and aminoester local anesthetics. synthetic local anesthetics are structurally related to cocaine. They differ from cocaine mainly in that they have no abuse potential and do not act on the sympathoadrenergic system, i.e. they do not produce hypertension or local vasoconstriction, with the exception of Ropivacaine and Mepivacaine that do produce weak vasoconstriction.
Local anesthetics vary in their pharmacological properties and they are used in various techniques of local anesthesia such as:
The local anesthetic lidocaine (lignocaine) is also used as a Class Ib antiarrhythmic drug.
Mechanism of action
All local anesthetics are membrane stabilizing drugs; they reversibly decrease the rate of depolarization and repolarization of excitable membranes (like neurons). Though many other drugs also have membrane stabilizing properties, all are not used as local anesthetics, for example propranolol. Local anesthetic drugs act mainly by inhibiting sodium influx through sodium-specific ion channels in the neuronal cell membrane, in particular the so-called voltage-gated sodium channels. When the influx of sodium is interrupted, an action potential cannot arise and signal conduction is inhibited. The receptor site is thought to be located at the cytoplasmic (inner) portion of the sodium channel. Local anesthetic drugs bind more readily to "open" sodium channels, thus onset of neuronal blockade is faster in neurons that are rapidly firing. This is referred to as state dependent blockade.
Local anesthetics are weak bases and are usually formulated as the hydrochloride salt to render them water-soluble. At the chemical's pKa the protonated (ionised) and unprotonated (unionised) forms of the molecule exist in an equilibrium but only the unprotonated molecule diffuses readily across cell membranes. Once inside the cell the local anesthetic will be in equilibrium, with the formation of the protonated (ionised form), which does not readily pass back out of the cell. This is referred to as "ion-trapping". In the protonated form, the molecule binds to the local anaesthetic binding site on the inside of the ion channel near the cytoplasmic end.
Acidosis such as caused by inflammation at a wound partly reduces the action of local anesthetics. This is partly because most of the anaesthetic is ionised and therefore unable to cross the cell membrane to reach its cytoplasmic-facing site of action on the sodium channel.
All nerve fibres are sensitive to local anesthetics, but generally, those with a smaller diameter tend to be more sensitive than larger fibres. Local anesthetics block conduction in the following order: small myelinated axons (e.g. those carrying nociceptive impulses), non-myelinated axons, then large myelinated axons. Thus, a differential block can be achieved (i.e. pain sensation is blocked more readily than other sensory modalities).
Undesired Effects
Localized Adverse Effects
The local adverse effects of anesthetic agents include neurovascular manifestations such as prolonged anesthesia (numbness) and paresthesia (tingling, feeling of "pins and needles", or strange sensations). These are symptoms of localized nerve impairment or nerve damage.
Risks
The risk of temporary or permanent nerve damage varies between different locations and types of nerve blocks [1].
Recovery
Permanent nerve damage after a peripheral nerve block is rare. Symptoms are very likely to resolve within a few weeks. The vast majority of those affected (92–97%), recover within four to six weeks. 99% of these people have recovered within a year. It is estimated that between 1 in 5,000 and 1 in 30,000 nerve blocks result in some degree of permanent persistent nerve damage [2].
It is suggested that symptoms may continue to improve for up to 18 months following injury.
Causes
Causes of localized symptoms include:
1. neurotoxicity due to allergenic reaction,
2. excessive fluid pressure in a confined space,
3. severing of nerve fibers or support tissue with the syringe/catheter,
4. injection-site [Hematoma] that puts pressure on the nerve, or
5. injection-site infection that produces inflammatory pressure on the nerve and/or necrosis.
General Adverse Effects
(See also local anesthetic toxicity)
General systemic adverse affects are due to the pharmacological effects of the anesthetic agents used. The conduction of electric impulses follows a similar mechanism in peripheral nerves, the central nervous system, and the heart. The effects of local anesthetics are therefore not specific for the signal conduction in peripheral nerves. Side effects on the central nervous system and the heart may be severe and potentially fatal. However, toxicity usually occurs only at plasma levels which are rarely reached if proper anesthetic techniques are adhered to. Additionally, persons may exhibit allergenic reactions to the anesthetic compounds and may also exhibit cyanosis due to methemoglobinemia.
Central nervous system
Depending on local tissue concentrations of local anesthetics, there may be excitatory or depressant effects on the central nervous system. At lower concentrations, a relatively selective depression of inhibitory neurons results in cerebral excitation, which may lead to generalized convulsions. A profound depression of brain functions occurs at higher concentrations which may lead to coma, respiratory arrest and death. Such tissue concentrations may be due to very high plasma levels after intravenous injection of a large dose. Another possibility is direct exposure of the central nervous system through the CSF, i.e. overdose in spinal anesthesia or accidental injection into the subarachnoid space in epidural anesthesia.
Cardiovascular system
The conductive system of the heart is quite sensitive to the action of local anesthetics. Lidocaine is often used as an antiarrhythmic drug and has been studied extensively, but the effects of other local anesthetics are probably similar to those of Lidocaine. Lidocaine acts by blocking sodium channels, leading to slowed conduction of impulses. This may obviously result in bradycardia, but tachyarrhythmia can also occur. With high plasma levels of lidocaine there may be higher-degree atrioventricular block and severe bradycardia, leading to coma and possibly death.
Treatment of overdose: "Lipid rescue"
There is evidence that Intralipid, a commonly available intravenous lipid emulsion, can be effective in treating severe cardiotoxicity secondary to local anaesthetic overdose, including human case reports of successful use in this way ('lipid rescue').[3] [4][5][6][7]
Hypersensitivity/Allergy
Adverse reactions to local anesthetics (especially the esters) are not uncommon, but true allergy is very rare. Allergic reactions to the esters is usually due to a sensitivity to their metabolite, para-aminobenzoic acid (PABA), and does not result in cross-allergy to amides. Therefore, amides can be used as alternatives in those patients. Non-allergic reactions may resemble allergy in their manifestations. In some cases, skin tests and provocative challenge may be necessary to establish a diagnosis of allergy. There are also cases of allergy to paraben derivatives, which are often added as preservatives to local anesthetic solutions.
Methemoglobinemia
The systemic toxicity of prilocaine is comparatively low, however its metabolite, o-toluidine, is known to cause methemoglobinemia. As methemoglobinemia reduces the amount of hemoglobin that is available for oxygen transport, this side effect is potentially life-threatening. Therefore dose limits for prilocaine should be strictly observed. Prilocaine is not recommended for use in infants.
Local anesthetics in clinical use
Esters are prone to producing allergic reactions, which may necessitate the use of an Amide. The names of Amides contain an "i" somewhere before the -aine. Esters do not.
Natural local anesthetics
Naturally occurring local anesthetics not derived from cocaine are usually neurotoxins, and have the suffix -toxin in their names. [2] Unlike cocaine produced local anesthetics which are intracellular in effect, saxitoxin & tetrodotoxin bind to the extracellular side of sodium channels.
See also
Footnotes
1. The Royal College of Anaesthetists, Nerve Damage Associated with Peripheral Nerve Block (2006)
2. The Royal College of Anaesthetists, Nerve Damage Associated with Peripheral Nerve Block (2006)
3. Weinberg GL, VadeBoncouer T, Ramaraju GA, Garcia-Amaro MF, Cwik MJ. Pretreatment or resuscitation with a lipid infusion shifts the dose-response to bupivacaine-induced asystole in rats. Anesthesiology 1998; 88: 1071-5.
4. Weinberg G, Ripper R, Feinstein DL, Hoffman W. Lipid emulsion infusion rescues dogs from bupivacaine-induced cardiac toxicity. Regional Anesthesia and Pain Medicine 2003; 28: 198-202..
5. Picard J, Meek T. Lipid emulsion to treat overdose of local anaesthetic: the gift of the glob. Anaesthesia 2006;61:107-9. PMID 16430560
6. Rosenblatt MA, Abel M, Fischer GW, Itzkovich CJ, Eisenkraft JB. Successful Use of a 20% lipid emulsion to resuscitate a patient after a presumed bupivacaine-related cardiac arrest. Anesthesiology 2006;105:217-8. PMID 16810015
7. Litz, RJ, Popp M, Stehr S N, Koch T. Successful resuscitation of a patient with ropivacaine-induced asystole after axillary plexus block using lipid infusion. Anaesthesia 2006;61:800-1.
References
"Nerve damage associated with peripheral nerve block", Risks associated with your anaesthetic, (The Royal College of Anaesthetists) Section 12, January 2006, <http://www.rcoa.ac.uk/docs/nerve-peripheral.pdf>. Retrieved on 2007-10-10
ar:مخدر موضعي de:Lokalanästhetikumit:Anestetico localenl:Lokaal anestheticum no:Lokalanestetikum
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:56:56.000Z
|
mwyv3hnjukjkfckl4mc72zf76ukf3dwf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19304",
"uncompressed_offset": 11829582,
"url": "answers.onstartups.com/questions/12547/moving-emails-across-google-apps-accounts",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://answers.onstartups.com/questions/12547/moving-emails-across-google-apps-accounts"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I had an account at
domain1.com, with G apps setup.
I setup another account at
domain2.com with another G apps account.
I want to move all my mails from domain1 to domain2 account. How can I do this?
share|improve this question
3 Answers
up vote 0 down vote accepted
I'm pretty sure there is no easy way to do that from the end-user GUI. If you have paid plans you could try to contact Google support and ask if they can do it for you (but I'm not hopeful, given Google Support's reputation).
What you could do is to download all mails to your local PC using Outlook, and then upload them to the other account using Email Uploader. Note that Email Uploader is being retired, but the link to the new replacement, Migration for Microsoft Outlook, does not seem to work right now.
I uploaded mails to Google Apps once, and it worked well enough, but it was a bit tricky to set up as I remember -- and it took a long time, 24 hours plus.
If Google Support can't help you, then the above trick is a bit difficult -- can't you just keep both accounts operative, and forward emails from one to the other from now on?
share|improve this answer
I am not quite sure if it is possible. I have set different domains at the same G apps accaunt, and it is easy, just add another domain and authenticate it.
share|improve this answer
You can download your user list as CSV from https://www.google.com/a/cpanel/domaìn.com/EmailAddresses and then upload them into your other account.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:29:46.000Z
|
hyb7ftyyvzd5juyr53z5sbioduzhabml
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19311",
"uncompressed_offset": 14276656,
"url": "archive.mises.org/3424/on-takings-and-public-use/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://archive.mises.org/3424/on-takings-and-public-use/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/3424/on-takings-and-public-use/
On Takings and Public Use
April 4, 2005 by
A law school buddy emailed me some comments about some recent developments in eminent domain law, e.g. this Slate article about Kelo v. New London–a case before the US Supreme Court, that concerns the state’s right to condemn private land and give it to private developers.
As a mini-primer–the Fifth Amendment to the U.S. Constitution requires that private property can’t be taken unless it is taken “for a public use” and “just compensation” is provided. Now this originally applied only the federal government (see discussion of Barron v. Baltimore here), but has been incorporated into the 14th Amendment so that it now limits the states as well (see this case, and this one; also here; more info re the 14th Amendment here).
So takings have to be for a “public purpose,” and the question is whether this requirement prevents states from condemning private land to give it to private developers. The Kelo case, as I understand it, is about whether “public use” in the 5th Amendment has any real Constitutional meaning. If it does, then shopping malls and luxury apartments become much more difficult to build.
It’s interesting to me how a sound economic (Austrian) and political (anarcho-capitalist) framework can help one cut through the muzzy arguments advanced by both “sides”.The problem is both the proponents, and opponents, of such “non-public use” takings seem to accept the basic idea that there is an objective way to classify something as being a “public use”. In my view, this standard is inherently vague and non-objective. Who knows, maybe transfering land from a little old lady to Donald Trump is a “public purpose,” as much as roads or the military. I doubt it’s possible to articulart a coherent, clear, just standard that the state could respect even if it wanted to. Since it’s not objective, in the end, it’s got to be whatever the state decrees.
Anarchists and Austrians ought to be able to see the problem here. Most people who think the state is justified have to accept the idea of a genuine public realm. In fact the economic concept of “public goods” is one main reason people support the state–they think there has to be a state otherwise certain necessary public goods would not be supplied. So if you believe this, you have to believe there is some definable, objectively bounded “public” purposes of the state. However, the idea of public goods is unscientific and uneconomic, as explained, e.g., by Austrian anarchocapitalist Hans-Hermann Hoppe, in Fallacies of the Public Goods Theory and the Production of Security. As Hoppe points out, there is no objective way to distinguish “public” goods. Likewise, if the state says it can expropriate things for a public purpose only, that falsely implies the state is limited–it implies that the standard of “publicness” is objective. But it is in fact not; it is just whatever the state decrees. Therefore under the guise of limiting itself, it really gives itself more power.
A similar point is true of many things about the state, such as the “rule of law”–for example, I tend to agree with libertarian law professor John Hasnas‘s view, in The Myth of the Rule of Law, that (my summary):
Despite common belief to the contrary, there is no such thing as “a government of laws and not people” (the so-called “rule of law”). Such a myth serves to maintain the public’s support for society’s power structure. The maintenance of liberty requires not only the abandonment of the ideal of the rule of law but also the [abandonment of the] commitment to a monopolistic legal system. The preservation of a truly free society requires liberating the law from state control to allow for the development of a market for law.)
Likewise, the state deludes people into thinking its expropriating power is limited, when it really is not. This allows it to get away with more than if its actions were recognized as naked criminality. Once you accept it’s okay for the state to take your property so long as it’s for a “public purpose,” then all it takes is some crafty government lawyer to come up with an argument why taking your land to give to Donald Trump indeed serves some public purpose. And of course, it does, as much as any other kind of eminent domain does.
Nonetheless, even though these standards are ambiguous and subject to manipulation by the state, it is to be hoped that some rationale is invented to limit the state’s resort to condemnation. Of note is the recent Michigan Supreme Court case, County of Wayen v. Hathcock [also, Overcoming Poletown: County of Wayne v. Hathcock, Economic Development Takings, and the Future of Public Use, by Ilya Somin; and the Institute for Justice's discussion of this case], which makes it more difficult (in Michigan) to expopriate land for a private purupose. There, the Court stated:
We are presented again with a clash of two bedrock principles of our legal tradition: the sacrosanct right of individuals to dominion over their private property, on the one hand and, on the other, the state’s authority to condemn private property for the commonweal. In this case, Wayne County would use the power of eminent domain to condemn defendants’ real properties for the construction of a 1,300-acre business and technology park. … Defendants argue that this exercise of the power of eminent domain is [not] permitted under article 10 of the 1963 Michigan Constitution, which requires that any condemnation of private property advance a “public use.” … We conclude that … these condemnations do not pass constitutional muster under art. 10, § 2 of our 1963 constitution. Section 2 permits the exercise of the power of eminent domain only for a “public use.” In this case, Wayne County intends to transfer the condemned properties to private parties in a manner wholly inconsistent with the common understanding of “public use” at the time our Constitution was ratified.
A final note–I have written on this topic in the international context, where international law is said to have similar standards for a host state to lawfully expropriate an investor’s property–the expropriation must be: (a) for a public purpose, (b) nondiscriminatory, and (c) accompanied by prompt and adequate compensation. There has been a great deal of debate about what adequate compensation means, but the obvious answer is that it has to be “full” compensation, however measured. If you take someone’s property, you should compensate them for its full value.
But if this is so, one can see that the “public purpose” requirement is basically superfluous and nonsensical: after all, whether the host state takes property for a public purpose or not, it still owes the investor full compensation. What’s the difference? The only way to distinguish between a lawful “public purpose” expropriation, and an unlawful one, would be for there to be different consequences–primarily, different damages. But this would require undercompensation in “legal” expropriations, which makes no sense. Alternatively, full compensation could be awarded in normal expropriations, with extra punitive damages added if the taking is discriminatory or not for a public purpose. But the problem with this approach is that punitive damages are especially troubling and unlikley in the international context where even full compensation has met with lots of resistance. (Background for this can be found in chapter 3 of my 1997 book Protecting Foreign Investment Under International Law: Legal Aspects of Political Risk, pp. 58-59 and 77-85; the section “The Requirements of Nondiscrimination and Public Purpose: Concepts of Limited Significance,” at pages 85-87, presents this argument which, so far as I know, is unique to my co-author and me. We planned at one point to turn that section into the thesis of a full blown article, but never got around to it. This argument will be expanded in International Investment, Political Risk, and Dispute Resolution: A Practitioner’s Guide, due out later this year.)
In the municipal (i.e., national law) context, however, the courts can actually enjoin the expropriation, if it is “unlawful”, so the public purpose requirement makes more sense–even if the standard is still inherently non-objective and arbitrary.
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:49:26.000Z
|
uju5mt4tx5jwgfjspgsmo4xnwf4kqegi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19312",
"uncompressed_offset": 14290017,
"url": "archive.mises.org/8829/the-myth-that-laissez-faire-is-responsible-for-our-financial-crisis/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://archive.mises.org/8829/the-myth-that-laissez-faire-is-responsible-for-our-financial-crisis/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/8829/the-myth-that-laissez-faire-is-responsible-for-our-financial-crisis/
The Myth that Laissez Faire Is Responsible for Our Financial Crisis
October 22, 2008 by
The myth that laissez faire exists in the present-day United States and is responsible for our current economic crisis is promulgated by people who know practically nothing whatever of sound, rational economic theory or the actual nature of laissez-faire capitalism.
They espouse it despite, or rather because of, their education at the leading colleges and universities of the country. When it comes to matters of economics, their education has steeped them entirely in the thoroughly wrong and pernicious doctrines of Marx and Keynes. In claiming to see the existence of laissez faire in the midst of such massive government interference as to constitute the very opposite of laissez faire, they are attempting to rewrite reality in order to make it conform with their Marxist preconceptions and view of the world.
FULL ARTICLE
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:14:26.000Z
|
p735lrxw3h35qz4cvjehfu3ihrzkuort
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19314",
"uncompressed_offset": 19035703,
"url": "arthritis-research.com/content/14/2/R77/abstract",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://arthritis-research.com/content/14/2/R77/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Circulating and synovial antibody profiling of juvenile arthritis patients by nucleic acid programmable protein arrays
David S Gibson1,2*, Ji Qiu3, Eliseo A Mendoza3, Kristi Barker3, Madeleine E Rooney1 and Joshua LaBaer3
Author Affiliations
1 Arthritis Research Group, Centre for Infection and Immunity, Health Science Building, Queen's University of Belfast, 97 Lisburn Road, Belfast BT9 7BL, UK
2 Division of Endocrinology, Metabolism and Diabetes, School of Medicine, University of Colorado Denver, 12800 E. 19th Avenue, Aurora, CO 80045, USA
3 Center for Personalized Diagnostics, Arizona State University, 1001 S. McAllister Avenue, Tempe, AZ 85287-6401, USA
For all author emails, please log on.
Arthritis Research & Therapy 2012, 14:R77 doi:10.1186/ar3800
Published: 17 April 2012
Abstract
Introduction
Juvenile idiopathic arthritis (JIA) is a heterogeneous disease characterized by chronic joint inflammation of unknown cause in children. JIA is an autoimmune disease and small numbers of autoantibodies have been reported in JIA patients. The identification of antibody markers could improve the existing clinical management of patients.
Methods
A pilot study was performed on the application of a high-throughput platform, the nucleic acid programmable protein array (NAPPA), to assess the levels of antibodies present in the systemic circulation and synovial joint of a small cohort of juvenile arthritis patients. Plasma and synovial fluid from 10 JIA patients was screened for antibodies against 768 proteins on NAPPAs.
Results
Quantitative reproducibility of NAPPAs was demonstrated with > 0.95 intra-array and inter-array correlations. A strong correlation was also observed for the levels of antibodies between plasma and synovial fluid across the study cohort (r = 0.96). Differences in the levels of 18 antibodies were revealed between sample types across all patients. Patients were segregated into two clinical subtypes with distinct antibody signatures by unsupervised hierarchical cluster analysis.
Conclusion
The NAPPAs provide a high-throughput quantitatively reproducible platform to screen for disease-specific autoantibodies at the proteome level on a microscope slide. The strong correlation between the circulating antibody levels and those of the inflamed joint represents a novel finding and provides confidence to use plasma for discovery of autoantibodies in JIA, thus circumventing the challenges associated with joint aspiration. We expect that autoantibody profiling of JIA patients on NAPPAs could yield antibody markers that can act as criteria to stratify patients, predict outcomes and understand disease etiology at the molecular level.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:13:20.000Z
|
nmjhega22eedxzv3zuw2pxfndfejfzzn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19333",
"uncompressed_offset": 43118228,
"url": "buffalo.nas-central.org/w/index.php?oldid=6951&title=Category%3AKurobox",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://buffalo.nas-central.org/w/index.php?title=Category:Kurobox&oldid=6951"
}
|
cccc_CC-MAIN-2013-20
|
Category:Kurobox
From NAS-Central Buffalo - The Linkstation Wiki
Revision as of 02:37, 18 September 2006 by Ramuk (Talk | contribs)
Jump to: navigation, search
Kuro Box
Kanji for Kuro Box
The Kuro Box
The Kuro Box is the name for a series of PowerPC processor based computers intended for use as a network-attached storage device. The original Kuro Box was made from spare hardware components the manufacturer had from the Linkstation. Recent versions of the Kuro Box use later Linkstation hardware or hardware very similar to the one of the Linkstation. All Kuro Box versions are provided without a Hard Drive. The case has the same physical dimensions and shape as the LinkStation, but it is black in color and has the Kanji symbols for Kuro Box () in silver lettering on the side panel.It has an internal Parallel ATA interface for a user supplied hard drive (as the device does not come with one). The product was designed to accept a Linux distribution for the PowerPC, several including Gentoo, Debian, Fedora and Sylver's Distro (which is the current incarnation of the Kuro's original embedded distribution) have been ported to it by various user groups in both the USA/Europe and Japan. It is sold by Buffalo Technology/Melco
Interesting Articles from the Kurobox Wiki
Add Jtag Port
• This document is a work in progress. It explains how to fit the internal on-chip debug (OCD) port on a Linkstation, Kuro-Box or Kuro-Box/HG to a PC interface.
LCDKuro
• This project is to add an LCD display device to the kurobox. The display will be used to provide useful information and a handy console for logging in with a keyboard.
Sekuro-box
• A security center based on the fantastic Kuro-box, use a Webcam to record any activity in front of the webcam
John's Suggested MP3 Player
• A portable mp3 player that a Nintendo DS with the web browser cartridge. A wireless connection from the mp3 player that automatically links up to home network and sync music collection when the mp3 player is in range.
Kurobox Media Ripper
• The KuroRipper is an addition to the Kurobox NAS system. It allows automatic copying of images,video and audio files from USB media such as USB keys, Compact FLASH, and SD cards. Also, it will rip entire audio CDs to mp3 format and, if avaialable will add the correct tags from the CDDB database to your Kurobox shares. Target directories.
Turn your Kuro into a Digital Video Recorder/Player
• Installing a Hauppage WinTV-PVRUSB2 capture device on Kuro and configure it to automatically record shows and save them in media directory.
Debian Galleon Media Server
• Galleon is a free open source media server that typically runs on a home computer and can serve your media collection, Internet content, and applications to your TV using your TiVo© DVR.
Subcategories
This category has only the following subcategory.
O
Pages in category "Kurobox"
The following 98 pages are in this category, out of 98 total.
A
B
C
D
E
F
G
H
I
J
K
L
M
N
P
R
S
T
U
V
W
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:30:22.000Z
|
guvsjqucx2q4bzc6unxmagx7n6ptjnr5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19334",
"uncompressed_offset": 49026362,
"url": "ccsenet.org/journal/index.php/jsd/article/view/6344/0",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://ccsenet.org/journal/index.php/jsd/article/view/6344/0"
}
|
cccc_CC-MAIN-2013-20
|
Assessment of Socioeconomic Factors and Stakeholders Involved in Dzanga Sangha Complex Protected Area, Central African Republic
Ngbo-Ngbangbo Louis Maxime, Ge Jiwen, Nahayo Alphonse
Abstract
Dzanga Ndoki is the main National Park located in Dzanga Sangha Complex Protected Area, Central African Republic. This study assesses socioeconomic factors and different NGOs involved in management of the park. A questionnaire survey was used to collect data in 8 villages around the park. Results on socioeconomic study showed that younger people aged of 20-25 (36.55%) and between 25-30 (27. 81%) are more dynamic in the forest than elderly ones (age >35) who represented (5.61%). Better education may help in conservation of the Dzanga Ndoki due to different employment. Admittedly, 39.27% of people had primary education, (6.4%) had secondary level, (1.33%) had higher education and 53.18% were illiterate. Employment and access to market are missing. Participative management has mostly focused on villages of Mossapoula and Yandoumbe. Ba Aka people (60.52%) were not satisfied with the project. In addition, poor conditions of local people let them very dependent to forest resources (illegal hunting and gathering). This project is however unable to provide financial support to national NGOs and associations for local people.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Journal of Sustainable Development ISSN 1913-9063 (Print) ISSN 1913-9071 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:03:57.000Z
|
eojp55kbhsgjnb3tnreeokwxhdebq4q7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19370",
"uncompressed_offset": 87703132,
"url": "elinux.org/index.php?oldid=197378&title=Embedded_linux_status",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://elinux.org/index.php?title=Embedded_linux_status&oldid=197378"
}
|
cccc_CC-MAIN-2013-20
|
Embedded linux status
From eLinux.org
Revision as of 00:49, 4 December 2012 by Tim Bird (Talk | contribs)
Jump to: navigation, search
Here is an outline for a presentation on the status of embedded Linux:
This is essentially Tim Bird's private collection of interesting notes about the status of embedded Linux. It tends to get updated right before a Linux conference.
NEWS: Tim Bird's Status of Embedded Linux (PDF) (February 2012) presentation from ELC 2012 is now available.
Contents
Process for adding information
Anyone can add information to this page. I used to maintain the information at the Technology Watch List, but the table format there is a bit constrictive. (It would be nice if MediaWiki had a table editor!!)
Since I have to form this stuff into a "State of Embedded Linux" presentation several times a year, keeping the information in wiki outline format is convenient for me. It's easier to put directly into a presentation.
Please place information in bullet form, with a link to a supporting article, in the appropriate sub-section below.
Page History
I'll let MediaWiki store historical versions of this page. If you want to see what the hot issues were from a last year or a few years ago, please see look at the page history. (Although, updates of this page have historically been a bit spotty).
Presentation History
Here's my presentation history:
Uncategorized info
This is where I put stuff I haven't had time to analyze or sort into the appropriate category:
February 2012
• lttng 2.0 was in mainline for about 2 weeks
• CTF exists, as well as babeltrace
• babeltrace (library for trace conversion) exists, but has no serious converters yet
• TMF (eclipse viewer) support for CTF coming real soon (if not already) (was predicted to be January 2012)
• TMF support for LTTng 2.0 planned for q2 2012
May 2011
Quote:
LinuxFR : What is your opinion about Android ? Are you mostly happy they made cellphones very usable or sad because it's really a kernel fork ?
Linus Torvalds : I think forks are good things, they don't make me sad. A lot of Linux development has come out of forks, and it's the only way to keep developers honest - the threat that somebody else can do a better job and satisfy the market better by being different. The whole point of open source to me is really the very real ability to fork (but also the ability for all sides to then merge the forked content back, if it turns out that the fork was doing the right things!)
So I think the android fork forced the mainline developers to seriously look at some of the issues that android had. I think we've solved them in mainline, and I hope (and do think) that android will eventually end up merging to mainline. But it will probably take time and further effort.
I think the more serious long-term issue we have in the kernel is the wild and crazy embedded platform code (and mostly ARM - not because ARM is in any way fundamentally crazier, but because ARM is clearly the most successful embedded platform by far). The embedded world has always tended to eschew standardized platforms: they've been resource constrained etc, so they've done very tailored chip and board solutions, and felt that they couldn't afford a lot of platform abstraction.
That causes a big maintenance headache, because then all those crazy platforms look slightly different to the kernel, and we have all that silly code just to support all those variations of what is really just the same thing deep down, just differently hooked up and with often arbitrary small differences.
But that's something that happens both within and outside of Android, it's in no way android-specific.
LinuxFR : What about the technical differences between Android and mainline ? Do you think the "wakelock" controversy is solvable ?
Linus Torvalds : I think it is technically largely solved (ie "details to be fixed, but nothing fundamentally scary"), but practically once you have an interface and existing code, it just is a fair amount of work to change. And there perhaps isn't quite enough motivation to make those changes very quickly. So it will take time, and probably several releases (both mainline and adroid) to actually happen.
LinuxFR : Can you explain why you're not happy with the ARM patches sent to you during merge windows ? Is there an obvious solution for this fragmentation problem ?
Linus Torvalds : Obvious solution? No. The problem is the wild variety of hardware, and then in many cases the Linux ARM platform code (not the ARM CPU support, but the support for certain chips with all the glue issues around the CPU core) has been mostly ugly "copy-and-paste" from some previous ARM platform support file, with some minimal editing to make it match the new one.
And it just results in this unmaintainable mess. It becomes painful when somebody then fixes some core infrastructure, and you end up with a hundred different ARM files all using that infrastructure. That happened with the IRQ chip driver cleanups Thomas did recently (well, has been doing over along time, the recent part is really just the final removal of some nasty old interfaces).
It results in other maintainability issues too - patches being big just means that people won't look at them as carefully etc etc. So it's just a bad situation. Many of the cases should be solvable by having better generic solutions and then plugging in just some per-platform numbers for those solutions.
April 2011
Other
• CONFIG_PM being eliminated - improved PM configuration
• ftrace using -mfentry (feb 9, 2011 lkml, steven rostedt)
April 2010
Previous to April 2010
• SystemTap 1.0 now includes support for cross-compilation.
• Patches for dynamic printks
• writing to /dev/kmsg to generate a printk (not new, but I just discovered it)
• LZO kernel compression is in 2.6.33
• Arjan van de Ven's timer-slack code - http://lwn.net/Articles/369361/
Kernel
Kernel Versions
Bootup Time
• U-boot bootgraph.pl support (see e-mail from Andrew Murray)
• Android has problems
• many people are addressing it with Snapshot boot
• readahead is getting lots of attention
• See Tim's presentation on Android boot time with readahead
• snapshot boot (see above)
• See ELC 2010? and ABS 2011 presentation on snapshot booting
• embedded bootchart
• busybox bootchart
• bootchart in Android init
• bootchart2 project
• C collector, python visualizer
• filesystem speedups
• CELF funding UBI logging
• CELF funding read-only block filesystems on flash (MTD)
• XIP
• Almost removed from kernel
• versions in kernel were broken, use of XIP on out-of-tree platforms doesn't help keep XIP in the tree
Bootloader
Memory Management
• anything new happening?
Power Management
• suspend blockers? (aka wakelocks)
• device PM
then and now
2003 - wanted:
• operating points
• frequency scaling
• tickless idle
• device pm
2011 - have:
• tickless idle
• device pm
• ???
System Size
• CELF reviving Linux-tiny project
• bloatwatch is still running, but who looks at it?
• Xi Wang's talk at ELC about optimizing memory usage throughout system (kernel, libs, application)
• OOM killer - dealing with memory pressure:
• [RESEARCH: OOM killer news]
• Android has its own thing
• cgroup memory notifications
then and now
2003 - wanted (shrink kernel to ???k) 2011 - current size = ?
• see bloatwatch
• growth is in user space
• compare with platform size growth over same period
Security
• virtualization for Android
• Samsung using vmware for Android (to separate personal and business use of phone)
• Android and attacks
• Android has different security
• has there been a root exploit from a java app?
then and now
2003 - wanted trusted root (TPM), guard against exploits 2011 - have??
File Systems
• YAFFS2
• Mainline effort by Charles Manning
• LogFS
• Joern disappeared again
• Squashfs
• Now supports LZMA2 in mainline
• CELF funding SquashFS on MTD work
• Arnd Bergmann's work on optimizing Linux FS for cheap flash media
• See ELC presentation and Linaro page
• Tim Bird's treadahead work
• See ABS presentation
Legal Issues (licensing and patents)
• mobile patent wars
• Google buys Motorola for patent portfolio
• Apple blocks Samsung tablet introduction in Europe
Graphics
• OpenGL ES
• whither fbdev?
• 2D - Android doesn't have a native 2D API (or it's changing?)
• [RESEARCH - did Android drop it's native 2D API? (skia?)]
• GoogleTV 1.0 (logitech and Sony) use Sodaville, which is an Atom with a SGX535 core
• Intel work on graphics in kernel:
• See Kieth Packard's video from September 2010: [Meego Graphics under the hood: http://www.youtube.com/watch?v=YRYTCQqrFcA] OSCON 2010
• Working on grphics KMS and DRI in the kernel
• good for faster booting
• good for less flicker on transitions
• higher performance 3d graphics
• better memory management
• kernel can pull memory back from graphics processor on low-memory conditions
• [RESEARCH - status of memory allocation discussions at ELC?]
• per CRTC pixmaps
• allows for zero-copy rotations
• support for larger screens
• support for multiple screens
• wayland (non-X-windows)
• moving away from X on Meego
• support for multiple APIs
• EGL
• OpenGL 2.1 supported now, OpenGL 3.0 support coming soon
• geometry shaders, tesselation
• architecture:
user space: Open GL (compiler for shaders)
mesa
i915 driver
-------------------------------
graphics interface (is not opengl, but a device-specific abstraction)
-------------------------------
kernel space: DRI
i915 driver
kernel space driver is a small driver Combination of DRI and GPU-specific driver is called the Graphics Execution Manager (GEM)
• ABS Khronos standards talk? (no slides available)
Audio
Multimedia
• GStreamer - held first ever GStreamer conference in October (co-located with ELC Europe)
• Khronos is working on their stuff
Embedded-specific features
infrared remote control support
Middleware
• ???
Tools
Debuggers
build systems
• OpenEmbedded/Poky (Yocto is umbrella project)
• Appears to be gaining momentum - lots of companies (including Sony) using it now
• lots of new interesting features: graphical tool, can build an image for self-hosting a build, new compatibility badging program for meta-data
• Will provide LTSI kernels as part of offering
Tracing
• Common Trace format
• 2011 - lttng is shipped by most major distros (including yocto)
• 2011 - would be nice to get in Android?
Toolchains
eclipse stuff
• Yocto uses CDT remote launch, org.eclipse.cdt.launch.remote and TCF file/shells to transfer binaries and launch applications
• CDT = (C Development Toolkit)
• See: http://www.yoctoproject.org/projects/eclipse-ide-plug
• support communication with emulator or real device, via Yocto Eclipse TCF
• emulated devices use NFS rootfs so host and target access same filesystem
• debugging is via cross-gdb (gdbserver and gdb client on host)
emulators
Contract Work
• eMMC tuning guide - should be published in January
• Is coming along nicely
• has explanations about benchmarking, analysis of different tunable items in the filesystem stack
• has lots of results testing the following filesystems: ext3/4, BTRFS, F2FS, with different I/O schedulers (including the new ROW I/O Scheduler)
• has specific suggestions for what options are most effective to tune your filesystem, based on the characteristics of your flash device
Distributions
• Poky or Angstrom (OpenEmbedded/Yocto Project)
Distribution tools
Meego
• Meego - what's up now that Nokia bailed?
Android
• Tablets
• Some nice tablets based on 3.0 are coming out (will move to Android 3.1 over summer)
• phone activations? (350,000 per day, as of April 8, 2011)
• GoogleTV
• Every device will have 3.1 and adb, which means every device can be used for development
• will have market
• good talks at Google I/O about app and web development for TVs
Unbuntu TV
CPU support
Chip vendor news
• Texas Instruments leaves mobile and tablet market
• November 2012, announces layoffs of 1700, drops future OMAP lines
Miscellaneous
• unlockable bootloaders
• Announced by Motorola and Sony/Ericsson
• can unlock bootloader to install custom firmward
• wipes the phone to remove DRM-protected content
• Motorola says you can re-lock by going back to a vendor-supplied image
• version update support
• Announced at Google I/O
• multiple partners agree to provide version updates at regular intervals
Industry organizations or projects
• LiMo - anything happening?
• CELF => CEWG under Linux Foundation
• CELF projects
• Linux Foundation
• Lots of stuff going on in embedded:
• Yocto
• Meego
• CE Working Group
• Linaro - 1 year in
• see David Rusling's presentation from ELC
Trends
• movement to eclipse (both Yocto and Android support eclipse plugins for tools)
• movement to emulators
• application portability
• Android apps will be able to run just about anywhere
• Will an IOS emulator appear, or will apple strangle any attempts
• application stores
• multiple app stores will create competition (good)
• more open platforms
• Google TV
• lots of stuff that no one expects will appear
• development trends:
• new tools??
Resources
• lwn.net
• elinux.org
• stackoverflow.com
• kernelnewbies
• linuxfordevices.com
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:51:04.000Z
|
b6kx5cu74saatvzqo565lan3g5bon52a
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19371",
"uncompressed_offset": 87721372,
"url": "elinux.org/index.php?oldid=5478&title=Hisense",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://elinux.org/index.php?title=Hisense&oldid=5478"
}
|
cccc_CC-MAIN-2013-20
|
Hisense
From eLinux.org
Revision as of 19:36, 10 February 2008 by Glenn (Talk | contribs)
Jump to: navigation, search
US Digital (USDTV http://usdtv.com/) sold an HDTV Receiver called the DB-2010 manufactured by HiSense. The unit runs an embedded Linux 2.4.18-12 kernel, with usb-storage compiled into the kernel. They swap MTD flash RAM partitions 1 and 4 with each new firmware update (similar to Tivo).
The box has a card slot on the front, but there is no card reader behind the slot. It has a single USB port on the back that can be used to upgrade the firmware. This uses the AMD/ATI Xilleon 225, a MIPS processor.
Tim Riker wrote USDTV requesting the source code on 2006.03.22 and got this reply on 2006.03.31:
Dear Mr. Riker,
Your request for access to the GPL and LGPL source code used in the USDTV DB-2010
receiver was recently forwarded to me. First of all, let me assure you that we
at USDTV are fully aware of the terms of these software licenses. Many members
of our development team are long-time users and supporters of free and
open-source software.
As you have requested, we will make available for Internet file transfer copies
of the software used in the USDTV receiver that is covered by these licenses.
Unfortunately, your request has caught us at a bad time. The USDTV development
offices are currently in the process of moving to a new location, so we do not
at this time have a server to host copies of the software to download. Once our
move is completed and our full Internet service is restored, we will set up a
site with the requested software available. In the meantime, I have attached
below a list of software that we use; all of these packages should be available
for download elsewhere on the Internet.
Linux kernel version 2.4.18
glibc version 2.2.4
libpthread version 0.9
busybox version 0.60.0
GNU tar 1.13.19
gzip version 1.3
Thanks,
Jim Burmeister
Technical Lead, Set-Top Box Software Development
U.S. Digital Television
Some other emails have gone back and forth, but no sources have yet been made available to Tim Riker.
USDTV filed for Chapter 7 bankruptcy in the US District Court of Delaware, and approximately 6600 receivers (still new in box) will be sold on July 17th at 10:00AM at 12552 SOUTH 125 WEST, STE 200 DRAPER, UTAH (UPSTAIRS @ DAW GROUP BLDG).
For those of you that never received a firmware update, here is the update. It contains GPL code yet I have no method of extracting only that code. As the GPL portions are freely copyable, and not extractable, the package itself must also be copyable. Were it not so, the GPL would be violated, and I'm sure they would never do that. With no further ado, here are the packages. REMEMBER TO NOT INCLUDE THE DELETEME.txt ON THE USB STICK or the upgrade WILL FAIL.
The two different installed firmware images appear to use different digital signatures. This is why one firmware update will not run on the other machine. It is expected that they can be swapped, but we are not publishing this information yet. We expect to publish extracted filesystem images here soon.
File signatures compatible with the 2.7.15-FTA upgrade are computed by obtaining the 32-character MD5 checksum of the file, then performing an MD5 hash using the salt $1$@M&k=Ba}$
The low-level boot code is ATI's (now AMD's) proprietary version of MMON, very likely derived from Eric Smith's mmon MIPS monitor - http://www.brouhaha.com/~eric/software/mmon/
If you have other GPL-containing firmware updates you would like posted here, please contact Tim Riker.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:51:22.000Z
|
jq6len3bawkjb22ko7hgnianegopzrdu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19382",
"uncompressed_offset": 96551849,
"url": "familysearch.org/learn/wiki/en/Rotterdam,_New_York",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://familysearch.org/learn/wiki/en/Rotterdam,_New_York"
}
|
cccc_CC-MAIN-2013-20
|
Rotterdam, New YorkEdit This Page
From FamilySearch Wiki
United States New York Schenectady CountyTown of Rotterdam
Rotterdam, New York
Map
Schenectady County's location in the state of New York
Facts
Founded 1820
Website: www.rotterdamny.org/
Contents
Resources
Cemeteries
• Holy Cross Cemetery Phone: 518-374-5319
• Mt. Stuart Cemeteries (Jewish) For tombstone images see jewishdata.com (fee charged) Contact Werner Marx: wmrx@juno.
• Workmen’s Circle Cemetery 1910-2002
• Agudas Achim/ Free Jewish Cemetery, 1897-2002
• Beth Shalom Cemetery
Contact Congregation Beth Shalom, Clifton Park, NY CBshalom@nycap.rr.com
• Beth Israel Cemetery (Jewish) on Abbotsford Rd Contact Norman Greenfield e-mail: NG253@cnsibm.albany.edu
• Schenectady Memorial Park Phone: 518-372-0030
• Sts Cyril & Method Cemetery Phone: 518-374-5319
The Glenville historian as a copy of the records (518) 399-5349.
Church Records
• Keefer, Donald A. "Baptismal Records of the First (or Woestina) Reformed Church of Rotterdam, Schenectady County, New York," National Genealogical Society Quarterly, Vol. 52 (1964):77-85. FHL Book 973 B2ng v. 52 (1964).
Repositories
Archives, Libraries and Museums
Societies
Town Clerk
Town Clerk[1]
Michelle Gannon
1100 Sunrise Boulevard
Rotterdam, NY 12306
Phone: 518-355-7575 ext 320
Email: mgolden@rotterdamny.org
Town Historian
Town Historian [2]
Richard Whalen
Phone: 518-887-2451
Town Records
To locate additional published and transcribed records for Rotterdam, New York check:
• Gordon L. Remington, New York Towns, Villages, and Cities: A Guide to Genealogical Sources (Boston: New England Historic Genealogical Society, 2002). American Ancestors online edition; At various libraries (WorldCat); FHL Book 974.7 D27r. Alphabetical list including date founded, if a town history exists, church and cemetery sources, and if a Civil War register (TCR) exists. The codes used under Church and Cemetery are defined in the link above the listing of towns, cities and villages.
Vital Records
References
1. Schenectady Digital History Archive, Schenectady County, City and Town Clerks, Historians and Historical Societies at http://www.schenectadyhistory.org/contacts.html, accessed 9 December 2011.
2. Schenectady Digital History Archive, Schenectady County, City and Town Clerks, Historians and Historical Societies at http://www.schenectadyhistory.org/contacts.html, accessed 9 December 2011.
Places
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 14 March 2012, at 23:20.
• This page has been accessed 837 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:27:13.000Z
|
7klvdofuizdazgn3zyi35lty72oz5t56
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19383",
"uncompressed_offset": 96570326,
"url": "familysearch.org/learn/wiki/en/index.php?days=1&target=Maryland_Genealogy&title=Special%3ARecentChangesLinked",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=Special:RecentChangesLinked&days=1&target=Maryland_Genealogy"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "Maryland Genealogy"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 05:27, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:28:00.000Z
|
knjlhux4nja2td3agjwl7kzn3ici2wdz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19384",
"uncompressed_offset": 96580894,
"url": "familysearch.org/learn/wiki/en/index.php?limit=500&target=Tracing_Immigrants_Origin_Newspapers&title=Special%3ARecentChangesLinked",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=Special:RecentChangesLinked&limit=500&target=Tracing_Immigrants_Origin_Newspapers"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "Tracing Immigrants Origin Newspapers"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 06:28, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:25:32.000Z
|
jpr6ejoiohdzxvd6uefxmglhk3gnf2ss
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19411",
"uncompressed_offset": 144961448,
"url": "journals.tdl.org/icce/index.php/icce/article/view/4622/0",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/4622/0"
}
|
cccc_CC-MAIN-2013-20
|
TO RETREAT IN ORDER TO BETTER FIGHT : LITTORAL PROTECTION OF SHINGLE BEACHES IN THE NORTH OF FRANCE
Bruno Manoha, Charles Teisson
Abstract
Rather than endeavouring to protect a shoreline under severe waves attack, on the northern coast ofFRANCE, a new solution aretreat landwards up to 800 m. With a slight retreat (180 m), the orientation ofthe new shoreline is drawn according to the dominating wave climate and enables the stabilization of the beach. A larger retreat (800 m) could allow the re-estuarisation of a valley. These solutions are tested on a physical movable bed model.
Keywords
littoral protection; shingle beach; France
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:24:50.000Z
|
rwkey2bitspvwqprj3s6nujulcxg2nh6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19437",
"uncompressed_offset": 181942945,
"url": "myrightword.blogspot.co.il/2009/01/hamas-blamesisrael-for-hamas-killing-of.html",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://myrightword.blogspot.co.il/2009/01/hamas-blamesisrael-for-hamas-killing-of.html"
}
|
cccc_CC-MAIN-2013-20
|
Tuesday, January 27, 2009
Hamas Blames...Israel For Hamas' Killing of IDF Soldier
Mushir al-Masri, a Hamas leader, said Israel was to blame for continuing to fire into Gaza. Al-Masri said his group had not agreed to a full cease-fire but only to a "lull" in fighting.
"The Zionists are responsible for any aggression," he said.
So, this is no lullaby.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:11:18.000Z
|
vlcnnaowyi3qpf4mccbkf6kul7wyqdu4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19442",
"uncompressed_offset": 194961984,
"url": "openwetware.org/index.php?oldid=189364&title=User%3ARicardo_Vidal",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://openwetware.org/index.php?title=User:Ricardo_Vidal&oldid=189364"
}
|
cccc_CC-MAIN-2013-20
|
User:Ricardo Vidal
From OpenWetWare
Revision as of 11:57, 5 March 2008 by Ricardo Vidal (Talk | contribs)
Jump to: navigation, search
Having fun in Seville, Spain
Ricardo Vidal
I'm a student at University of Algarve (Portugal), currently completing my Master's in Biological Engineering.
I'm performing a 6 month internship at MIT/OpenWetWare where I'll be studying, researching and helping improve the connection and collaboration between experimental research labs and the latest web 2.0 tools, such as a wiki like OWW.
I've setup a page with more information regarding my internship
Recently completed projects
The design and preparation of an industrial bioprocessing plant for production of Cephalosporin-C using Acremonium chrysogenum.
Other information
Misc
Interesting links
How to write a research paper
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:37:07.000Z
|
qxmtdyxy2iu4kuetbxbzmlf26dv7gx65
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19464",
"uncompressed_offset": 212731105,
"url": "quotationsbook.com/quote/23041/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://quotationsbook.com/quote/23041/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
...and the practice of exercise and temperance had entitled him to a healthy old age.
The long recess between the Trinity and Michaelmas terms empties the colleges of Oxford, as well as the courts of Westminster. I spent, at my father's house at Beriton in Hampshire, the two months of August and September. It is whimsical enough, that as soon as I left Magdalen College, my taste for books began to revive; but it was the same blind and boyish taste for the pursuit of exotic history.
Unprovided with original learning, unformed in the habits of thinking, unskilled in the arts of composition, I resolved-to write a book. The title of this first Essay, The Age of Sesostris, was perhaps suggested by Voltaire's Age of Lewis XIV. which was new and popular; but my sole object was to investigate the probable date of the life and reign of the conqueror of Asia. I was then enamoured of Sir John Marsham's Canon Chronicus; an elaborate work, of whose merits and defects I was not yet qualified to judge. According to his specious, though narrow plan, I settled my hero about the time of Solomon, in the tenth... Gibbon, Edward
Excerpt from Memoirs of My Life and Writings · This quote is about learning · Search on Google Books to find all references and sources for this quotation.
A bit about Gibbon, Edward ...
Edward Gibbon (April 27, 1737 (O.S.) (May 8, 1737 (N.S.)) - January 16, 1794) was arguably the most influential historian since the time of Tacitus. His magnum opus, The History of the Decline and Fall of the Roman Empire, published between 1776 and 1788, is a groundbreaking work whose influence endures to this day.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:46:30.000Z
|
wnj5cyuokmm524qhzeucyeaochfdbzct
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19465",
"uncompressed_offset": 212748530,
"url": "quotationsbook.com/quotes/author/4007/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://quotationsbook.com/quotes/author/4007/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Kepler, Johannes
Johannes Kepler (December 27, 1571 November 15, 1630), a key figure in the scientific revolution, was a Lutheran mathematician, astrologer, and astronomer. He is best known for his laws of planetary motion, based on his Astronomia nova, Harmonice Mundi and the textbook Epitome of Copernican Astronomy..
"The diversity of the phenomena of nature is so great, and the treasures hidden in the heavens so rich, precisely in order that the human mind shall never be lacking in fresh nourishment."
Kepler, Johannes on nature
"Nature uses as little as possible of anything."
Kepler, Johannes on nature
Take a look at recent activity on QB!
Search Quotations Book
Photos >>
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:46:14.000Z
|
l5yemgdjaaqdy2qjlsxoilzhjj4vjeek
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19466",
"uncompressed_offset": 212759146,
"url": "quotationsbook.com/quotes/tag/nightmares/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://quotationsbook.com/quotes/tag/nightmares/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes about nightmares
These are quotes tagged with "nightmares". You can also search for quotes containing the word nightmares.
"I have had dreams, and I have had nightmares. I overcame the nightmares because of my dreams."
Salk, Dr. Jonas on nightmares
5 fans of this quote
Take a look at recent activity on QB!
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:42:36.000Z
|
mhinjb6o7ztwuswipzrkls732oy3bbz4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19470",
"uncompressed_offset": 216462974,
"url": "redsarmy.com/2011/01/04/your-morning-dump-where-wafers-great-game-might-be-one-of-his-last/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://redsarmy.com/2011/01/04/your-morning-dump-where-wafers-great-game-might-be-one-of-his-last/"
}
|
cccc_CC-MAIN-2013-20
|
Your Morning Dump… Where Wafer’s great game might be one of his last
RedsArmyAdmin January 4, 2011 Uncategorized 10 Comments
Photo by Elsa/Getty Images
Every morning, we compile the links of the day and dump them here… highlighting the big storyline. Because there's nothing quite as satisfying as a good morning dump.
"Well, we give him a lot of [grief] about it because — and we still give him [grief] — I think on media day he said, 'You know, I'm an offensive player,'" Rivers said with a smile, knowing full well that being an offensive player doesn't mean a thing on his squads.
"That was his quote. But he's proven to us that he's more than that. I think a lot of players have that in them, they just don't know it sometimes. We're getting it out of him, and he's actually enjoying it. It's funny to watch him — he gets excited about defensive stops now. And that's great, because I get excited about that as well."
Wafer appears to be carving out a role in that defense-first mentality, aided by an almost frenzied approach to defense as he often hounds the opposing ball-handler. At one point Monday, Wafer's inspired defense on an in-bound play led to a five-second violation early in the fourth quarter.
The 10 points he contributed Monday were nice, but forcing that type of turnover is what will keep him on the floor.
"Everybody else [plays defense]," Wafer said. "I don't want to be the only guy who doesn't. I wouldn't be here if I didn't buy in."
ESPN Boston: Von Wafer's tenacity paying dividends
Von Wafer is THE reason the Celtics won last night. Pierce's heroics don't happen… Ray's big 3 doesn't happen… if Von Wafer isn't in there to keep it close earlier in the game. The Celtics were doing a ton of standing around on both ends of the court and Wafer was actually active and moving.
That's the reason why he was able to grab so many rebounds. Sure, some of it was some measure of getting the right bounce… but Von put himself into great positions by playing good defense and found himself in spots to get the ball.
Von is finally getting the hang of it. Which makes this Globe story a little surprising
Wafer signed a nonguaranteed contract in August that becomes guaranteed for the rest of the season if he is on the roster Jan. 10. Wafer has improved defensively and has had his moments, such as scoring 10 points off the bench in a 96-93 victory over the Timberwolves last night, but the Celtics may waive him to increase roster flexibility. The Celtics have the maximum 15 players on their roster.
Teams are eligible to sign players to 10-day contracts starting tomorrow.
With all the Celtics injuries… with all the problems they've had… and with how he's played recently….
Are the Celtics REALLY going to waive Von Wafer now JUST so they might be able to sign someone at a different position later?
I understand that they're watching money. But he's not even making a million bucks. I don't see why a team that's been so hurt so far would just cut a healthy guy on the off chance they need to sign someone else later. I'm sure Danny is keeping all options open… but I can't see Von going away in the next week.
Related links: Herald: Doc talks up Wafer's defense | CSNNE: Allen's tough love for Wafer pays off | Celtics Blog: Wafer coming on strong
On Page 2: Delonte takes a huge step in his comeback
Calling it a big step, West had the hard cast protecting his healing right wrist removed on Monday, the first step of what he hopes could be a return on or shortly after the All-Star break. It was replaced with a brace to allow him some ability to start moving it for light rehab.
“It’s feels stiff but it’s not painful,” West said. “I got great news from doctors. They said maybe three weeks [then] rehabilitation. I’ve already started out conditioning, ball-handling. I’m left-handed anyway. Fortunately, I’m left handed anyway so I able to get shots on my left hand. It’s just a matter of time before I gain game strength in this one.
“Today is Day 1. I got a lot accomplished,” he said of Monday’s milestone in recovery.
As for watching the likes of Nate RobinsonVon WaferMarquis Daniels and even rookie Avery Bradleybeing forced to pick up the slack as Rajon Rondo‘s back-up, West admitted it’s been rough.
“I can’t wait to get back out there,” West said. “It’s killing me sitting back here and rooting from the sidelines but we all have a position to play and right now mine is getting healthy and getting ready to contribute.”
WEEI: Delonte gets some really good news about his right wrist
Allow me to state the obvious and say Delonte would make a HUGE impact on this second unit…. and maybe even on the first unit if we need Rajon Rondo to take a few games off in the next few months.
When you think about the injuries… Delonte will be back in about a month. Perk will be back at around that same time. And KG will have played his way back into shape by then. These guys can take some time to get back into the swing of things and the C's can have a couple of months playing at full strength right before the playoffs.
Considering how bad things have been injury-wise… this is a pretty good scenario.
Related links: ESPN Boston: Postgame notes: West has cast removed | CSNNE: West not expected back until after All Star break
The rest of the links:
ESPN Boston: Rapid Reaction | WEEI: Fast Break: Celtics outlast Minnesota | Finding ways to win | Herald: Celtics catch Wolves | Celtics better with Pierce scoring, not passing | Globe: Taking it away | Third quarter a real turning point for Pierce | CSNNE: Rondo back to being a player, not a coach | Pierce hits another Celtics milestone | Love owns glass for T'Wolves in loss | Celtics squeak out a win | CBS Sports: David Kahn predicts Darko will be an All Star
Like this Article? Share it!
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:27:31.000Z
|
hkspivflolceu6drzr5m4pr36w66tyne
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19533",
"uncompressed_offset": 295456428,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Lookup/1362.7Main%2BFeatures5Nov%2B2009",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Lookup/1362.7Main+Features5Nov+2009"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1362.7 - Regional Statistics, Northern Territory, Nov 2009
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/11/2009
Page tools: Print Page Print All RSS Search this Product
ENVIRONMENT
Northern Territory Climate, Environmental Views and Behaviour of Territorians, Energy Use and Production
NORTHERN TERRITORY CLIMATE
The Northern Territory (NT) comprises a land area of 1,346,200 km2, and is the third largest of the states and territories in area after Western Australia and Queensland.The NT sits within two climatic zones: the wet/dry tropics in the north; and the semi-arid to arid areas in the south. In the north the 'wet season' runs from 1 October to 30 April, and the 'dry season' runs from 1 May to 30 September. Relative humidity in the north is highest during the wet season and lowest at the height of the dry season. In contrast, the southern part of the NT is relatively dry for most of the year, with cool winters and hot summers. Information on the NT climate by location can be found on the Bureau of Meteorology's Northern Territory climate statistics webpage for variables such as temperature, relative humidity, wind speed and rainfall.
ENVIRONMENTAL VIEWS AND BEHAVIOUR OF TERRITORIANS
The environmental views and behaviour of Territorians is discussed in the feature article "Territorians Buck the Trend on Green Issues" and in the article "NT Keeps Cool" in Inform NT, Mar 2009 (cat. no. 1308.7).
Description of data availableLink to data
Environmental behaviour and practices in households by state/territory, March 2008Environmental Issues: Energy Use and Conservation, Mar 2008 (cat. no. 4602.0.55.001)
Environmental views and behaviour by state/territory, 2007–08Environmental Views and Behaviour, 2007–08 (2nd issue) (cat. no. 4626.0.55.001)
ENERGY USE AND PRODUCTION
Description of data availableLink to data
Electricity, use and generation, NT, 2006–07 to 2008–09Electricity, Use and Generation, NT, 2006–07 to 2008–09
Water and waste water, use and production, NT, 2002–03 to 2008–09Water and Waste Water, Use and Production, NT, 2002–03 to 2008–09
Other power and water statistics including environment and water quality reports and reports on Indigenous essential servicesPower and Water Corporation publications webpage
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:51:29.000Z
|
kvuvjs46mhmjaj3vnl4qnblwrgllpxrw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19535",
"uncompressed_offset": 295480078,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/mediareleasesbytitle/1D4B6FD8ED7D3BBFCA2568A9001362BD",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/mediareleasesbytitle/1D4B6FD8ED7D3BBFCA2568A9001362BD?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
7217.0 - Directory of Agricultural Statistics, 1998
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 21/10/1998 Ceased
Page tools: Print Page Print All RSS Search this Product
• About this Release
• New ABS statistical directory to help agricultural industry (Media Release)
MEDIA RELEASE
October 21, 1998
Embargoed: 11:30 AM (AEST)
103/98
New ABS statistical directory to help agricultural industry
A new directory of Agricultural Statistics released today by the Australian Bureau of Statistics provides the industry with a comprehensive directory of sources of agricultural information in Australia ranging from Federal departments to local marketing boards.
Primary producers, industry associations and researchers, government and other organisations interested in agriculture are expected to benefit from the directory which provides a description of the statistical collection, detail of the data collected, method of collection, geographic coverage, frequency of publication, availability of historical data and contact details for each entry. Indexes are also provided for quick reference to data sources and subjects.
The new directory was put together by the ABS to assist and encourage informed decision-making, research and discussion by government departments, consultants, academics, researchers, farmers, students, and other individuals and organisations involved in agriculture.
Australian agriculture contributes over 3 per cent annually to Australia's Gross Domestic Product. The diverse activities of the agriculture sector utilise approximately 60 per cent of Australia's land mass and provide employment for nearly 400,000 people. These activities range from cut-flower growing to pig farming and are conducted on approximately 150,000 farms across Australia.
The Directory of Agricultural Statistics (cat. no. 7217.0) is available from ABS Bookshops. Review copies are available for Media on request. Contact Catherine McDonald on (02) 6252 6728 to arrange a copy.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:57:18.000Z
|
k2sf3fuqev6vwfyihtbuec27nm5fz666
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19538",
"uncompressed_offset": 314749995,
"url": "www.appropedia.org/RBOSE",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.appropedia.org/RBOSE"
}
|
cccc_CC-MAIN-2013-20
|
RBOSE
From Appropedia
Jump to: navigation, search
RBOSE - Research Base for Open Source Environment is a totally free environment without leaders where you can collaborate with people on projects all around the world. RBOSE is a collaboration platform for the development of free and open source solutions based on resource management and implementing them in our daily lives. Dedicated to openness, fairness and transparency in development they value diversity, creativity and sustainability.
RBOSE includes RepRap (for rapid prototyping of 3D objects), and OSF, or Open Source Farming.
This page is a "stub" - it needs more content.
You are invited to add your knowledge.
No registration needed - just edit.
We monitor for spam and to keep these pages improving.
Personal tools
Collaborators
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:56:58.000Z
|
4zaqwfli3xkiujx2n7w5h6y5iyjb73wa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19541",
"uncompressed_offset": 339730484,
"url": "www.biomedcentral.com/1471-2407/12/211",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.biomedcentral.com/1471-2407/12/211"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Total and individual antioxidant intake and risk of epithelial ovarian cancer
Dina Gifkins1,2, Sara H Olson3, Lisa Paddock2,4, Melony King1,2, Kitaw Demissie1,2, Shou-En Lu1,2, Ah-Ng T Kong5, Lorna Rodriguez-Rodriguez1 and Elisa V Bandera1,2*
Author Affiliations
1 The Cancer Institute of New Jersey, Robert Wood Johnson Medical School, 195 Little Albany St., New Brunswick, NJ, 08903, USA
2 School of Public Health, University of Medicine and Dentistry of New Jersey, Piscataway, NJ, USA
3 Department of Epidemiology and Biostatistics, Memorial Sloan-Kettering Cancer Center, New York, NY, USA
4 New Jersey Department of Health and Senior Services, Trenton, NJ, USA
5 Rutgers University, Department of Pharmaceutics, Ernest Mario School of Pharmacy, Piscataway, NJ, USA
For all author emails, please log on.
BMC Cancer 2012, 12:211 doi:10.1186/1471-2407-12-211
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2407/12/211
Received:14 February 2012
Accepted:1 June 2012
Published:1 June 2012
© 2012 Gifkins et al.; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Limiting oxidative stress to the ovarian epithelium has been proposed as a first-line defense against ovarian cancer. Although evidence for an association between individual dietary antioxidant intake and ovarian cancer risk is conflicting, the combined evidence suggests a modest inverse association. Our study aimed to evaluate the association between total antioxidant capacity (TAC) and individual antioxidant intakes (vitamin C, vitamin E, beta-carotene, selenium, lutein, and lycopene) and ovarian cancer risk.
Methods
We conducted a population-based case–control study in New Jersey. Cases were women ages 21 years and older with newly diagnosed epithelial ovarian cancer who resided in six counties of New Jersey. Controls were women in the same age range who resided in the same geographic area. A total of 205 ovarian cancer cases and 390 controls were included. Dietary intake was ascertained using the Block food frequency questionnaire (FFQ), and TAC indices were constructed by linking FFQ-derived estimates to two standardized antioxidant capacity databases, the USDA Oxygen Radical Absorbance Capacity (ORAC) Database, and the University of Olso’s Antioxidant Food Database. Multivariate logistic regression models were used to calculate odds ratios and 95 % confidence intervals while controlling for major ovarian cancer risk factors.
Results
We found a strong inverse association with selenium from food sources (OR: 0.41; 95 % CI: 0.20-0.85, for the highest vs. lowest tertile of dietary selenium intake). However, there was little evidence of an association with dietary TAC or the others individual antioxidants. In contrast, compared to non-users, supplement users had significant increased risk for all micronutrients, but no statistically significant increased risk was observed for combined intake from foods and supplements of any of these antioxidants.
Conclusions
This study found an inverse association between selenium consumption from food sources and ovarian cancer risk, while there was little evidence of an association with TAC or any of the other individual antioxidants. Additional research is needed to confirm these findings.
Keywords:
Ovarian neoplasms; Antioxidants; Total antioxidant capacity; Vitamin C; Vitamin E; Beta-carotene; Selenium; Lutein; Lycopene; Diet
Introduction
Ovarian cancer is associated with the highest mortality among all gynecologic cancers [1]. Ovarian cancer is commonly referred to as a “silent killer”, as symptoms are often non-specific and women are therefore diagnosed in late stages of disease. Approximately 21,990 women were diagnosed in 2011, and 15,460 women died from ovarian cancer [1].
In ovarian cancer, more than 90 % of cancers originate from the surface epithelial cells [2]. The etiologic theory of incessant ovulation was proposed in the 1970’s by Fathalla [3], which suggests that repeated ovulations are responsible for transformation of the ovarian epithelium. Additional studies have shown that ovarian surface epithelial cells surrounding follicular rupture are exposed to mutagens, including both inflammatory mediators and oxidants, which are produced during the periovulatory period [4,5]. During the process of ovulation and luteinization, reactive oxidants are produced in excess. Additionally, processes which occur during periovulatory remodeling cause ovarian surface epithelial cells to suffer genomic damages leading to apoptosis, and surrounding cells are exposed to excessive reactive oxidants. Animal and human experimental studies have confirmed that surface ovarian epithelial cells contain elevated levels of 8-oxoguanine during ovulation, which is one of the most important mutagenic lesions in DNA [6,7]. It has therefore been suggested that limiting oxidative stress to the ovarian epithelium could be considered a first-line defense against ovarian cancer [6].
Although evidence for an association between individual dietary antioxidant intake and ovarian cancer risk is conflicting [8], the combined role of these micronutrients in the prevention of ovarian cancer has not been elucidated. As both individual contributions from micronutrients and combined additive or synergistic effects may alter risk, understanding the combined effect of antioxidant micronutrients on the risk of ovarian cancer may also help to develop a better understanding of their role in disease prevention.
We therefore sought to investigate the association between total antioxidant capacity (TAC) intake and ovarian cancer risk using data from standardized antioxidant databases in a population-based case–control study conducted in New Jersey [9,10]. As few studies have investigated the role of antioxidant supplement intake and ovarian cancer risk, and evidence on individual dietary antioxidants is inconclusive, we also investigated the association between individual antioxidant micronutrients from food and supplements with ovarian cancer risk.
Methods
The NJ Ovarian Cancer Study has been described in detail elsewhere [9,10]. It was designed using identical study instruments and a shared control group with the EDGE Study (Estrogen, Diet, Genetics, and Endometrial Cancer) [11,12], and was conducted in a collaboration between the Cancer Institute of New Jersey (CINJ), Memorial Sloan-Kettering Cancer Center (MSKCC), and the New Jersey State Cancer Registry (NJSCR), based at the New Jersey Department of Health and Senior Services (NJDHSS).
In brief, cases were women with newly diagnosed histologically confirmed invasive epithelial ovarian cancer identified between January 2004 and May 2008. Ovarian cancer cases aged 21 years or older who spoke English or Spanish and resided in six counties of New Jersey (Bergen, Essex, Hudson, Middlesex, Morris, or Union) were eligible to participate. Case ascertainment was conducted by the NJSCR using rapid case ascertainment, supplemented with review of NJSCR data to identify cases diagnosed out of the area. During the study period, 493 women were identified. Of those, 61 passed away before they could be interviewed, for 9 cases their physicians advised that we should not contact them, and an additional 119 cases were not able to participate for various reasons (e.g., found to be ineligible, unable to reach, communication barriers, comorbidities). Of the remaining women, 233 (47 %) ovarian cancer cases completed the interview.
Controls were women 21 years and older who resided in the same six counties as the cases (Bergen, Essex, Hudson, Middlesex, Morris, or Union) and spoke English or Spanish. Women who had a hysterectomy and/or a bilateral oophorectomy were not eligible to participate. To identify controls aged < 65 years, random digit dialing was conducted. Of the 355 eligible women identified, 175 (49 %) completed the interview. To identify women > 65 years of age, random selection was conducted from lists purchased from the Centers for Medicare and Medicaid. Of the 316 women who were contacted, 68 (22 %) completed the interview. However, the eligibility of 40 % was unknown. We conducted area sampling to identify additional controls older than 65 years, starting in 2003. Thirty consecutive households in randomly chosen neighborhoods were contacted by mail and by home visits. To better match the age distribution of the cases women aged 55 years and older were later included. Overall, 467 (40 %) controls completed the interview.
Informed consent was provided by all women participating in the studies, and IRB approval was obtained from the CINJ, MSKCC, and the NJDHSS.
Data collection
A questionnaire was administered to participants to collect data on potential and established ovarian cancer risk factors. Information on demographic characteristics, residential history, pregnancy history, occupation, oral contraceptive use and other birth control methods, menstrual history and menopausal status, personal and family history of cancer and other illnesses, height and weight, physical activity, and exposure to other potential risk factors was included.
To assess dietary intake, participants were asked to complete the Block Food Frequency Questionnaire (FFQ), version 98.2 (NutritionQuest, Berkeley, CA). Patients reported their usual dietary intake in the six months prior to their date of entry into the study for controls and their diagnosis date for cases. A total of 205 ovarian cancer cases and 398 controls completed the FFQ. Eight controls were further excluded as they had both ovaries removed and were therefore ineligible, leaving 390 controls available for analysis.
NutritionQuest provided nutrient calculations for individual antioxidants using the USDA Nutrient Database for Standard Reference. We derived TAC indices by linking FFQ-derived food consumption to two standardized antioxidant capacity databases, the USDA Oxygen Radical Absorbance Capacity (ORAC) Database (http://www.ars.usda.gov/sp2userfiles/place/12354500/data/orac/orac07.pdf webcite), and the University of Olso’s Antioxidant Food Database [13].
Total daily intake of food items known to be high in antioxidant content from the FFQ, including over 50 food items, such as fruits, vegetables, juices, grains, teas, chocolate and wine was computed first. Daily consumption was derived based on frequency and portion size, and food values were converted from their unit listed in the FFQ to grams per day, using values from the USDA Nutrient Database for Standard References (http://www.nal.usda.gov webcite).
The ORAC database, developed by the USDA Agricultural Research Service, was utilized to develop individual indices for TAC: total antioxidant capacity (T-ORAC), hydrophilic antioxidant capacity (H-ORAC), lipophilic antioxidant capacity (L-ORAC), and total phenolics (TP). Additionally, antioxidant values were derived using another database, the Antioxidant Food (FRAP) database, which is based on the electron transfer FRAP assay to extract antioxidant values. Both databases were used to assess the comparability of results using the two assays.
Antioxidant values were attributed to each food item based on the data in the antioxidant databases. The total umol of Trolox Equivalents per 100 grams per day for each food item and total mg gallic acid equivalents per 100 grams per day for each food item were calculated, and the total of all items were summed to develop each of the indices. Separate antioxidant indices were developed for total H-ORAC, L-ORAC, T-ORAC, and TP, from the ORAC database, and a TAC index was developed from the Antioxidant Food (FRAP) Database. As the ORAC database does not include values for antioxidant supplements, to compare the results of the TAC index from the ORAC database to that of the FRAP database, a TAC index without supplements based on the FRAP index was also developed.
Data analysis
The relationship between ovarian cancer and the TAC indices and individual antioxidants (vitamin C, vitamin E, beta-carotene, lycopene, lutein, and selenium, from food sources, supplements, and food and supplements combined) was assessed by evaluating the indices as categorical variables. Tertiles of each TAC index were created based on the distribution of each index among controls. Age-adjusted ANCOVA and cross-tabulations were conducted to assess any association between the TAC indices and case–control status. Multiple unconditional logistic regression models were developed to estimate odds ratios and 95 % confidence intervals while controlling for potential confounders. Potential covariates included age, body mass index (BMI), education (high school or less, college, graduate school), race, age at menarche (continuous), menopausal status, parity (0–1, 2, >3), oral contraceptive use (ever, never), hormone replacement therapy (HRT) use (never, used unopposed estrogen only, used combined therapy), tubal ligation, total energy intake (continuous), smoking status (never, current, former), alcohol consumption (continuous), and physical activity (continuous total metabolic equivalents). Tests for trend were derived by assigning a median value to each tertile of the antioxidant variables. All analyses were conducted using SAS software version 9.2.
Results
Demographic and patient characteristics are presented in Table 1. The majority of participants were white. As expected, odds ratios were below one for oral contraceptive use, higher parity, and a prior tubal ligation, and above one for having a first degree relative with ovarian cancer.
Table 1. Selected characteristics of women participating in The NJ Ovarian Cancer Study
Tables 2 and 3 show the age-adjusted mean intake for each TAC index and individual antioxidant micronutrients among cases and controls. Cases tended to have a slightly lower intake of total antioxidants. However, no significant differences were observed between cases and controls for any of the TAC indices or individual micronutrients.
Table 2. Age-adjusted mean total antioxidant capacity intake based on antioxidant indices in cases and controls
Table 3. Age-adjusted mean antioxidant micronutrient intake from foods and supplements
After adjusting for major risk factors, there was little evidence of an association with any of the TAC indices, as shown in Table 4. No association was observed for consumption of vitamin C, vitamin E, or beta-carotene from food sources, as shown in Table 5. However, intake of selenium from food sources was associated with a strong, significant inverse association with ovarian cancer risk (OR: 0.41; 95 % CI: 0.20-0.85 for the highest tertile compared to the lowest). In contrast, compared to non-users, ovarian cancer risk was elevated for supplement users of all individual antioxidants examined, with ORs (95 % CI) of 1.63 (1.01-2.62) for vitamin C, 1.63 (1.02-2.63) for vitamin E, 1.69 (1.08-2.66) for beta-carotene, and 1.64 (1.05-2.56) for selenium supplement users. No association was observed when the amount of antioxidant supplement intake was combined with dietary intake. There was a suggestion of increased risk for dietary lycopene (OR: 1.54; 95%CI: 0.90-2.62) and lutein (OR: 1.48; 95%CI: 0.82-2.68), but it was not statistically significant.
Table 4. Total antioxidant capacity intake based on antioxidant indices and ovarian cancer risk
Table 5. Antioxidant micronutrients from food and supplements and ovarian cancer risk
Discussion
In this study we found little evidence that the dietary TAC had an impact on ovarian cancer risk, based on antioxidant content values from the USDA ORAC database and the FRAP-based Antioxidant Food Database. In line with these findings, most individual micronutrients evaluated were also not found to be associated with ovarian cancer, with the exception of selenium. We found a statistically significant 60 % decreased risk of ovarian cancer for women in the highest tertile of selenium intake from food sources compared to the lowest. In contrast, we observed significant increased risk for users of all types of antioxidant supplements examined, compared to non-users. However, no increased risks were observed for the total amount of antioxidant intake when supplement amounts were combined with dietary intake.
Similar to our results, most studies investigating dietary vitamin C and ovarian cancer risk report no association [14-23]. However, some studies have found significant decreased risks [24-28]. The only two cohort studies evaluating vitamin C reported no association, including an analysis of the Nurse’s Health Study, which identified 301 ovarian cancer cases during a follow-up of 16 years [23]. Additionally, a meta-analysis of case-controls studies found no association, reporting a pooled OR of 0.98 (95 % CI: 0.95-1.01) for additional daily intake of 30 mg vitamin C [8]. Only one other study has investigated supplement use, and in contrast to our results found a significantly decreased risk of almost 50 %, and also reported a decreased risk for supplements combined with dietary intake [18].
We also found no association with vitamin E intake. Similarly, of all previously conducted studies evaluating vitamin E and ovarian cancer risk [14-18,21-24,26,29-31], most found no association. Only a few case–control studies reported decreased risks [17,24,26,31]. In contrast to our findings, the only two studies investigating supplement use reported strong inverse associations [18,30].
Consistent with our findings, several cohort studies [14,15,22,23] and some case–control studies [16,18,32] found no association with beta-carotene from food sources. Also, a meta-analysis of case–control studies reported no association (pooled OR: 0.98; 95 % CI: 0.96-0.99) for additional daily intake of 500mcg beta-carotene [8]. However, an inverse association with beta-carotene has been reported in other studies [17,26,27,29,31], and non-significant decreased risks have also been reported [21,33]. To our knowledge, our study is the first to investigate beta-carotene supplement use and ovarian cancer risk.
In support of our findings, a nested case–control study investigating the serum selenium status of ovarian cancer patients compared to healthy controls found that increasing serum selenium was associated with a decreased risk of ovarian cancer (OR: 0.23; 95%CI: 0.1-0.9 for highest tertile compared to lowest; p for trend = 0.02) [34]. Das and Ma (1986) reported similar findings, with a reverse correlation between serum selenium concentration and ovarian cancer incidence[35]. Additionally, Sieja (1998) found ovarian cancer patients had significantly lower serum selenium concentrations compared to controls (p < 0.05), approaching critical levels, particularly during chemotherapy treatment[36]. However, other studies investigating selenium intake from dietary and supplement sources [14,18,21], including an analysis of the Women’s Health Initiative [14], found no association with ovarian cancer risk. Tung et al. [21] assessed selenium intake among a multiethnic group of patients from Hawaii and Los Angeles and Fleischauer et al. [18] had a smaller number of cases (n = 169), and used both community and hospital-based controls. Differences in the study populations may partially explain the conflicting results.
Numerous studies have indicated that selenium may have anticancer properties. Human studies have shown a decrease in the incidence of prostate, lung, and colorectal cancers [37,38]. Additionally, animal studies have shown that, at high doses, selenium compounds reduce tumor yields, inhibit cell growth, and stimulate programmed cell death in cultures. In ovarian cancer cells, it has been demonstrated that selenium compounds inhibit the synthesis of nucleic acids (Rzaeva, 1985). Selenoprotein deficiency has also been found to be present in certain types of cancer. The proposed mechanism by which selenium may have a protective effect on cancer is mainly through its antioxidant properties. Selenium provides antioxidant protection against the effect of reactive oxygen species on cancer initiation and promotion [39]. Geographic variation in selenium concentrations exists, however no study has investigated whether ovarian cancer risk differs in areas with varying selenium concentrations.
Our conflicting findings of a protective effect associated with dietary selenium intake versus an increased risk associated with supplement intake are unclear. Of note, the increased risk observed with selenium supplements only reached statistical significance after further adjustment for physical activity and smoking status. It is possible that related unmeasured confounders may be influencing the association. Studies of supplement intake and relation with cancer risk have been conflicting. A recent systematic review concludes that evidence does not support selenium supplementation in the prevention of cancer [40]. Other reports have suggested that certain supplements may increase the risk of cancer, as has been recently observed with vitamin E supplementation and prostate cancer risk [41].
Only one other study has developed a total antioxidant score in ovarian cancer patients, using data from the Teacher’s Health Study in California [15]. However, this study only included antioxidant values from fruits and vegetables, identified from variable literature sources, and did not assess supplement use. Similar to our results, no association was observed.
This study may be subject to the limitations of case–control studies, such as recall bias and selection bias. Particularly with our finding of increased risk with supplements, it is possible that cases may have reported use differently than controls. We also had a low participation rate. Potential non-participation bias was assessed by comparing characteristics of women who participated in this study to cases who did not in the New Jersey State Cancer Registry during the study time period. Cases that consented tended to be younger; however the racial/ethnic distribution and distributions by histology, stage and grade were similar. We did not have information on women who did not end up participating as controls. However, the distribution of risk factors in this study is similar to that reported in other studies, which gives us reassurance in the validity of our data.
In conclusion, this study found a strong inverse association of selenium from food sources and ovarian cancer risk, while selenium supplement intake was associated with increased risk. However, we did not find any significant association between TAC intake and ovarian cancer risk. Supplement use in this study was found to be associated with increased ovarian cancer risk for all supplements studied. However, combined amounts of antioxidants from diet and supplement sources were not associated with increased risks. As several reports have recently raised concerns about the safety of vitamin supplements in recent years, including the 2007 WCRF/AICR Report which warned cancer patients and survivors against taking certain supplements [8], these findings warrant further investigation to better understand the role of selenium from foods and supplements on ovarian cancer risk.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
DG wrote the first draft of the manuscript. EVB conceptualized the study and provided overall supervision for conducting the study. DG, EVB, MK conducted data analyses. LEP implemented case ascertainment. Additional expertise was provided by KD, SHO (cancer epidemiology), LRR (gynecologic oncology), S-EL (biostatistics), A-NTK (antioxidants, carcinogenesis). All authors revised the article critically for important intellectual content and approved the final version of the manuscript.
Acknowledgments
We thank Thanusha Puvananayagam, Shameka Faulkner, Katherine Pulick, the interviewers and students who were involved in this study, the New Jersey Department of Health and Senior Services personnel, as well as all the participants who generously donated their time to the study. This work was funded by NIH-K07 CA095666, R01CA83918, The Cancer Institute of New Jersey, and NIH-K22CA138563.
References
1. American Cancer Society:
Cancer Facts & Figures. 2011. PubMed Abstract | Publisher Full Text
2. Torres MP, Ponnusamy MP, Lakshmanan I, Batra SK: Immunopathogenesis of ovarian cancer.
Minerva Med 2009, 100(5):385-400. PubMed Abstract | Publisher Full Text
3. Fathalla MF: Incessant ovulation–a factor in ovarian neoplasia?
Lancet 1971, 2(7716):163. PubMed Abstract
4. Behrman HR, Kodaman PH, Preston SL, Gao S: Oxidative stress and the ovary.
J Soc Gynecol Investig 2001, 8(1 Suppl Proceedings):S40-42. PubMed Abstract
5. Murdoch WJ, McDonnel AC: Roles of the ovarian surface epithelium in ovulation and carcinogenesis.
Reproduction 2002, 123(6):743-750. PubMed Abstract | Publisher Full Text
6. Murdoch WJ, Martinchick JF: Oxidative damage to DNA of ovarian surface epithelial cells affected by ovulation: carcinogenic implication and chemoprevention.
Exp Biol Med 2004, 229(6):546-552.
7. Murdoch WJ, Van Kirk EA, Alexander BM: DNA damages in ovarian surface epithelial cells of ovulatory hens.
Exp Biol Med 2005, 230(6):429-433.
8. World Cancer Research Fund, American Institute for Cancer Research: Food, Nutrition and the Prevention of Cancer: A Global Perspective. American Cancer Institute for Cancer Research, Washington, DC; 2007.
9. Bandera EV, King M, Chandran U, Paddock LE, Rodriguez-Rodriguez L, Olson SH: Phytoestrogen consumption from foods and supplements and epithelial ovarian cancer risk: a population-based case control study.
BMC Womens Health 2011, 11:40. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
10. Chandran U, Bandera EV, Williams-King MG, Paddock LE, Rodriguez-Rodriguez L, Lu SE, Faulkner S, Pulick K, Olson SH: Healthy eating index and ovarian cancer risk.
Cancer causes & control : CCC 2011, 22(4):563-571. PubMed Abstract | Publisher Full Text
11. Bandera EV, Williams MG, Sima C, Bayuga S, Pulick K, Wilcox H, Soslow R, Zauber AG, Olson SH: Phytoestrogen consumption and endometrial cancer risk: a population-based case–control study in New Jersey.
Cancer causes & control : CCC 2009, 20(7):1117-1127. PubMed Abstract | Publisher Full Text
12. Fortuny J, Sima C, Bayuga S, Wilcox H, Pulick K, Faulkner S, Zauber AG, Olson SH: Risk of endometrial cancer in relation to medical conditions and medication use.
Cancer Epidemiol Biomarkers Prev 2009, 18(5):1448-1456. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
13. Carlsen MH, Halvorsen BL, Holte K, Bohn SK, Dragland S, Sampson L, Willey C, Senoo H, Umezono Y, Sanada C, et al.: The total antioxidant content of more than 3100 foods, beverages, spices, herbs and supplements used worldwide.
Nutr J 2010, 9:3. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
14. Thomson CA, Neuhouser ML, Shikany JM, Caan BJ, Monk BJ, Mossavar-Rahmani Y, Sarto G, Parker LM, Modugno F, Anderson GL: The role of antioxidants and vitamin A in ovarian cancer: results from the Women's Health Initiative.
Nutr Cancer 2008, 60(6):710-719. PubMed Abstract | Publisher Full Text
15. Chang ET, Lee VS, Canchola AJ, Clarke CA, Purdie DM, Reynolds P, Anton-Culver H, Bernstein L, Deapen D, Peel D, et al.: Diet and risk of ovarian cancer in the California Teachers Study cohort.
Am J Epidemiol 2007, 165(7):802-813. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
16. Salazar-Martinez E, Lazcano-Ponce EC, Gonzalez Lira-Lira G, Escudero-De los Rios P, Hernandez-Avila M: Nutritional determinants of epithelial ovarian cancer risk: a case–control study in Mexico.
Oncology 2002, 63(2):151-157. PubMed Abstract | Publisher Full Text
17. Bidoli E, La Vecchia C, Talamini R, Negri E, Parpinel M, Conti E, Montella M, Carbone MA, Franceschi S: Micronutrients and ovarian cancer: a case–control study in Italy.
Annals of oncology : official journal of the European Society for Medical Oncology / ESMO 2001, 12(11):1589-1593. Publisher Full Text
18. Fleischauer AT, Olson SH, Mignone L, Simonsen N, Caputo TA, Harlap S: Dietary antioxidants, supplements, and risk of epithelial ovarian cancer.
Nutr Cancer 2001, 40(2):92-98. PubMed Abstract | Publisher Full Text
19. Shu XO, Gao YT, Yuan JM, Ziegler RG, Brinton LA: Dietary factors and epithelial ovarian cancer.
Br J Cancer 1989, 59(1):92-96. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
20. Byers T, Marshall J, Graham S, Mettlin C, Swanson M: A case–control study of dietary and nondietary factors in ovarian cancer.
J Natl Cancer Inst 1983, 71(4):681-686. PubMed Abstract
21. Tung KH, Wilkens LR, Wu AH, McDuffie K, Hankin JH, Nomura AM, Kolonel LN, Goodman MT: Association of dietary vitamin A, carotenoids, and other antioxidants with the risk of ovarian cancer.
Cancer Epidemiol Biomarkers Prev 2005, 14(3):669-676. PubMed Abstract | Publisher Full Text
22. Kushi LH, Mink PJ, Folsom AR, Anderson KE, Zheng W, Lazovich D, Sellers TA: Prospective study of diet and ovarian cancer.
Am J Epidemiol 1999, 149(1):21-31. PubMed Abstract | Publisher Full Text
23. Fairfield KM, Hankinson SE, Rosner BA, Hunter DJ, Colditz GA, Willett WC: Risk of ovarian carcinoma and consumption of vitamins A, C, and E and specific carotenoids: a prospective analysis.
Cancer 2001, 92(9):2318-2326. PubMed Abstract | Publisher Full Text
24. Zhang M, Lee AH, Binns CW: Physical activity and epithelial ovarian cancer risk: a case–control study in China.
International journal of cancer Journal international du cancer 2003, 105(6):838-843. PubMed Abstract | Publisher Full Text
25. McCann SE, Freudenheim JL, Marshall JR, Graham S: Risk of human ovarian cancer is related to dietary intake of selected nutrients, phytochemicals and food groups.
J Nutr 2003, 133(6):1937-1942. PubMed Abstract | Publisher Full Text
26. McCann SE, Moysich KB, Mettlin C: Intakes of selected nutrients and food groups and risk of ovarian cancer.
Nutr Cancer 2001, 39(1):19-28. PubMed Abstract | Publisher Full Text
27. Slattery ML, Schuman KL, West DW, French TK, Robison LM: Nutrient intake and ovarian cancer.
Am J Epidemiol 1989, 130(3):497-502. PubMed Abstract
28. Tzonou A, Hsieh CC, Polychronopoulou A, Kaprinis G, Toupadaki N, Trichopoulou A, Karakatsani A, Trichopoulos D: Diet and ovarian cancer: a case–control study in Greece.
International journal of cancer Journal international du cancer 1993, 55(3):411-414. PubMed Abstract
29. Cramer DW, Kuper H, Harlow BL, Titus-Ernstoff L: Carotenoids, antioxidants and ovarian cancer risk in pre- and postmenopausal women.
Int J Cancer 2001, 94(1):128-134. PubMed Abstract | Publisher Full Text
30. Pan SY, Ugnat AM, Mao Y, Wen SW, Johnson KC: Canadian Cancer Registries Epidemiology Research G: A case–control study of diet and the risk of ovarian cancer.
Cancer Epidemiol Biomarkers Prev 2004, 13(9):1521-1527. PubMed Abstract | Publisher Full Text
31. Jeong NH, Song ES, Lee JM, Lee KB, Kim MK, Cheon JE, Lee JK, Son SK, Lee JP, Kim JH, et al.: Plasma carotenoids, retinol and tocopherol levels and the risk of ovarian cancer.
Acta Obstet Gynecol Scand 2009, 88(4):457-462. PubMed Abstract | Publisher Full Text
32. Risch HA, Jain M, Marrett LD, Howe GR: Dietary fat intake and risk of epithelial ovarian cancer.
J Natl Cancer Inst 1994, 86(18):1409-1415. PubMed Abstract | Publisher Full Text
33. Engle A, Muscat JE, Harris RE: Nutritional risk factors and ovarian cancer.
Nutr Cancer 1991, 15(3–4):239-247. PubMed Abstract | Publisher Full Text
34. Helzlsouer KJ, Alberg AJ, Norkus EP, Morris JS, Hoffman SC, Comstock GW: Prospective study of serum micronutrients and ovarian cancer.
J Natl Cancer Inst 1996, 88(1):32-37. PubMed Abstract | Publisher Full Text
35. Das NP, Ma CW, Salmon YM: Serum selenium concentrations in ovarian cancer patients using a simplified fluorimetric procedure.
Biol Trace Element Res 1986, 10:215-222. Publisher Full Text
36. Sieja K: Selenium (Se) deficiency in women with ovarian cancer undergoing chemotherapy and the influence of supplementation with this micro-element on biochemical parameters.
Pharmazie 1998, 53(7):473-476. PubMed Abstract
37. Combs GF: Impact of selenium and cancer-prevention findings on the nutrition-health paradigm.
Nutr Cancer 2001, 40(1):6-11. PubMed Abstract | Publisher Full Text
38. Rayman MP: Selenium in cancer prevention: a review of the evidence and mechanism of action.
Proc Nutr Soc 2005, 64(4):527-542. PubMed Abstract | Publisher Full Text
39. Brozmanova J, Manikova D, Vlckova V, Chovanec M: Selenium: a double-edged sword for defense and offence in cancer.
Arch Toxicol 2010, 84(12):919-938. PubMed Abstract | Publisher Full Text
40. Dennert G, Zwahlen M, Brinkman M, Vinceti M, Zeegers MP, Horneber M: Selenium for preventing cancer.
Cochrane Database Syst Rev 2011, 5:CD005195. PubMed Abstract | Publisher Full Text
41. Klein EA, Thompson IM, Tangen CM, Crowley JJ, Lucia MS, Goodman PJ, Minasian LM, Ford LG, Parnes HL, Gaziano JM, et al.: Vitamin E and the risk of prostate cancer: the Selenium and Vitamin E Cancer Prevention Trial (SELECT).
JAMA 2011, 306(14):1549-1556. PubMed Abstract | Publisher Full Text
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2407/12/211/prepub
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:38.000Z
|
knmsmwz5fikrzqshqytkrdyhsmmy64oz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19555",
"uncompressed_offset": 425201734,
"url": "www.eea.europa.eu/data-and-maps/figures/annual-mean-no2-concentration-averaged-through-available-urban-background-stations-eea-member-countries/csi004_assessmentv6_figure05",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/figures/annual-mean-no2-concentration-averaged-through-available-urban-background-stations-eea-member-countries/csi004_assessmentv6_figure05"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55497 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
CSI004_AssessmentV7_Figure05
Download
There are currently no items in this folder.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:03:43.000Z
|
4z45sgeez7jm7eszztzuz2njht7j6fwt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19557",
"uncompressed_offset": 439760550,
"url": "www.familysearch.org/learn/wiki/en/Brockham_Green,_Surrey",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Brockham_Green,_Surrey"
}
|
cccc_CC-MAIN-2013-20
|
Brockham Green, SurreyEdit This Page
From FamilySearch Wiki
England Surrey Surrey Parishes
Contents
Parish History
'Brockham, or Brockham Green, a village and a chapelry in Betchworth, Surrey parish. The village stands on the river Mole, 1½ mile SW of Betchworth, and 2 E of Dorking. The chapelry was constituted in 1848. '[1]
Resources
Civil Registration
Birth, marriages and deaths were kept by the government, from July 1837 to the present day. The civil registration article tells more about these records. There are several Internet sites with name lists or indexes. A popular site is FreeBMD.
Church records
Contributor: Include here information for parish registers, Bishop’s Transcripts, non conformist and other types of church records, such as parish chest records. Add the contact information for the office holding the original records. Add links to the Family History Library Catalog showing the film numbers in their collection
Census records
Census records from 1841-1891 are available on film through a Family History Center or at the Family History Library. The first film number is 474664. To view these census images online, they are available through the following websites for a fee ($) or free:
• FamilySearch has some of the British Censuses available.
• FindMyPast ($) has all available census records including images, and is free at Family History Centers and the Family History Library and some public and academic libraries.
• Ancestry.co.uk ($) has now all available census records but free at Family History Centers and the Family History Library and at numerous public and academic libraries. The library versions are known as AncestryInstitution.com.
• The Genealogist.co.uk ($) has all available censuses and is free at Family History Centers and the Family History Library and various other libraries.
• FreeCen is a UK census searches. It is not complete and individuals are always asked to consider helping out with transcriptions.
Probate records
Surrey will abstracts (1470-1858) are available online at British Origins ($).[2]
Records of wills, administrations, inventories, indexes, etc. were filed by the court with jurisdiction over this parish. Go to Surrey Probate Records to find the name of the court having primary jurisdiction. Scroll down in the article to the section Court Jurisdictions by Parish.
Maps and Gazetteers
Maps are a visual look at the locations in England. Gazetteers contain brief summaries about a place.
Web sites
References
1. Wilson, John Marius, Imperial Gazetteer of England and Wales 1870-72. Accessed 5 March 2013. Adapted.
2. 'About Surrey and South London Will Abstracts 1470-1858,' Origins.net, accessed 27 June 2012.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 5 March 2013, at 17:24.
• This page has been accessed 384 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:52:16.000Z
|
3ga6vjai4run5xvjm2qxximgt7zyngvm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19558",
"uncompressed_offset": 439779741,
"url": "www.familysearch.org/learn/wiki/en/Dictionary_of_Genealogy_and_Archaic_Terms",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Dictionary_of_Genealogy_and_Archaic_Terms"
}
|
cccc_CC-MAIN-2013-20
|
Dictionary of Genealogy and Archaic TermsEdit This Page
From FamilySearch Wiki
Definitions of terms often found in historic records when researching one's ancestors.
Contents
Content
The terms included in the dictionary are those often found in records found when doing research about one's ancestors. This includes legal terms found in historical documents. In addition, terms that are used by the genealogical community today are also included.
Internet Address
or do a Google search for dictionary of genealogy terms
Using the Site
Browse for the word in the dictionary by selecting the first letter of the word you are searching for.
Cost
Free
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 18 August 2009, at 22:55.
• This page has been accessed 790 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:00:37.000Z
|
gw7a3ybjhffpc64oza7hbd55o5pxnuej
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19559",
"uncompressed_offset": 454007652,
"url": "www.forensicswiki.org/w/index.php?diff=14027&oldid=14015&title=Apple_iPhone",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=Apple_iPhone&diff=14027&oldid=14015"
}
|
cccc_CC-MAIN-2013-20
|
Error
Jump to: navigation, search
2 revisions of this difference (14015 and 14027) were not found.
This is usually caused by following an outdated diff link to a page that has been deleted. Details can be found in the deletion log.
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:52:51.000Z
|
tq2emarxagzjpmoykgktnzbgd6twctu3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19565",
"uncompressed_offset": 470316511,
"url": "www.go4expert.com/forums/using-movewindow-api-visual-basic-t412/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.go4expert.com/forums/using-movewindow-api-visual-basic-t412/"
}
|
cccc_CC-MAIN-2013-20
|
Using MoveWindow API in Visual Basic
Go4Expert Founder
20Aug2005,10:17 #1
Visual Basic Move Window API definition
Code:
Public Declare Function MoveWindow Lib "user32" Alias "MoveWindow"
(ByVal hwnd As Long, ' Handle to the Window e.g. Me.Hwnd
ByVal x As Long, ' New position of the left side of the Window/Form.
ByVal y As Long, ' New position of the top side of the Window/Form.
ByVal nWidth As Long, ' New width of the Window
ByVal nHeight As Long, ' New height of the Window
ByVal bRepaint As Long) ' Specifies whether Window is to be repainted. True means repainted
As Long ' If the function succeeds, the return value is nonzero else zero.
Also you should be careful about the OS version and according to the MSDN it states Minimum operating systems Windows 95, Windows NT 3.1
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:12:24.000Z
|
nw4txndsubxqasfesnm2egdaq4n4k3bn
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19568",
"uncompressed_offset": 488644117,
"url": "www.hindawi.com/journals/aaa/2012/641236/cta/",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.hindawi.com/journals/aaa/2012/641236/cta/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Abstract and Applied Analysis
Volume 2012 (2012), Article ID 641236, 15 pages
doi:10.1155/2012/641236
Research Article
A New Optimized Runge-Kutta Pair for the Numerical Solution of the Radial Schrödinger Equation
1School of Mathematics and Statistics, Zaozhuang University, Zaozhuang 277160, China
2Department of Mathematics, Chuzhou University, Chuzhou 239000, China
Received 9 May 2012; Revised 23 September 2012; Accepted 9 October 2012
Academic Editor: Malisa R. Zizovic
Copyright © 2012 Yonglei Fang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
How to Cite this Article
Yonglei Fang, Qinghong Li, Qinghe Ming, and Kaimin Wang, “A New Optimized Runge-Kutta Pair for the Numerical Solution of the Radial Schrödinger Equation,” Abstract and Applied Analysis, vol. 2012, Article ID 641236, 15 pages, 2012. doi:10.1155/2012/641236
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:13:20.000Z
|
jjxub5uiladqcphqhpyiopl5y7oolink
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19576",
"uncompressed_offset": 511478812,
"url": "www.isfdb.org/cgi-bin/publisheryear.cgi",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.isfdb.org/cgi-bin/publisheryear.cgi?1253+1998"
}
|
cccc_CC-MAIN-2013-20
|
Paper Tiger - Books Published in 1998
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Publications:
1-85028-411-3 The Flight of Dragons, 1998, £13.99, 134pp, tp , cover: Wayne Anderson Peter Dickinson
1-85585-463-5 The Book of Sea Monsters, Sep 1998, £14.99, 112pp, tp , cover: Bob Eggleton Nigel Suckling, Bob Eggleton
1-85585-640-9 Hindsight: Photographic Art of Boris Vallejo, 1998, £20.00, 128pp, hc Boris Vallejo
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:03:40.000Z
|
ios7dxllv2vprgy4kujqwb2cp43ukptw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19577",
"uncompressed_offset": 511481746,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?114967"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Outer Cyberspace
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Outer Cyberspace
Author: Bruce Sterling
Year: 1992
Type: ESSAY
Series: Science (F&SF)
ISFDB Record Number: 114967
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:42:55.000Z
|
yvu7m5ywkzwskea7wk34xhuofmxufwm6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19586",
"uncompressed_offset": 558568452,
"url": "www.mariowiki.com/Yebbi",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.mariowiki.com/Yebbi"
}
|
cccc_CC-MAIN-2013-20
|
Yebbi
From the Super Mario Wiki
Jump to: navigation, search
Yebbi, the yellow Nimbi sage.
“Are the fell beasts gone? So it is safe for me to come out thither?”
Yebbi, Super Paper Mario
Yebbi is a very important Nimbi in Super Paper Mario.
When Mario first encountered Yebbi, he actually had not seen him in person. Yebbi was afraid of the monsters invading The Overthere and decided to hide in a restroom. When Mario knocked, Yebbi asked who he was. The responses available to the player were: "Mario!", "Grambi!", and, comically, "A monster!"
If the player chooses to respond, "Mario!", Yebbi declares, "Mario? What a strange name! Thou must be a monster!" If the player responds "Grambi!", Yebbi insists "Grambi? Thou liest! Thou must be a monster!" Then, ironically, when the player responds "A monster!", he shouts, "Thou LIEST! No monster would admit to being a monster! Which means... thou art not a monster?" Then, he comes out of the restroom.
Even when he first came out, he was unwilling to give the party the orb, but he reluctantly agreed when Luvbi threatened to tell everyone he had been hiding in the bathroom. He came out and relinquished the Yellow Orb, which was required to build a bridge to Grambi's castle.
[edit] Names in Other Languages
Language Name Meaning
Japanese キーエル
kīeru
Yellow Eru
French Jaubi Comes from jaune (yellow) and "Nimbi"
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:44.000Z
|
v3papulqt3nsmqknbv4aozsfqjazakou
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19600",
"uncompressed_offset": 607795497,
"url": "www.openwetware.org/index.php?diff=prev&oldid=654737&title=BME103%3AW930_Group4",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.openwetware.org/index.php?title=BME103:W930_Group4&diff=prev&oldid=654737"
}
|
cccc_CC-MAIN-2013-20
|
BME103:W930 Group4
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(OUR TEAM)
(Protocols)
Line 97: Line 97:
[[Image:Fluorimeter Set up.jpg]]
[[Image:Fluorimeter Set up.jpg]]
<br>''Fluorimeter Assembly Procedeure:''<br>
<br>''Fluorimeter Assembly Procedeure:''<br>
-
1)Use pipettes to put two drops of dye and two drops of the sample on a glass slide.<br>
+
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br>
2)Do not use the same pipette for each sample.<br>
2)Do not use the same pipette for each sample.<br>
3)Place the glass slide on the device.<br>
3)Place the glass slide on the device.<br>
Revision as of 14:35, 14 November 2012
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Contents
OUR TEAM
Name: Renaad Alawi
Experiemental Protocol Planner
Name: Lauren Allison
Research and Development
Name: Jake Krammer
Open PCR Machine
Name: Jan Simper
Open PCR Machine
Name: Justus Vangor
Research and Development
Name: Christian Vargas
Experimental Protocol Planner
LAB 1 WRITE-UP
(Please finish by 11/7/2012)
Initial Machine Testing
The Original Design
The Polymerase Chain Reaction(PCR) machine essentially tests sequences of DNA for variations in nucleotides. This simple device is portable, easy to use, and relatively inexpensive. The LCD screen provides information on what step of the reaction is currently taking place. The heating lid heats up the samples contained within the sample holder, allowing the reaction to occur. The circuit board allows the fan, the heater, and the LCD screen to all run efficiently by connecting their wires to a central area. The PCR Machine is able to test up to 16 samples of DNA at a time and can be connected to a computer for ease of use. The machine heats up DNA samples so the samples disassociate allowing a primer to connect to the sequences of DNA and then the machine cools the DNA samples down with the primer in place.
Experimenting With the Connections
When the mounting plate was unplugged from the circuit board, the machine the LCD light and the menu on the PCR machine shut off.
When the white wire that connects the circuit board to the sample holder was unplugged, the temperature on the menu on the PCR machine dropped from room temperature to -40.0 degrees Celsius. The conclusion is that the white wire was the temperature sensor wire.
Test Run The date the OpenPCR Machine #4 was first tested was October 24, 2012. The test tubes were put into the machine and the handle was secured over them. There was a little difficulty in determining when to stop turning the handle. The software itself was simple and easy to use and there were no problems in running the OpenPCR software. After the reaction was complete, the tubes were taken out, labeled, and stored in a refrigerated area.
Protocols
Polymerase Chain Reaction
The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.
Thermal Cycling Process:
1)The DNA is first heated to 95 degrees Celsius which will in turn unzip the DNA to expose its bases and create two one-stranded strips
2)After primer is added to the solution, the DNA is then cooled down to 57 degrees Celsius so that the said primer can attach to a template sequence to form a forward primer.
3)The DNA is then once more heated to 72 degrees Celsius so that the replication process can be completed.
4)This process is repeated 30 more times to acquire a greater number of DNA samples.
PCR Master Mix Components:
-GoTaq® Colorless Master Mix, 2X 25μl
-upstream primer 10μM
-downstream primer 10μM
-DNA template 1–5μl
-Nuclease-Free Water to 50μl
Reagent Volume
Template DNA (20 ng) 0.2 µL
10 µM Forward Primer 1.0 µL
10 µM Reverse Primer 1.0 µL
GoTaq Master Mix 50.0 µL
dH2O 47.8 µL
Total Volume 100.0 µL
Patient Sample Descriptions:
Positive Control: Cancer DNA Template
Negative Control: DNA Template
Patient 1, Replicates(1,2,3):
ID: 80175
Gender: Female
Age: 59
Patient 2, Replicates(1,2,3):
ID: 57483
Gender: Male
Age: 56
Fluorimeter Measurements
Fluorimeter Assembly Set-Up
Fluorimeter Assembly Procedeure:
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.
2)Do not use the same pipette for each sample.
3)Place the glass slide on the device.
4)Turn on the blue LED light.
5)Place the smartphone on the holder provided and position them in front of the device.
6)Place a box on top of the device and smartphone to create a dark environment.
7)Take a close clear picture of the drop.
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the device.
Opening Images in Image J:
1)Using the android phone, email the pictures taken from the phone to the email of the ImageJ Software Operator.
2)Open the email of the ImageJ Operator and save the pictures onto the computer of the ImageJ Software Operator.
3)Open up the ImageJ Software.
4)Click File > Open.
5)Then select the images from wherever they were saved on the computer.
6)Click open and the image should appear in the program.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
What is the function of each component of a PCR reaction?
Template DNA: A double-stranded segment of DNA that encodes either a cancerous gene or a normal gene
Primers: Short segments of DNA that bind to a specific sequence of nucleotides (binds to cancer gene)
Taq Polymerase: A protein that serves as the catalyst for the DNA replication; grabs extra nucleotides within the solution and binds them to the "unzipped" strands
Magnesium Chloride: A cofactor that binds to the Taq Polymerase and affects the speed of the reaction; positive correlation between amount of magnesium chloride and reaction speed
dNTP's: Deoxynucleotide triphosphates; extra nucleotide bases in solution that are able to be grabbed and synthesized by Taq Polymerase to replicate DNA strands beyond the primer sequence
What happens during each step of thermal cycling?
• At 95° Celsius: DNA melts and "unzips" to create two one-stranded strips, primers are added to the solution
• At 57°Celsius: Primers attach to the corresponding template sequence they complement, forming one forward primer and one reverse primer
• At 72° Celsius: Taq Polymerase finishes the replication process with the use of dNTP's and magnesium chloride
Why does a cancer gene produce a positive result while a normal gene produces a negative?
• Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place.
Specific to this cancer gene:
The reverse primer that should bond to the cancer gene is AACTCTTACACTGCATACAT. The forward primer that should bond to the cancer gene is GTATAAGACATTCCTGTCCT (200 bp away from reverse)
Relation to Bayes' Rule:
In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients.
Specific to this cancer gene:
Approximately 1.1% of people have the C/T variation
p (hc|C) = p(C|hc) p(hc) / p(C)
where p(C)=5% and p(hc|C)=7.8%
Image Credit to OpenPCR.org/use-it/
Results
Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 2773313 0 Negative for gene
PCR: Positive Control 26759481 2 Positive for gene
PCR: Patient 1 ID 80175, rep 1 17085185 1.27694 Positive for gene
PCR: Patient 1 ID 80175, rep 2 12388707 0.92593 Positive for gene
PCR: Patient 1 ID 80175, rep 3 4620549 0.345339 Negative for gene
PCR: Patient 2 ID 57483, rep 1 16031260 1.19817 Positive for gene
PCR: Patient 2 ID 57483, rep 2 11636055 0.869677 Positive for gene
PCR: Patient 2 ID 57483, rep 3 18928511 1.41471 Positive for gene
KEY
• Sample = A sample is a set of DNA contained within one plastic tube.
• Integrated Density = Integrated density is an extensive quantity. It is the sum of the values of the pixels in the image or selection equivalent to the product of the area and mean gray value. We subtracted the integrated density of the background from the integrated density of our sample to obtain our data.
• DNA μg/mL = The concentration was obtained by dividing the integrated density of the sample with the background subtracted by the integrated density of the positive control with the background subtracted and multiplying by 2.
• Conclusion = Whether or not the sample was positive for the cancer gene.
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:04:21.000Z
|
cw3ll75azov6ni536tvgr7etwm6j6aeu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19601",
"uncompressed_offset": 607806513,
"url": "www.openwetware.org/index.php?oldid=201638&title=Category%3APeople_at_UNM",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.openwetware.org/index.php?title=Category:People_at_UNM&oldid=201638"
}
|
cccc_CC-MAIN-2013-20
|
Category:People at UNM
From OpenWetWare
Revision as of 13:53, 3 May 2008 by Bill Flanagan (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Users who are at the University of New Mexico.
Subcategories
This category has the following 2 subcategories, out of 2 total.
S
U
Pages in category "People at UNM"
The following 7 pages are in this category, out of 7 total.
U
U cont.
U cont.
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:44:58.000Z
|
66rs7ct6vfzbr7jdjiadnq5avwtk4m67
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19602",
"uncompressed_offset": 607812700,
"url": "www.openwetware.org/index.php?redirect=no&title=IGEM%3AHarvard%2F2007%2FMeetings",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.openwetware.org/index.php?title=IGEM:Harvard/2007/Meetings&redirect=no"
}
|
cccc_CC-MAIN-2013-20
|
IGEM:Harvard/2007/Meetings
From OpenWetWare
Jump to: navigation, search
Pre-iGEM planning meetings
Week 1
Week 2
Week 3
Week 4
Week 5
Week 6
Week 7
Week 8
Week 9
Week 10
Here is all of the presentations and general overview of the weekly meetings that took place during iGEM 2007. Special Thanks to Stephanie Lo for her notes, and to the iGEM members/advisors/TFs for their input.
-Kevin
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:28:36.000Z
|
63jlv56v35fr5avyk5m47e3tx4nijuph
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19604",
"uncompressed_offset": 619407324,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0031.tlg023.perseus-eng1%3A2.3",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0031.tlg023.perseus-eng1:2.3"
}
|
cccc_CC-MAIN-2013-20
|
[3] This is how we know that we know him: if we keep his commandments.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (Brooke Foss Westcott, Fenton John Anthony Hort, 1885)
load focus Latin (Saint Jerome, Bible Foundation and On-Line Book Initiative)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0031.tlg023.perseus-eng1:2.3
Document URN: urn:cts:greekLit:tlg0031.tlg023.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:02:36.000Z
|
66wlchidscd7mlyzg4r6r76jx3oyhww5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19628",
"uncompressed_offset": 766405262,
"url": "www.webos-internals.org/index.php?oldid=15533&title=Intercept_SSL_Traffic",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.webos-internals.org/index.php?title=Intercept_SSL_Traffic&oldid=15533"
}
|
cccc_CC-MAIN-2013-20
|
Intercept SSL Traffic
From WebOS Internals
Revision as of 12:33, 20 April 2011 by RodWhitby (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Run Internet Sharing on your host, gateway address is 10.0.2.1, client wifi address is 10.0.2.x
Contents
Run burpsuite
Assumes you want to intercept traffic to <target-host>:<target-port>
proxy listeners
• local listener port: 8443
• listen on loopback interface only: no
• support invisible proxying for non-proxy-aware clients: yes
• redirect to host: <target-host>
• redirect to port: <target-port>
server SSL certificate
• generate a CA-signed certification with a specific hostname: <target-host>
intercept client requests
• intercept-if: yes
• update Content-Length: yes
intercept server responses
• intercept-if: yes
• update Content-Length: yes
misc
• unpack gzip / deflate: yes
On the device
iptables -t nat -A OUTPUT -p tcp --dst <target-host> --dport <target-port> -j DNAT --to-destination <intercept-host>:<intercept-port>
openssl s_client -connect <target-host>:<target-port> -showcerts
copy the PortSwigger server CA cert into /etc/ssl/certs/trustedcerts/PortSwigger.pem
link it into /etc/ssl/certs/trustedcerts/ and /var/ssl/trustedcerts/ as <hash>.0
openssl x509 -hash -noout < PortSwigger.pem
Personal tools
Google AdSense
WebOS Internals is Hosted by
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:59:30.000Z
|
pgcyrpbqc2llouppv3hmwm7yxzj26vmj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19629",
"uncompressed_offset": 767948904,
"url": "www.werelate.org/wiki/Person:John_Crow_%2837%29",
"warc_date": "2013-11-22T14:52:47.000Z",
"warc_filename": "<urn:uuid:8935b760-6762-44c2-bb7b-eb58767a9d19>",
"warc_url": "http://www.werelate.org/wiki/Person:John_Crow_(37)"
}
|
cccc_CC-MAIN-2013-20
|
Person:John Crow (37)
Watchers
John Crow
b.ABT 1845
Facts and Events
Name John Crow
Gender Male
Birth[1] ABT 1845
Alt Death[3] 26 Feb 1864
Death[1][3] 7 MAY 1864 Knoxville, Knox, Tennessee, United States
Burial? Knoxville National Cemetery, Knoxville, Knox, Tennessee, United StatesSec C, grave 767
Civil War Service
Source: 1
Pension
• Mother's Pension: Application 172182 (no certificate number listed -- an indication that it was not approved)
• Father's Pension: Application 293145, Certificate 274148
Source: S2
References
1. 1.0 1.1 Foraker, J.B; H.A. Axline; and J.S. Robinson. Official roster of the soldiers of the state of Ohio in the War of the Rebellion, 1861-1866. (Akron [Ohio]: Werner Co., 1886-1895).
2. United States. Veterans Administration. Organization index to pension files of veterans who served between 1861 and 1900- [1917]. (Washington, District of Columbia: The National Archives, 1949).
3. 3.0 3.1 The Official Roster lists his date of death as 7 May 1864; his tombstone lists it as 26 February 1864. It should be noted that the tombstone appears to be a more recent government-issued tombstone, as it is not in the same style as those issued during or immediately after the Civil War. Perhaps it is a replacement.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:59:17.000Z
|
4b2nszr3i3nce63o3gdvjid4id4fq4t4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19643",
"uncompressed_offset": 18748400,
"url": "autisminnb.blogspot.com/2011/11/mottron-mantra-autism-is-advantage-not.html",
"warc_date": "2013-11-22T14:54:08.000Z",
"warc_filename": "<urn:uuid:a33efe70-79b5-4dae-be7d-7e31697319f1>",
"warc_url": "http://autisminnb.blogspot.com/2011/11/mottron-mantra-autism-is-advantage-not.html"
}
|
cccc_CC-MAIN-2013-20
|
Friday, November 04, 2011
The Mottron Mantra: Autism Is An Advantage Not A Disorder
The DLM5: Dr. Laurent Mottron's Diagnostic
and Statistical Manual of Mental Advantages
If you authored or coauthored several journal articles a year over many years, involving high functioning, highly intelligent persons with autism and surrounded yourself with very intelligent, high functioning autistic researchers would they influence your perception of autism? In the case of psychiatrist, and anti-autism cure, anti-ABA activist, Dr. Laurent Mottron, who has published many journal articles involving high functioning autism participants, the answer is yes.
Dr. Motton has acknowledged repeatedly that his perception of autism has been influenced by his professional relationship with the very intelligent, high functioning autistic Michelle Dawson. In his latest comment in the journal Nature Dr. Mottron states that the half dozen autistic persons who form part of his research team are "typical autistics".
As the father of a son who is not one of Mottron's "typical autistics", who is in fact one of the approximately 70% of persons with Autistic Disorder (not autism generally) who also have intellectual disabilities and is severely affected in his understanding of the world and his daily functioning skills I am left shaking my head once again at Dr. Mottron's characterizations of autism. Once again, prominent media headlines around the world are screaming the Mottron mantra that autism is an "advantage".
Dr. Mottron acknowledges that many with autism are considered intellectually disabled although he expresses his doubts about the figures, saying he doesn't believe them. His vague caveats about the serious challenges faced by so many with autism are buried in the article and do not form part of the autism is an advantage headlines.
Maybe Dr. Mottron should start hiring some of the many persons with Autistic Disorder and intellectual disabilities, including some of the adults living in institutions including psychiatric hospitals. Maybe he should get out of his lab and join one of the search and rescue teams that are regularly called out to find autistic children who wander away from home and school. Perhaps he could join the tertiary care team at the Stan Cassidy Center here in Fredericton and help the autistic children and youth with severe behaviour challenges that they treat. The caseload the Stan Cassidy handles is so overwhelming that the administration had planned a few years ago to disband the autism team because the workload was so great it was threatening its ability to provide other services offered by the center to persons with neurological injuries. The autism team was continued after public opposition led by parents of children with autism, parents who have to deal 24/7 with the daily realities of their children's autism disorders.
I am surprised Dr. Mottron is not fighting the American Psychiatric Association's proposal to combine the various autism disorders into one new Autism Spectrum Disorder in the DSM5, the proposed new version of the APA's Diagnostic and Statistical Manual of Mental Disorders. After all "typical" autism for Dr. Mottron is not a disorder, it is an advantage.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:29:53.000Z
|
l4cemlws2ky3hc737umflweqiszz5i6j
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19666",
"uncompressed_offset": 44483283,
"url": "ccsenet.org/journal/index.php/jsd/article/view/15991",
"warc_date": "2013-11-22T14:54:08.000Z",
"warc_filename": "<urn:uuid:a33efe70-79b5-4dae-be7d-7e31697319f1>",
"warc_url": "http://ccsenet.org/journal/index.php/jsd/article/view/15991"
}
|
cccc_CC-MAIN-2013-20
|
Stakeholders’ Participation in Water Management: A Case Study of the Msunduzi Catchment Management
Boakye M. K., Akpor O. B.
Abstract
Public participation is widely accepted as a critical component of managing water resources in South Africa; hence it is strongly emphasized in the South African National Water Act. Although the importance of an enabling legislation and policy on public participation is highly appreciated; this is not sufficient enough to support meaningful participation of the public, particularly those from disadvantaged communities. This study was therefore aimed at investigating the extent of participation of previously disadvantaged communities in water management. To achieve this objective, the study employed a qualitative approach that involved the use of primary and secondary data sources. The results obtained revealed the lack of meaningful participation by disadvantaged communities in water management decisions. This is because the majority of individuals that may have interest in water resource management are excluded in such decisions at the community level. It was also observed that the organizations that attended the forum do not interact with their community, hence did not serve as intermediaries between the South African Department of Water Affairs (DWA) and their communities. The reliance of the DWA on community organizations in catchment is ineffective. In addition, the few participants from disadvantaged communities who are part of the forum do not understand the technical nature of information presented. It is therefore important that more emphasis be placed on the development of skills and capacity of participants to understand and make meaningful contributions, especially those from the disadvantaged communities.
Full Text: PDF DOI: 10.5539/jsd.v5n6p104
This work is licensed under a Creative Commons Attribution 3.0 License.
Journal of Sustainable Development ISSN 1913-9063 (Print) ISSN 1913-9071 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:31:58.000Z
|
xzniv3wqtvg5vbnaiwrjx4mufoiifika
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19669",
"uncompressed_offset": 54423004,
"url": "cnx.org/content/m41680/1.2/content_info",
"warc_date": "2013-11-22T14:54:08.000Z",
"warc_filename": "<urn:uuid:a33efe70-79b5-4dae-be7d-7e31697319f1>",
"warc_url": "http://cnx.org/content/m41680/1.2/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » IIR filters
About: IIR filters
Module by: Ricardo Vargas. E-mail the author
View the content: IIR filters
Metadata
Name: IIR filters
ID: m41680
Language: English (en)
Subject: Science and Technology
License: Creative Commons Attribution License CC-BY 3.0
Authors: Ricardo Vargas (richv68@hotmail.com)
Copyright Holders: Ricardo Vargas (richv68@hotmail.com)
Maintainers: Ricardo Vargas (richv68@hotmail.com), Daniel Williamson (dcwill@cnx.org), C. Sidney Burrus (csb@rice.edu), Jared Adler (jca2@rice.edu)
Latest version: 1.2 (history)
First publication date: Mar 11, 2010 4:01 pm -0600
Last revision to module: Dec 7, 2011 4:30 pm -0600
Downloads
PDF: m41680_1.2.pdf PDF file, for viewing content offline and printing. Learn more.
EPUB: m41680_1.2.epub Electronic publication file, for viewing in handheld devices. Learn more.
XML: m41680_1.2.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Source Export ZIP: m41680_1.2.zip ZIP containing the module XML plus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.2 Dec 7, 2011 4:30 pm -0600 by Daniel Williamson
Changes:
Change Title
Version: 1.1 Dec 6, 2011 12:44 pm -0600 by Ricardo Vargas
Changes:
Published.
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Ricardo Vargas
• the title of the work: IIR filters
• the Connexions URL where the work can be found: http://cnx.org/content/m41680/1.2/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Vargas, R. IIR filters, Connexions Web site. http://cnx.org/content/m41680/1.2/, Dec 7, 2011.
American Medical Assocation (AMA) Manual of Style:
Vargas R. IIR filters [Connexions Web site]. December 7, 2011. Available at: http://cnx.org/content/m41680/1.2/.
American Psychological Assocation (APA) Publication Manual:
Vargas, R. (2011, December 7). IIR filters. Retrieved from the Connexions Web site: http://cnx.org/content/m41680/1.2/
Chicago Manual of Style (Bibliography):
Vargas, Ricardo. "IIR filters." Connexions. December 7, 2011. http://cnx.org/content/m41680/1.2/.
Chicago Manual of Style (Note):
Ricardo Vargas, "IIR filters," Connexions, December 7, 2011, http://cnx.org/content/m41680/1.2/.
Chicago Manual of Style (Reference, in Author-Date style):
Vargas, R. 2011. IIR filters. Connexions, December 7, 2011. http://cnx.org/content/m41680/1.2/.
Modern Languages Association (MLA) Style Manual:
Vargas, Ricardo. IIR filters. Connexions. 7 Dec. 2011 <http://cnx.org/content/m41680/1.2/>.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:34:10.000Z
|
g3zpqtw3oninan3nu67yodgis74pxag3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19680",
"uncompressed_offset": 64921982,
"url": "daviswiki.org/The_Flying_Carousel_of_the_Delta_Breeze?action=Files&do=view&target=Carousel_cow_dog.jpg",
"warc_date": "2013-11-22T14:54:08.000Z",
"warc_filename": "<urn:uuid:a33efe70-79b5-4dae-be7d-7e31697319f1>",
"warc_url": "http://daviswiki.org/The_Flying_Carousel_of_the_Delta_Breeze?action=Files&do=view&target=Carousel_cow_dog.jpg"
}
|
cccc_CC-MAIN-2013-20
|
The Flying Carousel of the Delta Breeze
Info Map
Search:
Image 'Carousel_cow_dog.jpg' of page The Flying Carousel of the Delta Breeze:
Daisy the Cow and Bob the Dog
Uploaded by LillianChow on 2007-04-21 16:37:01. File size: 299KB
This is a Wiki Spot wiki. Wiki Spot is a 501(c)3 non-profit organization that helps communities collaborate via wikis.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:33:21.000Z
|
vffp56ecrsihpqk3vxa7rhxm6l4kvwzy
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:19687",
"uncompressed_offset": 76828498,
"url": "dotnetkicks.com/tags/c3",
"warc_date": "2013-11-22T14:54:08.000Z",
"warc_filename": "<urn:uuid:a33efe70-79b5-4dae-be7d-7e31697319f1>",
"warc_url": "http://dotnetkicks.com/tags/c3"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
By tag: c3
showing: of
0
kicks
AsyncWebService calls – the truth behind the Begin.. End.. Methods (Unpublished)
Long story short, if you want to shotgun your webservice requests, make synchronous calls from worker threads and take the time to get that right.
Kicked By:
Drop Kicked By:
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.